Starting /dee2/code/volunteer_pipeline.sh SRR8618220 current disk space = 1544566001664 free memory = 1597595608 SRR8618220 SRAfilesize d0a23f807f32fe6f0241ecf3f68523d0 SRR8618220.sra SRR8618220.sra file validated SRR8618220 is paired end SRR8618220 is conventional basespace SRR8618220 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618220_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.929 34.0 31.0 34.0 31.0 34.0 2 33.231 34.0 33.0 34.0 31.0 34.0 3 33.316 34.0 34.0 34.0 31.0 34.0 4 35.372 37.0 37.0 37.0 35.0 37.0 5 35.94925 37.0 37.0 37.0 35.0 37.0 6 36.31925 37.0 37.0 37.0 35.0 37.0 7 36.174 37.0 37.0 37.0 35.0 37.0 8 36.458 37.0 37.0 37.0 35.0 37.0 9 38.323 39.0 39.0 39.0 37.0 39.0 10-11 38.39475 39.0 39.0 39.0 37.0 39.0 12-13 38.40575 39.0 39.0 39.0 37.0 39.0 14-15 40.00575 41.0 40.0 41.0 38.0 41.0 16-17 39.956374999999994 41.0 40.0 41.0 38.0 41.0 18-19 39.913375 41.0 40.0 41.0 38.0 41.0 20-21 39.75075 41.0 40.0 41.0 37.5 41.0 22-23 39.71025 41.0 39.5 41.0 37.5 41.0 24-25 39.568 41.0 39.0 41.0 37.0 41.0 26-27 39.410125 40.0 39.0 41.0 36.0 41.0 28-29 39.295500000000004 40.0 39.0 41.0 36.0 41.0 30-31 39.06225 40.0 38.0 41.0 35.0 41.0 32-33 38.9835 40.0 38.0 41.0 35.0 41.0 34-35 39.166 40.0 38.5 41.0 35.0 41.0 36-37 39.185125 41.0 38.5 41.0 35.0 41.0 38-39 39.090875 40.0 38.0 41.0 35.0 41.0 40-41 38.900125 40.0 38.0 41.0 35.0 41.0 42-43 38.675 40.0 37.0 41.0 35.0 41.0 44-45 38.40325 40.0 36.5 41.0 35.0 41.0 46-47 38.138625000000005 40.0 35.5 41.0 34.0 41.0 48-49 37.985125 39.0 35.0 41.0 34.0 41.0 50-51 37.610375000000005 39.0 35.0 41.0 33.5 41.0 52-53 37.463375 38.5 35.0 41.0 33.5 41.0 54-55 37.156375 38.0 35.0 41.0 33.0 41.0 56-57 36.871125 37.0 35.0 40.0 33.0 41.0 58-59 36.5985 36.5 35.0 40.0 33.0 41.0 60-61 36.27475 35.5 35.0 40.0 33.0 41.0 62-63 35.990125 35.0 35.0 39.0 32.0 41.0 64-65 35.651375 35.0 35.0 39.0 31.5 41.0 66-67 35.484375 35.0 34.0 38.5 31.5 41.0 68-69 35.180375 35.0 34.0 37.0 31.5 40.0 70-71 34.867625 35.0 34.0 37.0 31.0 39.5 72-73 34.494 35.0 34.0 36.0 30.5 39.0 74-75 34.21125 35.0 34.0 36.0 30.0 39.0 76-77 33.310625 34.5 32.5 35.0 28.0 37.0 78-79 33.873125 35.0 33.0 35.0 30.0 37.0 80-81 33.77975 35.0 33.5 35.0 30.0 37.0 82-83 33.576125000000005 35.0 33.0 35.0 30.0 36.0 84-85 33.47325 35.0 33.0 35.0 29.5 36.0 86-87 33.235875 35.0 33.0 35.0 29.0 35.5 88-89 32.9765 35.0 33.0 35.0 29.0 35.0 90-91 32.757000000000005 35.0 33.0 35.0 28.5 35.0 92-93 32.389375 35.0 33.0 35.0 27.0 35.0 94-95 32.20075 35.0 33.0 35.0 27.0 35.0 96-97 31.985124999999996 35.0 32.5 35.0 27.0 35.0 98-99 31.57525 34.5 32.5 35.0 26.0 35.0 100 31.16175 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.10231394621638401 1101 2 -0.0683552220137571 1101 3 -0.1196998123827413 1101 4 -1.7958098811757353 1101 5 -0.9229518449030678 1101 6 -0.3296435272045031 1101 7 -0.29349593495934556 1101 8 -0.14352720450280998 1101 9 -0.22695434646654178 1101 10-11 -0.09505941213258495 1101 12-13 -0.043026891807379286 1101 14-15 0.014040025015638946 1101 16-17 -6.879299562214669E-4 1101 18-19 0.007754846779242541 1101 20-21 -0.01263289555972591 1101 22-23 -0.004283927454665104 1101 24-25 0.041307066916822066 1101 26-27 0.004158849280798904 1101 28-29 0.031707317073170316 1101 30-31 0.10719199499686738 1101 32-33 -0.007348342714195155 1101 34-35 -0.008036272670416622 1101 36-37 -0.03949343339586875 1101 38-39 -0.13611632270168883 1101 40-41 -0.10365853658536395 1101 42-43 -0.1496560350218914 1101 44-45 -0.14896810506566283 1101 46-47 -0.46019387116947996 1101 48-49 -0.42223264540337624 1101 50-51 -0.3125078173858711 1101 52-53 -0.32354596622889176 1101 54-55 -0.4447154471544721 1101 56-57 -0.6116010006253916 1101 58-59 -0.4875547217010592 1101 60-61 -0.3545966228893036 1101 62-63 -0.3609443402126331 1101 64-65 -0.16782363977485915 1101 66-67 -0.14293308317699172 1101 68-69 -0.19762351469668715 1101 70-71 -0.2134459036898093 1101 72-73 -0.1667604752970604 1101 74-75 -0.1919949968730421 1101 76-77 -0.09174484052532961 1101 78-79 -0.1496247654784213 1101 80-81 -0.23658536585365653 1101 82-83 -0.2604127579737323 1101 84-85 -0.11069418386491492 1101 86-87 -0.25781738586616854 1101 88-89 -0.13733583489680967 1101 90-91 -0.15747342088805283 1101 92-93 -0.2606003752345245 1101 94-95 -0.390587867417139 1101 96-97 -0.32851782363977833 1101 98-99 0.026203877423387922 1101 100 0.1924327704815525 1104 1 0.10231394621638401 1104 2 0.0683552220137642 1104 3 0.1196998123827342 1104 4 1.7958098811757353 1104 5 0.9229518449030607 1104 6 0.3296435272045031 1104 7 0.29349593495935267 1104 8 0.14352720450281709 1104 9 0.22695434646654178 1104 10-11 0.09505941213258495 1104 12-13 0.043026891807379286 1104 14-15 -0.014040025015638946 1104 16-17 6.879299562285723E-4 1104 18-19 -0.007754846779235436 1104 20-21 0.01263289555972591 1104 22-23 0.004283927454657999 1104 24-25 -0.041307066916822066 1104 26-27 -0.004158849280798904 1104 28-29 -0.03170731707316321 1104 30-31 -0.10719199499687448 1104 32-33 0.007348342714195155 1104 34-35 0.008036272670416622 1104 36-37 0.03949343339586875 1104 38-39 0.13611632270168883 1104 40-41 0.10365853658536395 1104 42-43 0.1496560350218843 1104 44-45 0.14896810506566993 1104 46-47 0.46019387116948707 1104 48-49 0.42223264540337624 1104 50-51 0.312507817385864 1104 52-53 0.32354596622889176 1104 54-55 0.4447154471544721 1104 56-57 0.6116010006253916 1104 58-59 0.4875547217010592 1104 60-61 0.3545966228893036 1104 62-63 0.3609443402126331 1104 64-65 0.16782363977485915 1104 66-67 0.1429330831769846 1104 68-69 0.19762351469668005 1104 70-71 0.2134459036898093 1104 72-73 0.1667604752970604 1104 74-75 0.1919949968730421 1104 76-77 0.09174484052532961 1104 78-79 0.1496247654784284 1104 80-81 0.23658536585366363 1104 82-83 0.2604127579737323 1104 84-85 0.11069418386491492 1104 86-87 0.25781738586616143 1104 88-89 0.13733583489681678 1104 90-91 0.15747342088805283 1104 92-93 0.2606003752345245 1104 94-95 0.390587867417139 1104 96-97 0.3285178236397712 1104 98-99 -0.026203877423387922 1104 100 -0.1924327704815525 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 13.0 28 20.0 29 44.0 30 65.0 31 94.0 32 120.0 33 189.0 34 276.0 35 471.0 36 789.0 37 908.0 38 852.0 39 157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.147508139243676 10.543451039318807 13.573754069621838 48.73528675181568 2 27.125 17.525 30.25 25.1 3 26.875 22.75 22.225 28.15 4 30.30617540217955 26.569797612869746 16.398546964193045 26.72548002075765 5 31.724999999999998 28.499999999999996 17.974999999999998 21.8 6 22.375 32.775 20.150000000000002 24.7 7 21.45 13.900000000000002 37.125 27.525 8 23.35 19.825 23.075000000000003 33.75 9 24.075 18.4 27.55 29.975 10-11 28.237499999999997 26.0625 18.35 27.35 12-13 25.51887971992998 20.94273568392098 24.656164041010253 28.882220555138783 14-15 27.212500000000002 22.037499999999998 23.525 27.224999999999998 16-17 26.724999999999998 22.75 22.4875 28.037499999999998 18-19 27.287499999999998 22.6375 22.575 27.500000000000004 20-21 26.825 23.225 22.237499999999997 27.712500000000002 22-23 27.237499999999997 23.200000000000003 21.7 27.8625 24-25 26.187500000000004 22.4625 23.6875 27.6625 26-27 26.3625 23.0375 22.5 28.1 28-29 27.3375 22.45 22.2125 28.000000000000004 30-31 26.525 23.150000000000002 22.675 27.650000000000002 32-33 26.6125 22.775000000000002 22.6125 28.000000000000004 34-35 26.924999999999997 22.662499999999998 21.349999999999998 29.062500000000004 36-37 26.450000000000003 23.25 22.975 27.325 38-39 27.1 22.625 22.8625 27.4125 40-41 27.150000000000002 23.025000000000002 22.15 27.675 42-43 27.200000000000003 21.6625 23.1875 27.950000000000003 44-45 27.725 22.8875 21.9625 27.425 46-47 27.500000000000004 22.9375 21.6625 27.900000000000002 48-49 26.8625 22.1375 23.075000000000003 27.925 50-51 27.375 23.3625 22.400000000000002 26.8625 52-53 27.462500000000002 22.975 21.9625 27.6 54-55 26.700000000000003 23.3 22.3875 27.6125 56-57 27.1625 23.6125 22.275 26.950000000000003 58-59 28.125 22.287499999999998 22.775000000000002 26.8125 60-61 27.224999999999998 22.8375 21.7875 28.15 62-63 26.637499999999996 22.8125 22.8625 27.6875 64-65 27.8125 21.95 22.425 27.8125 66-67 26.7625 22.6375 23.549999999999997 27.05 68-69 28.0625 22.8375 22.3 26.8 70-71 28.475 22.2625 22.7625 26.5 72-73 26.787499999999998 22.912499999999998 22.575 27.725 74-75 27.450000000000003 23.95 21.95 26.650000000000002 76-77 26.787499999999998 22.8375 22.787499999999998 27.5875 78-79 26.8125 23.0625 22.45 27.675 80-81 27.187499999999996 22.85 22.3375 27.625 82-83 28.1 22.825 21.7375 27.3375 84-85 27.5125 22.900000000000002 22.412499999999998 27.175 86-87 26.937499999999996 23.3 21.987499999999997 27.775 88-89 28.175 22.1375 21.925 27.762500000000003 90-91 26.787499999999998 24.025 21.975 27.212500000000002 92-93 27.56418284283031 22.74264245460238 22.492172824045085 27.20100187852223 94-95 28.08904452226113 22.923961980990494 21.885942971485743 27.101050525262632 96-97 26.6125 22.1875 23.150000000000002 28.050000000000004 98-99 28.08202050512628 22.405601400350086 22.843210802700675 26.669167291822955 100 27.775 21.575 22.575 28.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.5 27 0.5 28 2.0 29 4.0 30 4.5 31 7.5 32 9.5 33 9.0 34 14.0 35 26.0 36 34.5 37 37.0 38 42.5 39 52.5 40 68.5 41 92.5 42 115.5 43 126.5 44 142.0 45 136.5 46 131.0 47 138.0 48 128.0 49 124.5 50 121.0 51 115.0 52 105.0 53 94.0 54 85.5 55 84.0 56 91.0 57 90.0 58 94.5 59 110.5 60 118.0 61 118.5 62 115.5 63 125.5 64 115.5 65 95.0 66 103.0 67 101.5 68 96.0 69 96.0 70 90.0 71 72.0 72 61.5 73 58.0 74 51.0 75 40.5 76 30.0 77 24.0 78 18.0 79 12.5 80 6.5 81 5.0 82 4.0 83 2.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 3.65 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.025 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.1875 94-95 0.05 96-97 0.0 98-99 0.025 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01390644753477 97.89999999999999 2 0.8343868520859671 1.6500000000000001 3 0.15170670037926676 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0375 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618220 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618220_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39175 34.0 31.0 34.0 31.0 34.0 2 32.78825 34.0 31.0 34.0 31.0 34.0 3 33.0805 34.0 33.0 34.0 31.0 34.0 4 36.501 37.0 37.0 37.0 35.0 37.0 5 36.5305 37.0 37.0 37.0 35.0 37.0 6 36.578 37.0 37.0 37.0 35.0 37.0 7 36.43975 37.0 37.0 37.0 35.0 37.0 8 36.48125 37.0 37.0 37.0 35.0 37.0 9 38.30925 39.0 39.0 39.0 37.0 39.0 10-11 38.352374999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.39925 39.0 39.0 39.0 37.0 39.0 14-15 40.00975 41.0 40.0 41.0 38.0 41.0 16-17 39.97875 41.0 40.0 41.0 38.0 41.0 18-19 39.93675 41.0 40.0 41.0 38.0 41.0 20-21 39.914125 41.0 40.0 41.0 38.0 41.0 22-23 39.781625000000005 41.0 40.0 41.0 37.5 41.0 24-25 39.682125 41.0 40.0 41.0 37.0 41.0 26-27 39.555375 41.0 39.5 41.0 36.5 41.0 28-29 39.400125 41.0 39.0 41.0 36.0 41.0 30-31 39.213875 40.0 38.5 41.0 35.5 41.0 32-33 39.132374999999996 40.0 38.5 41.0 35.0 41.0 34-35 39.03275 40.0 38.0 41.0 35.0 41.0 36-37 38.888875 40.0 38.0 41.0 35.0 41.0 38-39 38.754875 40.0 38.0 41.0 35.0 41.0 40-41 38.425625 40.0 37.0 41.0 34.0 41.0 42-43 38.200874999999996 40.0 36.0 41.0 34.0 41.0 44-45 37.92 39.5 35.5 41.0 33.0 41.0 46-47 37.610125 39.0 35.0 41.0 33.0 41.0 48-49 37.5145 39.0 35.0 41.0 33.0 41.0 50-51 37.028125 38.5 34.5 40.0 32.0 40.5 52-53 37.09325 38.0 35.0 40.0 33.0 41.0 54-55 37.148250000000004 38.0 35.0 41.0 33.0 41.0 56-57 36.99825 37.0 35.0 41.0 33.0 41.0 58-59 36.7605 37.0 35.0 40.5 33.0 41.0 60-61 36.532250000000005 36.0 35.0 40.0 33.0 41.0 62-63 36.203 35.0 35.0 39.5 32.5 41.0 64-65 35.986000000000004 35.0 35.0 39.0 32.5 41.0 66-67 35.6905 35.0 35.0 39.0 32.0 41.0 68-69 35.452749999999995 35.0 35.0 37.5 31.5 40.5 70-71 35.085 35.0 34.0 37.0 31.5 40.0 72-73 34.884125 35.0 34.0 36.5 31.0 39.0 74-75 34.553124999999994 35.0 34.0 36.0 31.0 39.0 76-77 34.0505 35.0 33.5 35.5 29.5 37.5 78-79 33.938125 35.0 33.5 35.0 30.0 37.0 80-81 33.747125 35.0 33.0 35.0 29.0 37.0 82-83 33.51775 35.0 33.0 35.0 29.0 36.0 84-85 33.343875 35.0 33.0 35.0 29.0 36.0 86-87 33.0945 35.0 33.0 35.0 29.0 35.5 88-89 32.970124999999996 35.0 33.0 35.0 29.0 35.0 90-91 32.655249999999995 35.0 33.0 35.0 27.0 35.0 92-93 32.47 35.0 33.0 35.0 27.0 35.0 94-95 32.185375 35.0 33.0 35.0 27.0 35.0 96-97 31.386375 34.0 31.5 35.0 24.0 35.0 98-99 30.910625 34.0 31.0 35.0 23.5 35.0 100 30.736 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.023577235772357596 1101 2 -0.1370856785490986 1101 3 -0.11388367729831117 1101 4 0.004002501563476812 1101 5 -0.060662914321454764 1101 6 -0.06441525953720628 1101 7 -0.008943089430900386 1101 8 -0.10087554721700798 1101 9 -0.08155096935585249 1101 10-11 -0.02911194496560654 1101 12-13 0.028142589118203887 1101 14-15 -0.14462163852407883 1101 16-17 -0.06863664790494539 1101 18-19 -0.05115697310819911 1101 20-21 -0.14008755472170265 1101 22-23 0.03927454659161356 1101 24-25 -0.04208880550343963 1101 26-27 -0.04574734208880926 1101 28-29 -0.09287054409005435 1101 30-31 -0.19987492182614375 1101 32-33 -0.11035021888680063 1101 34-35 -0.12088805503439914 1101 36-37 -0.17876797998749083 1101 38-39 -0.10447154471544451 1101 40-41 -0.0035021888680404345 1101 42-43 -0.29358974358974166 1101 44-45 -0.2994058786741718 1101 46-47 -0.16307066916822777 1101 48-49 -0.18427141963727678 1101 50-51 -0.4380863039399614 1101 52-53 -0.3723889931207012 1101 54-55 -0.36181988742964677 1101 56-57 -0.3628517823639754 1101 58-59 -0.28058161350844557 1101 60-61 -0.29784240150094377 1101 62-63 -0.5450906816760508 1101 64-65 -0.437523452157599 1101 66-67 -0.3487804878048806 1101 68-69 -0.27001250781738406 1101 70-71 -0.30666041275797085 1101 72-73 -0.2947779862413995 1101 74-75 -0.4079424640400262 1101 76-77 -0.2974984365228224 1101 78-79 -0.3183864915572201 1101 80-81 -0.016979362101309903 1101 82-83 0.04358974358974166 1101 84-85 -0.17041901188243003 1101 86-87 -0.15240775484677727 1101 88-89 -0.14193245778611896 1101 90-91 -0.2909005628517818 1101 92-93 -0.3357098186366514 1101 94-95 -0.4760162601626021 1101 96-97 -0.07879924953095951 1101 98-99 -0.05287679799875278 1101 100 -0.4101313320825497 1104 1 -0.023577235772357596 1104 2 0.13708567854909148 1104 3 0.11388367729831117 1104 4 -0.004002501563476812 1104 5 0.06066291432144766 1104 6 0.06441525953721339 1104 7 0.00894308943089328 1104 8 0.10087554721700798 1104 9 0.08155096935584538 1104 10-11 0.029111944965599434 1104 12-13 -0.028142589118203887 1104 14-15 0.14462163852407883 1104 16-17 0.06863664790494539 1104 18-19 0.051156973108192005 1104 20-21 0.14008755472170265 1104 22-23 -0.03927454659162066 1104 24-25 0.04208880550343963 1104 26-27 0.045747342088802156 1104 28-29 0.09287054409006146 1104 30-31 0.19987492182614375 1104 32-33 0.11035021888680063 1104 34-35 0.12088805503439914 1104 36-37 0.17876797998749794 1104 38-39 0.10447154471544451 1104 40-41 0.00350218886804754 1104 42-43 0.29358974358974166 1104 44-45 0.2994058786741718 1104 46-47 0.16307066916822777 1104 48-49 0.18427141963726967 1104 50-51 0.4380863039399614 1104 52-53 0.3723889931207012 1104 54-55 0.36181988742964677 1104 56-57 0.3628517823639754 1104 58-59 0.28058161350844557 1104 60-61 0.29784240150093666 1104 62-63 0.5450906816760437 1104 64-65 0.437523452157599 1104 66-67 0.3487804878048806 1104 68-69 0.27001250781739117 1104 70-71 0.30666041275797795 1104 72-73 0.2947779862413995 1104 74-75 0.4079424640400191 1104 76-77 0.2974984365228295 1104 78-79 0.3183864915572201 1104 80-81 0.016979362101309903 1104 82-83 -0.04358974358974166 1104 84-85 0.17041901188243003 1104 86-87 0.15240775484678437 1104 88-89 0.14193245778611896 1104 90-91 0.2909005628517818 1104 92-93 0.3357098186366443 1104 94-95 0.4760162601626021 1104 96-97 0.07879924953095596 1104 98-99 0.052876797998749225 1104 100 0.41013133208255326 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 10.0 28 28.0 29 55.0 30 75.0 31 91.0 32 122.0 33 183.0 34 266.0 35 482.0 36 763.0 37 866.0 38 893.0 39 166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.007049345417926 8.987915407854985 14.551863041289023 50.453172205438065 2 27.0 17.5 29.925 25.575 3 26.924999999999997 21.8 21.325 29.95 4 29.65 26.775 16.175 27.400000000000002 5 32.95 27.775 19.0 20.275000000000002 6 23.7 31.275 18.9 26.125 7 21.28725269221137 13.724017029802155 38.06661657901327 26.922113698973206 8 22.77054108216433 19.68937875751503 23.672344689378757 33.86773547094188 9 23.373373373373376 18.21821821821822 28.453453453453452 29.954954954954953 10-11 27.04426106526632 26.344086021505376 18.11702925731433 28.49462365591398 12-13 25.6 21.25 24.9875 28.1625 14-15 26.424999999999997 23.0625 22.975 27.537499999999998 16-17 27.05 22.8 21.637500000000003 28.512500000000003 18-19 27.075 22.237499999999997 23.0 27.6875 20-21 25.7875 23.5375 22.7 27.975 22-23 26.5875 22.4625 22.825 28.125 24-25 26.8625 23.7125 21.55 27.875 26-27 27.650000000000002 22.662499999999998 22.95 26.737499999999997 28-29 26.424999999999997 23.0 22.7625 27.8125 30-31 27.05 22.9875 23.1625 26.8 32-33 26.224999999999998 22.6375 23.5 27.6375 34-35 26.525 22.6375 22.8 28.037499999999998 36-37 27.437499999999996 22.412499999999998 22.8375 27.3125 38-39 26.0125 22.8125 22.5125 28.6625 40-41 27.787499999999998 22.725 22.75 26.737499999999997 42-43 26.637499999999996 21.775 23.65 27.9375 44-45 27.187499999999996 22.5875 22.9375 27.287499999999998 46-47 26.7625 22.5875 22.900000000000002 27.750000000000004 48-49 26.787499999999998 22.625 22.6875 27.900000000000002 50-51 27.3 22.8375 22.4375 27.425 52-53 26.875 22.662499999999998 22.55 27.9125 54-55 26.1625 23.6875 22.7375 27.4125 56-57 26.75 23.775 22.55 26.924999999999997 58-59 27.575 22.775000000000002 21.587500000000002 28.0625 60-61 27.275 22.075 22.775000000000002 27.875 62-63 26.937499999999996 22.05 23.2875 27.725 64-65 26.2875 23.075000000000003 22.7375 27.900000000000002 66-67 25.424999999999997 23.925 23.0125 27.6375 68-69 26.2875 22.5 23.4875 27.725 70-71 27.400000000000002 22.35 23.150000000000002 27.1 72-73 26.0 22.8125 23.0 28.1875 74-75 26.787499999999998 22.662499999999998 22.8 27.750000000000004 76-77 27.375 22.537499999999998 22.775000000000002 27.3125 78-79 27.224999999999998 22.425 22.75 27.6 80-81 27.325 22.3375 22.7 27.6375 82-83 27.3875 22.3 23.0625 27.250000000000004 84-85 27.175 22.2125 22.5 28.1125 86-87 26.8375 22.0125 23.025000000000002 28.125 88-89 27.987499999999997 22.3875 22.05 27.575 90-91 26.75 22.3 23.4625 27.487499999999997 92-93 28.08202050512628 22.20555138784696 22.48062015503876 27.231807951987996 94-95 26.687499999999996 22.237499999999997 22.775000000000002 28.299999999999997 96-97 28.0875 22.7 22.662499999999998 26.55 98-99 28.3125 23.075000000000003 22.5875 26.025 100 27.500000000000004 23.35 21.775 27.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.5 29 1.5 30 3.0 31 4.0 32 7.5 33 9.5 34 14.0 35 21.5 36 25.5 37 40.5 38 53.5 39 66.0 40 95.5 41 114.5 42 119.0 43 128.5 44 130.0 45 123.5 46 138.5 47 139.5 48 124.0 49 121.5 50 101.0 51 98.0 52 107.0 53 97.0 54 83.0 55 77.0 56 80.0 57 101.0 58 122.0 59 118.5 60 126.0 61 124.5 62 107.5 63 103.0 64 110.0 65 105.0 66 107.0 67 113.0 68 106.5 69 90.0 70 72.0 71 63.5 72 53.0 73 49.0 74 46.5 75 40.0 76 30.5 77 22.0 78 18.0 79 15.0 80 12.5 81 9.5 82 3.5 83 0.5 84 1.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.17500000000000002 8 0.2 9 0.1 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0375 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561884 spots for SRR8618220.sra Written 561884 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra Read 561872 spots for SRR8618220.sra Written 561872 spots for SRR8618220.sra SRR ids: ['SRR8618220.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kg0ai7s9 SRR8618220.sra spots: 11237452 blocks: [[1, 561872], [561873, 1123744], [1123745, 1685616], [1685617, 2247488], [2247489, 2809360], [2809361, 3371232], [3371233, 3933104], [3933105, 4494976], [4494977, 5056848], [5056849, 5618720], [5618721, 6180592], [6180593, 6742464], [6742465, 7304336], [7304337, 7866208], [7866209, 8428080], [8428081, 8989952], [8989953, 9551824], [9551825, 10113696], [10113697, 10675568], [10675569, 11237452]] SRR8618220 file size 2924596 SRR8618220 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618220 SRR8618220_1.fastq SRR8618220_2.fastq Input file: SRR8618220_1.fastq Paired file: SRR8618220_2.fastq trimmed: SRR8618220-trimmed-pair1.fastq, SRR8618220-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:19:18 2024 >> started Sat Dec 7 07:19:28 2024 >> done (10.165s) 11237452 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11237452 (100.00%) read pairs available; of these: 1450968 (12.91%) trimmed read pairs available after processing 9786484 (87.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 17 0.00% 82 40 0.00% 83 96 0.00% 84 5440 0.05% 85 5968 0.05% 86 6377 0.06% 87 7513 0.07% 88 9007 0.08% 89 11580 0.10% 90 18534 0.16% 91 33656 0.30% 92 47528 0.42% 93 65324 0.58% 94 88088 0.78% 95 112635 1.00% 96 146970 1.31% 97 204502 1.82% 98 293332 2.61% 99 394361 3.51% 100 9786484 87.09% 11237452 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=24 prefix-density=0.44 prefix-fanout=2.3 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.21 sequence-density-rank=16 fanout-score=9.34 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=3.4 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=27 prefix-density=0.45 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=31 fanout-score=8.29 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.7 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618220 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:19:59 Started mapping on | Dec 07 07:19:59 Finished on | Dec 07 07:20:35 Mapping speed, Million of reads per hour | 1123.75 Number of input reads | 11237452 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10995402 Uniquely mapped reads % | 97.85% Average mapped length | 198.32 Number of splices: Total | 6639355 Number of splices: Annotated (sjdb) | 6323524 Number of splices: GT/AG | 6548517 Number of splices: GC/AG | 75932 Number of splices: AT/AC | 1698 Number of splices: Non-canonical | 13208 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 92191 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 9419 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 149859 149859 149859 N_multimapping 92191 92191 92191 N_noFeature 255544 5503783 5540169 N_ambiguous 253203 22972 24955 UnstrandedReadsAssigned:10486655 PositiveStrandReadsAssigned:5468647 NegativeStrandReadsAssigned:5430278 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618220 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618220-trimmed-pair1.fastq SRR8618220-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,237,452 reads, 10,697,381 reads pseudoaligned [quant] estimated average fragment length: 162.657 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52973 SRR8618220.ke.tsv 35125 SRR8618220.se.tsv 88098 total ==> SRR8618220.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 774.458 0 0 PNS24247 1044 882.343 17.7765 2.47076 PNS24249 1928 1766.34 60.4884 4.19971 PNS24246 1044 882.343 17.7765 2.47076 PNS24248 1044 882.343 17.7765 2.47076 PNS24244 1471 1309.34 19.1821 1.79666 PNS24243 293 137.758 6 5.34143 KQK14069 1603 1441.34 2827.46 240.575 KQK14071 474 313.507 279.739 109.428 ==> SRR8618220.se.tsv <== BRADI_1g14170v3 3424 BRADI_1g53295v3 149 BRADI_1g59795v3 258 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 119 BRADI_1g74790v3 26 BRADI_1g09890v3 0 BRADI_1g77505v3 127 BRADI_1g48960v3 0 SRR8618220 completed mapping pipeline successfully