Starting /dee2/code/volunteer_pipeline.sh SRR8618219 current disk space = 1544828383232 free memory = 1596802184 SRR8618219 SRAfilesize 4e5d6a45f2fcb1030f79e41978c074fa SRR8618219.sra SRR8618219.sra file validated SRR8618219 is paired end SRR8618219 is conventional basespace SRR8618219 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618219_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88175 34.0 31.0 34.0 31.0 34.0 2 33.18175 34.0 33.0 34.0 31.0 34.0 3 33.27525 34.0 34.0 34.0 31.0 34.0 4 35.46825 37.0 37.0 37.0 35.0 37.0 5 36.02325 37.0 37.0 37.0 35.0 37.0 6 36.38825 37.0 37.0 37.0 35.0 37.0 7 36.07625 37.0 37.0 37.0 35.0 37.0 8 36.408 37.0 37.0 37.0 35.0 37.0 9 38.31075 39.0 39.0 39.0 37.0 39.0 10-11 38.388 39.0 39.0 39.0 37.0 39.0 12-13 38.387375000000006 39.0 39.0 39.0 37.0 39.0 14-15 39.993375 41.0 40.0 41.0 38.0 41.0 16-17 39.926874999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.870875 41.0 40.0 41.0 38.0 41.0 20-21 39.846125 41.0 40.0 41.0 38.0 41.0 22-23 39.705625 41.0 40.0 41.0 37.5 41.0 24-25 39.561 41.0 39.0 41.0 37.0 41.0 26-27 39.454875 40.5 39.0 41.0 36.0 41.0 28-29 39.247749999999996 40.0 38.5 41.0 36.0 41.0 30-31 39.027875 40.0 38.0 41.0 35.0 41.0 32-33 38.871625 40.0 38.0 41.0 35.0 41.0 34-35 39.11925 40.0 38.0 41.0 35.0 41.0 36-37 39.17 40.0 38.0 41.0 35.0 41.0 38-39 38.962875 40.0 38.0 41.0 35.0 41.0 40-41 38.793625000000006 40.0 37.5 41.0 35.0 41.0 42-43 38.511250000000004 40.0 37.0 41.0 35.0 41.0 44-45 38.339124999999996 40.0 36.0 41.0 35.0 41.0 46-47 38.07275 39.5 35.0 41.0 34.5 41.0 48-49 37.847625 39.0 35.0 41.0 34.0 41.0 50-51 37.605374999999995 39.0 35.0 41.0 34.0 41.0 52-53 37.376625000000004 38.0 35.0 41.0 33.0 41.0 54-55 36.9625 37.0 35.0 40.5 33.0 41.0 56-57 36.743375 37.0 35.0 40.0 33.0 41.0 58-59 36.431749999999994 36.0 35.0 40.0 33.0 41.0 60-61 36.144625000000005 35.5 35.0 39.5 32.5 41.0 62-63 35.886624999999995 35.0 35.0 39.0 32.0 41.0 64-65 35.532 35.0 34.5 39.0 31.5 41.0 66-67 35.292 35.0 34.0 37.5 31.0 40.5 68-69 35.002375 35.0 34.0 37.0 31.0 40.0 70-71 34.796375 35.0 34.0 36.5 31.0 39.0 72-73 34.455124999999995 35.0 34.0 36.0 30.5 39.0 74-75 34.164 35.0 34.0 35.5 30.0 38.0 76-77 33.353125 34.5 32.5 35.0 28.5 37.0 78-79 33.853625 35.0 33.0 35.0 30.0 37.0 80-81 33.793125 35.0 33.0 35.0 30.0 36.0 82-83 33.46 35.0 33.0 35.0 29.5 36.0 84-85 33.290625 35.0 33.0 35.0 29.0 36.0 86-87 33.002125 35.0 33.0 35.0 29.0 35.0 88-89 32.8155 35.0 33.0 35.0 28.0 35.0 90-91 32.504374999999996 35.0 33.0 35.0 27.0 35.0 92-93 32.176500000000004 35.0 32.0 35.0 27.0 35.0 94-95 32.02225 35.0 32.0 35.0 27.0 35.0 96-97 31.658875000000002 34.5 32.0 35.0 25.0 35.0 98-99 31.259125 34.0 32.0 35.0 24.5 35.0 100 30.9115 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.052914427449358925 1101 2 0.1343013642000841 1101 3 0.13094253823894064 1101 4 -0.8158329888383662 1101 5 -0.30229433650269044 1101 6 0.01245349317900235 1101 7 -0.30379288962381423 1101 8 -0.09544233154196036 1101 9 0.044129805704841374 1101 10-11 0.13140760644894556 1101 12-13 0.07913910706903948 1101 14-15 0.08944811905745809 1101 16-17 0.12531004547334135 1101 18-19 0.20499173212071042 1101 20-21 0.06955353451839841 1101 22-23 0.26979123604795063 1101 24-25 0.33621847871021515 1101 26-27 0.16721785861926008 1101 28-29 0.1806531624638268 1101 30-31 0.15990595287308906 1101 32-33 0.07319656883009884 1101 34-35 0.12241628772220281 1101 36-37 0.18840429929722546 1101 38-39 0.36174555601488123 1101 40-41 0.344460520876396 1101 42-43 0.3972457627118686 1101 44-45 0.20463001240182166 1101 46-47 0.18375361719719052 1101 48-49 0.10699152542373014 1101 50-51 0.1953803224472921 1101 52-53 0.169388176932614 1101 54-55 0.3262195121951237 1101 56-57 0.0667114510128144 1101 58-59 0.3006149235221187 1101 60-61 0.22883939644481188 1101 62-63 0.21827201322860645 1101 64-65 0.16006097560975263 1101 66-67 0.3210004133939677 1101 68-69 0.22573894171145525 1101 70-71 0.039349937990905914 1101 72-73 0.1011781727986758 1101 74-75 0.1294181479950396 1101 76-77 0.0828596527490717 1101 78-79 0.27304671351798504 1101 80-81 0.16858722612649757 1101 82-83 0.04756614303431661 1101 84-85 0.197266432410089 1101 86-87 -0.013642000826784795 1101 88-89 0.0289117403885939 1101 90-91 0.18693158329888604 1101 92-93 0.3774545266639109 1101 94-95 0.024855312112443073 1101 96-97 -0.13711761058288374 1101 98-99 -0.07686544026456943 1101 100 0.09125671765192322 1104 1 -0.05291442744936603 1104 2 -0.1343013642000841 1104 3 -0.13094253823894064 1104 4 0.8158329888383591 1104 5 0.30229433650268334 1104 6 -0.01245349317900235 1104 7 0.3037928896238071 1104 8 0.09544233154196036 1104 9 -0.04412980570483427 1104 10-11 -0.13140760644894556 1104 12-13 -0.07913910706903238 1104 14-15 -0.08944811905745809 1104 16-17 -0.12531004547333424 1104 18-19 -0.20499173212071042 1104 20-21 -0.0695535345183913 1104 22-23 -0.26979123604795774 1104 24-25 -0.33621847871020805 1104 26-27 -0.16721785861926008 1104 28-29 -0.1806531624638268 1104 30-31 -0.15990595287308906 1104 32-33 -0.07319656883009173 1104 34-35 -0.12241628772220281 1104 36-37 -0.18840429929723257 1104 38-39 -0.36174555601488123 1104 40-41 -0.344460520876396 1104 42-43 -0.3972457627118615 1104 44-45 -0.20463001240182166 1104 46-47 -0.18375361719718342 1104 48-49 -0.10699152542373014 1104 50-51 -0.1953803224472921 1104 52-53 -0.1693881769326211 1104 54-55 -0.3262195121951237 1104 56-57 -0.0667114510128144 1104 58-59 -0.3006149235221187 1104 60-61 -0.22883939644481188 1104 62-63 -0.21827201322860645 1104 64-65 -0.16006097560975974 1104 66-67 -0.32100041339396057 1104 68-69 -0.22573894171144815 1104 70-71 -0.039349937990905914 1104 72-73 -0.1011781727986758 1104 74-75 -0.1294181479950396 1104 76-77 -0.0828596527490717 1104 78-79 -0.27304671351798504 1104 80-81 -0.16858722612650467 1104 82-83 -0.047566143034309505 1104 84-85 -0.197266432410089 1104 86-87 0.013642000826784795 1104 88-89 -0.028911740388586793 1104 90-91 -0.18693158329888604 1104 92-93 -0.3774545266639109 1104 94-95 -0.024855312112443073 1104 96-97 0.13711761058288374 1104 98-99 0.07686544026457298 1104 100 -0.09125671765192322 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 0.0 27 8.0 28 26.0 29 44.0 30 67.0 31 97.0 32 143.0 33 183.0 34 268.0 35 498.0 36 795.0 37 972.0 38 776.0 39 121.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.404404404404406 9.934934934934935 13.78878878878879 46.871871871871875 2 26.724999999999998 17.599999999999998 29.725 25.95 3 26.525 22.3 22.425 28.749999999999996 4 30.051679586563306 26.589147286821706 15.064599483204134 28.294573643410853 5 31.3 29.25 18.35 21.099999999999998 6 22.650000000000002 33.775 18.224999999999998 25.35 7 22.175 13.900000000000002 35.6 28.325 8 22.675 20.175 24.125 33.025 9 22.900000000000002 18.75 27.55 30.8 10-11 27.762500000000003 25.974999999999998 18.425 27.8375 12-13 25.528191023877984 20.75259407425928 23.777972246530815 29.94124265533192 14-15 26.4125 22.2 22.9875 28.4 16-17 26.650000000000002 22.725 22.1375 28.487499999999997 18-19 26.5 22.55 21.975 28.975 20-21 26.8375 22.0625 22.6125 28.487499999999997 22-23 27.287499999999998 22.975 21.9 27.8375 24-25 26.625 22.8 22.1 28.475 26-27 27.6125 22.45 22.8125 27.125 28-29 26.974999999999998 21.8875 22.325 28.812500000000004 30-31 26.137500000000003 22.8 22.6 28.462500000000002 32-33 25.775 23.5 22.95 27.775 34-35 28.1125 22.1 22.6125 27.175 36-37 26.724999999999998 22.4375 22.400000000000002 28.4375 38-39 26.787499999999998 23.0125 22.112499999999997 28.0875 40-41 26.7125 22.925 21.9 28.462500000000002 42-43 27.6875 21.325 23.225 27.762500000000003 44-45 27.275 22.6125 22.4625 27.650000000000002 46-47 26.575 22.425 22.8 28.199999999999996 48-49 27.187499999999996 22.525000000000002 22.3625 27.925 50-51 27.5875 22.975 22.275 27.1625 52-53 27.1375 22.3 22.037499999999998 28.525 54-55 26.1625 22.4375 23.6375 27.762500000000003 56-57 26.924999999999997 22.7 22.537499999999998 27.8375 58-59 27.175 22.6375 21.925 28.262500000000003 60-61 27.6 22.400000000000002 21.875 28.125 62-63 27.4125 23.0875 23.0 26.5 64-65 27.187499999999996 23.599999999999998 21.95 27.2625 66-67 27.4125 22.825 23.125 26.637499999999996 68-69 27.8375 22.2 22.75 27.212500000000002 70-71 28.675 22.0 22.400000000000002 26.924999999999997 72-73 27.625 22.0 22.400000000000002 27.975 74-75 27.1375 23.1875 22.0 27.675 76-77 26.5375 22.8 22.9375 27.725 78-79 27.037499999999998 22.662499999999998 22.225 28.075 80-81 27.462500000000002 22.975 22.025 27.537499999999998 82-83 27.975 22.85 21.7875 27.3875 84-85 27.6875 23.3 22.787499999999998 26.224999999999998 86-87 27.925 22.8125 21.95 27.3125 88-89 28.299999999999997 22.95 22.225 26.525 90-91 28.712500000000002 22.5 21.762500000000003 27.025 92-93 28.369415592541607 22.763108497059193 22.437742460267803 26.429733450131398 94-95 28.22852856607076 22.14026753344168 22.86535816977122 26.765845730716343 96-97 28.125 22.900000000000002 22.6125 26.3625 98-99 28.62857857232154 22.715339417427177 21.7402175271909 26.915864483060382 100 27.700000000000003 22.900000000000002 21.75 27.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.0 26 0.0 27 0.5 28 1.5 29 3.5 30 5.0 31 6.0 32 11.5 33 12.5 34 11.0 35 15.0 36 20.5 37 33.0 38 48.5 39 67.0 40 83.0 41 97.5 42 110.0 43 119.0 44 127.0 45 123.0 46 112.5 47 108.0 48 115.5 49 121.0 50 116.0 51 107.5 52 110.0 53 103.0 54 92.0 55 82.0 56 82.5 57 101.5 58 110.0 59 121.0 60 133.0 61 144.5 62 135.5 63 117.0 64 118.5 65 124.0 66 117.5 67 107.5 68 100.5 69 88.5 70 81.0 71 70.5 72 60.0 73 50.0 74 38.0 75 36.0 76 30.5 77 18.5 78 14.5 79 15.0 80 11.0 81 5.0 82 1.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 3.25 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.11249999999999999 94-95 0.0125 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65652724968315 97.3 2 1.2927756653992395 2.55 3 0.050697084917617236 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618219 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618219_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33175 34.0 31.0 34.0 31.0 34.0 2 32.6945 34.0 31.0 34.0 31.0 34.0 3 33.0235 34.0 33.0 34.0 31.0 34.0 4 36.49975 37.0 37.0 37.0 35.0 37.0 5 36.5355 37.0 37.0 37.0 35.0 37.0 6 36.54275 37.0 37.0 37.0 35.0 37.0 7 36.48125 37.0 37.0 37.0 35.0 37.0 8 36.5315 37.0 37.0 37.0 35.0 37.0 9 38.3705 39.0 39.0 39.0 37.0 39.0 10-11 38.33525 39.0 39.0 39.0 37.0 39.0 12-13 38.372125 39.0 39.0 39.0 37.0 39.0 14-15 39.99925 41.0 40.0 41.0 38.0 41.0 16-17 39.997625 41.0 40.0 41.0 38.0 41.0 18-19 39.990875 41.0 40.0 41.0 38.0 41.0 20-21 39.865375 41.0 40.0 41.0 38.0 41.0 22-23 39.804625 41.0 40.0 41.0 38.0 41.0 24-25 39.7495 41.0 40.0 41.0 37.0 41.0 26-27 39.542625 41.0 39.5 41.0 37.0 41.0 28-29 39.40225 40.5 39.0 41.0 36.0 41.0 30-31 39.253125 40.0 39.0 41.0 35.5 41.0 32-33 39.23175 40.0 39.0 41.0 35.0 41.0 34-35 39.1065 40.5 38.5 41.0 35.0 41.0 36-37 38.872375 40.0 38.0 41.0 35.0 41.0 38-39 38.65275 40.0 38.0 41.0 35.0 41.0 40-41 38.530375 40.0 37.0 41.0 34.5 41.0 42-43 38.184375 40.0 36.5 41.0 34.0 41.0 44-45 37.9125 39.0 35.5 41.0 33.5 41.0 46-47 37.604375000000005 39.0 35.0 41.0 33.0 41.0 48-49 37.373374999999996 39.0 35.0 41.0 33.0 41.0 50-51 36.852374999999995 38.0 34.5 40.0 32.0 40.5 52-53 36.909 38.0 35.0 40.0 33.0 41.0 54-55 37.043375 37.0 35.0 40.5 33.0 41.0 56-57 36.819375 37.0 35.0 40.0 33.0 41.0 58-59 36.6565 36.0 35.0 40.0 33.0 41.0 60-61 36.389375 35.5 35.0 40.0 33.0 41.0 62-63 36.018125 35.0 35.0 39.0 32.0 41.0 64-65 35.838125000000005 35.0 35.0 39.0 32.0 41.0 66-67 35.559 35.0 35.0 38.5 32.0 41.0 68-69 35.309250000000006 35.0 34.5 37.0 32.0 40.0 70-71 34.90875 35.0 34.0 37.0 31.0 39.5 72-73 34.676375 35.0 34.0 36.0 31.0 39.0 74-75 34.50025 35.0 34.0 36.0 31.0 39.0 76-77 34.05875 35.0 33.5 35.5 29.5 37.0 78-79 33.784 35.0 33.0 35.0 29.5 37.0 80-81 33.623875 35.0 33.0 35.0 29.5 36.5 82-83 33.44775 35.0 33.0 35.0 29.0 36.0 84-85 33.12575 35.0 33.0 35.0 29.0 36.0 86-87 32.86 35.0 33.0 35.0 28.0 35.5 88-89 32.7175 35.0 33.0 35.0 27.0 35.0 90-91 32.433375 35.0 33.0 35.0 27.0 35.0 92-93 32.01975 35.0 32.0 35.0 26.0 35.0 94-95 31.888125000000002 34.5 32.0 35.0 27.0 35.0 96-97 31.422874999999998 34.0 32.0 35.0 24.5 35.0 98-99 30.762875 34.0 31.0 35.0 23.5 35.0 100 30.374 34.0 31.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.6215378255477475 1101 2 0.11228813559322504 1101 3 0.3051880942538219 1101 4 0.12556841670111396 1101 5 0.20121951219512368 1101 6 0.126705250103349 1101 7 0.18959280694502212 1101 8 0.24462587846217332 1101 9 0.10706903679206903 1101 10-11 0.20450082678792825 1101 12-13 0.15530694501860154 1101 14-15 0.2273408433236881 1101 16-17 0.3161688714344777 1101 18-19 0.17848284415048 1101 20-21 0.16006097560975263 1101 22-23 0.2532554774700273 1101 24-25 0.057875155022735214 1101 26-27 0.18494212484497297 1101 28-29 0.26692331541959646 1101 30-31 0.15347250930135914 1101 32-33 0.0665047540305963 1101 34-35 0.09913704009921531 1101 36-37 -0.07035448532451483 1101 38-39 0.11841153369160651 1101 40-41 0.0799400578751559 1101 42-43 0.03002273666804456 1101 44-45 -0.10828338156262873 1101 46-47 0.050692434890443394 1101 48-49 0.08988735014468574 1101 50-51 0.1106087226126462 1101 52-53 0.08670938404299022 1101 54-55 0.1506562629185595 1101 56-57 0.42421971889210397 1101 58-59 0.06761575031004696 1101 60-61 0.08634766432410146 1101 62-63 0.15342083505580462 1101 64-65 0.1680963207937225 1101 66-67 0.011445845390660736 1101 68-69 -0.043225506407608805 1101 70-71 0.13006407606449244 1101 72-73 -0.03544853245142576 1101 74-75 -0.03836812732534156 1101 76-77 -0.1650992145514678 1101 78-79 0.0498139727160023 1101 80-81 -0.10704319966928466 1101 82-83 -0.023485944605212694 1101 84-85 -0.09691504754029978 1101 86-87 -0.22894274493592803 1101 88-89 -0.08670938404299022 1101 90-91 -0.057358412567175776 1101 92-93 0.04557668458040354 1101 94-95 -0.1311750723439431 1101 96-97 0.010825754443985147 1101 98-99 -0.0843840429929763 1101 100 -0.053534518396034514 1104 1 -0.621537825547751 1104 2 -0.11228813559321793 1104 3 -0.305188094253829 1104 4 -0.12556841670111396 1104 5 -0.20121951219512368 1104 6 -0.126705250103349 1104 7 -0.189592806945015 1104 8 -0.24462587846217332 1104 9 -0.10706903679206192 1104 10-11 -0.20450082678792825 1104 12-13 -0.15530694501860154 1104 14-15 -0.2273408433236881 1104 16-17 -0.3161688714344706 1104 18-19 -0.17848284415047289 1104 20-21 -0.16006097560975974 1104 22-23 -0.2532554774700273 1104 24-25 -0.057875155022735214 1104 26-27 -0.18494212484498007 1104 28-29 -0.26692331541959646 1104 30-31 -0.15347250930135914 1104 32-33 -0.0665047540305892 1104 34-35 -0.09913704009921531 1104 36-37 0.07035448532451483 1104 38-39 -0.11841153369160651 1104 40-41 -0.0799400578751559 1104 42-43 -0.030022736668037453 1104 44-45 0.10828338156262873 1104 46-47 -0.0506924348904505 1104 48-49 -0.08988735014468574 1104 50-51 -0.11060872261265331 1104 52-53 -0.08670938404299022 1104 54-55 -0.1506562629185595 1104 56-57 -0.4242197188921111 1104 58-59 -0.06761575031003986 1104 60-61 -0.08634766432410146 1104 62-63 -0.15342083505580462 1104 64-65 -0.1680963207937154 1104 66-67 -0.01144584539065363 1104 68-69 0.043225506407608805 1104 70-71 -0.13006407606449244 1104 72-73 0.03544853245142576 1104 74-75 0.03836812732534156 1104 76-77 0.1650992145514678 1104 78-79 -0.04981397271599519 1104 80-81 0.10704319966928466 1104 82-83 0.023485944605212694 1104 84-85 0.09691504754030689 1104 86-87 0.22894274493592803 1104 88-89 0.08670938404299022 1104 90-91 0.05735841256718288 1104 92-93 -0.04557668458040354 1104 94-95 0.1311750723439431 1104 96-97 -0.010825754443985147 1104 98-99 0.08438404299297275 1104 100 0.05353451839603096 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 14.0 28 39.0 29 47.0 30 64.0 31 93.0 32 122.0 33 186.0 34 281.0 35 518.0 36 791.0 37 891.0 38 806.0 39 145.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.49260095309757 8.878856282919488 13.594181088537749 49.0343616754452 2 28.325 17.299999999999997 29.725 24.65 3 28.275 21.5 22.0 28.225 4 29.375 25.6 16.2 28.825 5 32.5 28.599999999999998 17.974999999999998 20.925 6 23.1 31.474999999999998 18.85 26.575 7 21.596596596596594 13.513513513513514 37.58758758758759 27.3023023023023 8 22.44744744744745 19.26926926926927 24.34934934934935 33.933933933933936 9 23.58089522380595 17.254313578394598 28.207051762940733 30.957739434858716 10-11 26.669167291822955 25.968992248062015 18.529632408102024 28.832208052013 12-13 24.8125 20.75 25.275 29.1625 14-15 26.825 23.025000000000002 22.8375 27.3125 16-17 26.25 21.625 23.0 29.125 18-19 26.5 23.1875 22.3375 27.975 20-21 26.125 23.0125 23.075000000000003 27.787499999999998 22-23 25.8 22.5875 22.9625 28.65 24-25 25.912499999999998 22.425 22.775000000000002 28.8875 26-27 26.9625 23.674999999999997 21.712500000000002 27.650000000000002 28-29 26.974999999999998 22.3125 22.3375 28.375 30-31 26.3625 23.075000000000003 22.162499999999998 28.4 32-33 27.787499999999998 22.3 23.0875 26.825 34-35 27.762500000000003 21.125 22.9375 28.175 36-37 26.3 22.425 23.150000000000002 28.125 38-39 28.000000000000004 23.4875 22.35 26.1625 40-41 27.5875 21.575 22.125 28.712500000000002 42-43 25.4375 22.775000000000002 23.775 28.012500000000003 44-45 26.424999999999997 23.6375 22.3875 27.55 46-47 28.0625 22.4625 21.587500000000002 27.8875 48-49 26.937499999999996 22.2625 23.474999999999998 27.325 50-51 26.625 23.474999999999998 22.05 27.85 52-53 26.787499999999998 21.6625 22.8 28.749999999999996 54-55 26.224999999999998 22.412499999999998 22.237499999999997 29.125 56-57 27.1125 22.6125 22.725 27.55 58-59 27.6125 22.225 22.125 28.037499999999998 60-61 27.224999999999998 22.912499999999998 22.2125 27.650000000000002 62-63 26.8 22.525000000000002 23.549999999999997 27.125 64-65 27.1375 22.7 22.037499999999998 28.125 66-67 26.2125 22.8375 23.175 27.775 68-69 27.4125 23.1375 22.112499999999997 27.3375 70-71 28.012500000000003 21.9375 22.162499999999998 27.8875 72-73 26.275 23.375 22.075 28.275 74-75 27.800000000000004 22.900000000000002 22.55 26.75 76-77 28.1125 22.650000000000002 21.7 27.537499999999998 78-79 27.212500000000002 22.8875 22.2 27.700000000000003 80-81 28.299999999999997 21.975 22.8 26.924999999999997 82-83 27.800000000000004 22.25 22.25 27.700000000000003 84-85 27.625 21.825 22.875 27.675 86-87 27.750000000000004 22.675 22.3125 27.2625 88-89 28.712500000000002 22.075 22.1 27.1125 90-91 27.9375 21.7 22.0625 28.299999999999997 92-93 27.69096137017127 22.852856607075882 22.75284410551319 26.703337917239654 94-95 28.1625 22.4625 22.412499999999998 26.9625 96-97 27.950000000000003 21.925 23.275000000000002 26.85 98-99 28.449999999999996 23.275000000000002 21.975 26.3 100 28.199999999999996 23.974999999999998 20.75 27.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 2.0 28 1.5 29 1.5 30 3.0 31 4.0 32 6.5 33 12.5 34 17.0 35 17.0 36 22.5 37 42.0 38 50.0 39 60.5 40 85.5 41 91.5 42 95.0 43 110.5 44 131.0 45 130.5 46 129.5 47 138.0 48 121.5 49 105.0 50 107.5 51 107.0 52 99.0 53 85.5 54 78.5 55 90.5 56 96.0 57 91.5 58 97.5 59 123.0 60 129.5 61 129.5 62 136.5 63 132.0 64 135.0 65 131.0 66 113.5 67 110.0 68 113.0 69 84.5 70 78.5 71 75.5 72 50.5 73 52.5 74 47.0 75 32.0 76 29.0 77 24.5 78 15.0 79 8.5 80 4.5 81 2.5 82 1.0 83 0.5 84 1.5 85 1.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.1 8 0.1 9 0.025 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62839725679451 97.075 2 1.143002286004572 2.25 3 0.2286004572009144 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 557522 spots for SRR8618219.sra Written 557522 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra Read 557514 spots for SRR8618219.sra Written 557514 spots for SRR8618219.sra SRR ids: ['SRR8618219.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fo4nawk2 SRR8618219.sra spots: 11150288 blocks: [[1, 557514], [557515, 1115028], [1115029, 1672542], [1672543, 2230056], [2230057, 2787570], [2787571, 3345084], [3345085, 3902598], [3902599, 4460112], [4460113, 5017626], [5017627, 5575140], [5575141, 6132654], [6132655, 6690168], [6690169, 7247682], [7247683, 7805196], [7805197, 8362710], [8362711, 8920224], [8920225, 9477738], [9477739, 10035252], [10035253, 10592766], [10592767, 11150288]] SRR8618219 file size 2901839 SRR8618219 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618219 SRR8618219_1.fastq SRR8618219_2.fastq Input file: SRR8618219_1.fastq Paired file: SRR8618219_2.fastq trimmed: SRR8618219-trimmed-pair1.fastq, SRR8618219-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:00:20 2024 >> started Sat Dec 7 07:00:30 2024 >> done (10.048s) 11150288 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11150288 (100.00%) read pairs available; of these: 1520595 (13.64%) trimmed read pairs available after processing 9629693 (86.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 14 0.00% 82 35 0.00% 83 87 0.00% 84 6108 0.05% 85 6504 0.06% 86 7332 0.07% 87 8010 0.07% 88 9614 0.09% 89 12405 0.11% 90 19687 0.18% 91 35762 0.32% 92 49929 0.45% 93 69096 0.62% 94 92354 0.83% 95 118965 1.07% 96 155308 1.39% 97 213809 1.92% 98 306786 2.75% 99 408790 3.67% 100 9629693 86.36% 11150288 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=28 prefix-density=0.44 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.28 sequence-density-rank=6 fanout-score=7.84 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=3.6 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=26 prefix-density=0.43 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.29 sequence-density-rank=6 fanout-score=7.75 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=3.5 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618219 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:01:00 Started mapping on | Dec 07 07:01:00 Finished on | Dec 07 07:01:43 Mapping speed, Million of reads per hour | 933.51 Number of input reads | 11150288 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10931376 Uniquely mapped reads % | 98.04% Average mapped length | 198.29 Number of splices: Total | 6233829 Number of splices: Annotated (sjdb) | 5939624 Number of splices: GT/AG | 6150411 Number of splices: GC/AG | 68951 Number of splices: AT/AC | 1599 Number of splices: Non-canonical | 12868 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 87214 % of reads mapped to multiple loci | 0.78% Number of reads mapped to too many loci | 5783 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.90% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 131698 131698 131698 N_multimapping 87214 87214 87214 N_noFeature 214415 5446364 5495095 N_ambiguous 247659 21525 23507 UnstrandedReadsAssigned:10469302 PositiveStrandReadsAssigned:5463487 NegativeStrandReadsAssigned:5412774 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618219 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618219-trimmed-pair1.fastq SRR8618219-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,150,288 reads, 10,648,920 reads pseudoaligned [quant] estimated average fragment length: 160.562 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR8618219.ke.tsv 35125 SRR8618219.se.tsv 88098 total ==> SRR8618219.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 776.622 0 0 PNS24247 1044 884.438 15.6371 2.1557 PNS24249 1928 1768.44 60.1453 4.14678 PNS24246 1044 884.438 15.6371 2.1557 PNS24248 1044 884.438 15.6371 2.1557 PNS24244 1471 1311.44 17.9433 1.66822 PNS24243 293 139.152 7 6.13348 KQK14069 1603 1443.44 5263.54 444.609 KQK14071 474 315.659 499.301 192.861 ==> SRR8618219.se.tsv <== BRADI_1g14170v3 6195 BRADI_1g53295v3 130 BRADI_1g59795v3 228 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 113 BRADI_1g74790v3 42 BRADI_1g09890v3 0 BRADI_1g77505v3 128 BRADI_1g48960v3 0 SRR8618219 completed mapping pipeline successfully