Starting /dee2/code/volunteer_pipeline.sh SRR8618221 current disk space = 1544564690944 free memory = 1467331760 SRR8618221 SRAfilesize 1faabc87d69ae8c9ae789e315f180cf2 SRR8618221.sra SRR8618221.sra file validated SRR8618221 is paired end SRR8618221 is conventional basespace SRR8618221 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618221_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9015 34.0 31.0 34.0 31.0 34.0 2 33.19525 34.0 33.0 34.0 31.0 34.0 3 33.2485 34.0 34.0 34.0 31.0 34.0 4 35.38125 37.0 37.0 37.0 35.0 37.0 5 35.98425 37.0 37.0 37.0 35.0 37.0 6 36.323 37.0 37.0 37.0 35.0 37.0 7 36.06575 37.0 37.0 37.0 35.0 37.0 8 36.40275 37.0 37.0 37.0 35.0 37.0 9 38.29225 39.0 39.0 39.0 37.0 39.0 10-11 38.3635 39.0 39.0 39.0 37.0 39.0 12-13 38.350125000000006 39.0 39.0 39.0 37.0 39.0 14-15 39.938375 41.0 40.0 41.0 38.0 41.0 16-17 39.928125 41.0 40.0 41.0 38.0 41.0 18-19 39.9005 41.0 40.0 41.0 38.0 41.0 20-21 39.786625 41.0 40.0 41.0 37.5 41.0 22-23 39.735375 41.0 40.0 41.0 37.5 41.0 24-25 39.609875 41.0 39.0 41.0 37.0 41.0 26-27 39.456374999999994 41.0 39.0 41.0 36.0 41.0 28-29 39.327625 40.0 39.0 41.0 36.0 41.0 30-31 39.075125 40.0 38.0 41.0 35.5 41.0 32-33 38.94175 40.0 38.0 41.0 35.0 41.0 34-35 39.11225 40.0 38.5 41.0 35.0 41.0 36-37 39.246875 41.0 39.0 41.0 35.0 41.0 38-39 39.083124999999995 40.5 38.0 41.0 35.0 41.0 40-41 38.863375 40.0 38.0 41.0 35.0 41.0 42-43 38.7115 40.0 37.5 41.0 35.0 41.0 44-45 38.504625000000004 40.0 37.0 41.0 35.0 41.0 46-47 38.230125 40.0 36.0 41.0 34.0 41.0 48-49 38.00675 39.5 35.0 41.0 34.0 41.0 50-51 37.741375 39.0 35.0 41.0 33.0 41.0 52-53 37.507374999999996 39.0 35.0 41.0 33.0 41.0 54-55 37.23025 38.0 35.0 41.0 33.0 41.0 56-57 36.9855 37.0 35.0 41.0 33.0 41.0 58-59 36.687875 37.0 35.0 40.0 33.0 41.0 60-61 36.40225 36.0 35.0 40.0 33.0 41.0 62-63 36.144625 36.0 35.0 39.5 32.5 41.0 64-65 35.806124999999994 35.0 35.0 39.0 32.0 41.0 66-67 35.56525 35.0 34.0 39.0 31.0 41.0 68-69 35.204625 35.0 34.0 37.5 31.0 40.0 70-71 34.967124999999996 35.0 34.0 37.0 31.0 39.5 72-73 34.5835 35.0 34.0 36.5 30.0 39.0 74-75 34.31325 35.0 34.0 36.0 30.0 39.0 76-77 33.500875 34.5 32.5 35.0 29.0 37.0 78-79 33.898250000000004 35.0 33.0 35.0 30.0 37.0 80-81 33.811375 35.0 34.0 35.0 30.0 37.0 82-83 33.583875 35.0 33.0 35.0 29.5 36.0 84-85 33.4285 35.0 33.0 35.0 29.5 36.0 86-87 33.057625 35.0 33.0 35.0 29.0 35.5 88-89 32.872875 35.0 33.0 35.0 29.0 35.0 90-91 32.63175 35.0 33.0 35.0 27.5 35.0 92-93 32.334 35.0 33.0 35.0 27.0 35.0 94-95 32.28475 35.0 33.0 35.0 27.0 35.0 96-97 31.947875000000003 35.0 32.5 35.0 27.0 35.0 98-99 31.525375 34.5 32.0 35.0 25.0 35.0 100 31.316 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0033610282057523477 1101 2 0.0035761340109203843 1101 3 0.011938372186818924 1101 4 -0.9957919926863994 1101 5 -0.47754833158560217 1101 6 -0.12020381275039682 1101 7 -0.2375843618079685 1101 8 -0.05103385227609181 1101 9 -0.17517679008361853 1101 10-11 -3.361028205759453E-4 1101 12-13 0.11323976230808341 1101 14-15 0.10133500040332422 1101 16-17 0.0952380952380949 1101 18-19 0.2524401064773798 1101 20-21 0.10954263128176223 1101 22-23 0.13022639885993925 1101 24-25 0.0887983651958777 1101 26-27 0.25682288725766966 1101 28-29 0.11211045683095477 1101 30-31 0.22452340620042577 1101 32-33 0.21141539619800653 1101 34-35 0.1673254281949923 1101 36-37 0.1749751283912815 1101 38-39 0.3136713183297033 1101 40-41 0.047081283106123806 1101 42-43 0.13255223037831598 1101 44-45 0.2473044553789947 1101 46-47 0.19271463526122545 1101 48-49 0.2239587534618579 1101 50-51 0.05866338630313095 1101 52-53 0.13657874216880828 1101 54-55 0.3790970933828106 1101 56-57 0.4174195369847524 1101 58-59 0.12000887311445751 1101 60-61 0.059678416821277835 1101 62-63 0.0231507622811975 1101 64-65 0.1620418918555515 1101 66-67 0.03192976795461533 1101 68-69 0.18341803124411626 1101 70-71 0.22185474980506115 1101 72-73 0.0951036541098631 1101 74-75 0.16116802452206258 1101 76-77 0.5659568175096155 1101 78-79 0.4218023177650494 1101 80-81 0.40137398833050497 1101 82-83 -0.006036406657528914 1101 84-85 0.10257858083944882 1101 86-87 0.1303070635368755 1101 88-89 -0.12937269769567905 1101 90-91 0.26620687800811993 1101 92-93 -0.032655750047055676 1101 94-95 -0.02345325481971372 1101 96-97 0.27524804388158586 1101 98-99 0.3365128660159691 1101 100 0.05141028743513232 1104 1 -0.0033610282057452423 1104 2 -0.003576134010913279 1104 3 -0.011938372186818924 1104 4 0.9957919926864065 1104 5 0.47754833158559507 1104 6 0.12020381275039682 1104 7 0.2375843618079614 1104 8 0.0510338522760847 1104 9 0.17517679008362563 1104 10-11 3.361028205759453E-4 1104 12-13 -0.11323976230808341 1104 14-15 -0.10133500040331711 1104 16-17 -0.0952380952380949 1104 18-19 -0.2524401064773727 1104 20-21 -0.10954263128176223 1104 22-23 -0.13022639885993215 1104 24-25 -0.0887983651958777 1104 26-27 -0.25682288725766966 1104 28-29 -0.11211045683095477 1104 30-31 -0.22452340620042577 1104 32-33 -0.21141539619799943 1104 34-35 -0.1673254281949923 1104 36-37 -0.1749751283912815 1104 38-39 -0.3136713183297033 1104 40-41 -0.047081283106123806 1104 42-43 -0.13255223037831598 1104 44-45 -0.2473044553789947 1104 46-47 -0.19271463526121835 1104 48-49 -0.2239587534618579 1104 50-51 -0.058663386303138054 1104 52-53 -0.13657874216880828 1104 54-55 -0.3790970933828035 1104 56-57 -0.41741953698475953 1104 58-59 -0.12000887311446462 1104 60-61 -0.059678416821277835 1104 62-63 -0.023150762281190396 1104 64-65 -0.1620418918555515 1104 66-67 -0.03192976795461533 1104 68-69 -0.18341803124411626 1104 70-71 -0.22185474980506115 1104 72-73 -0.0951036541098631 1104 74-75 -0.16116802452206258 1104 76-77 -0.5659568175096084 1104 78-79 -0.4218023177650494 1104 80-81 -0.4013739883305121 1104 82-83 0.006036406657521809 1104 84-85 -0.10257858083944882 1104 86-87 -0.1303070635368826 1104 88-89 0.12937269769567905 1104 90-91 -0.26620687800811993 1104 92-93 0.032655750047055676 1104 94-95 0.02345325481971372 1104 96-97 -0.2752480438815823 1104 98-99 -0.33651286601597263 1104 100 -0.051410287435128765 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 5.0 27 13.0 28 28.0 29 51.0 30 72.0 31 100.0 32 123.0 33 163.0 34 266.0 35 422.0 36 698.0 37 1009.0 38 891.0 39 159.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.414267834793492 10.312891113892366 14.017521902377972 44.25531914893617 2 26.825 17.95 30.125 25.1 3 26.900000000000002 22.775000000000002 22.05 28.275 4 30.88082901554404 27.383419689119172 15.44041450777202 26.295336787564764 5 29.549999999999997 30.0 19.525000000000002 20.925 6 23.275000000000002 32.45 19.15 25.124999999999996 7 21.224999999999998 13.525 39.175 26.075 8 23.35 18.45 24.075 34.125 9 22.325 18.7 27.375 31.6 10-11 26.937499999999996 27.375 18.025 27.6625 12-13 25.778222277784725 21.177647205900737 25.21565195649456 27.82847855981998 14-15 25.624999999999996 22.7625 23.8375 27.775 16-17 27.212500000000002 22.6 22.8 27.3875 18-19 26.75 22.9375 22.237499999999997 28.075 20-21 26.8375 23.45 22.75 26.9625 22-23 26.900000000000002 22.5625 22.55 27.987499999999997 24-25 27.0125 24.15 22.8625 25.974999999999998 26-27 26.137500000000003 23.962500000000002 22.15 27.750000000000004 28-29 26.05 23.5625 22.5875 27.800000000000004 30-31 26.4125 22.9625 23.225 27.400000000000002 32-33 26.687499999999996 23.775 23.150000000000002 26.387500000000003 34-35 26.174999999999997 22.925 22.925 27.975 36-37 27.4125 22.9875 22.7 26.900000000000002 38-39 26.275 23.799999999999997 22.6 27.325 40-41 26.650000000000002 23.724999999999998 23.1375 26.487500000000004 42-43 26.2625 23.0125 22.9375 27.787499999999998 44-45 27.462500000000002 23.8125 23.2875 25.4375 46-47 27.175 22.875 22.325 27.625 48-49 25.424999999999997 23.625 23.3 27.650000000000002 50-51 26.55 22.275 24.5 26.674999999999997 52-53 27.200000000000003 23.2875 22.275 27.237499999999997 54-55 26.375 23.6125 23.1375 26.875 56-57 26.987499999999997 22.6375 23.3125 27.0625 58-59 27.762500000000003 22.6125 22.3375 27.287499999999998 60-61 25.7 24.0125 22.6375 27.650000000000002 62-63 26.474999999999998 23.2875 23.962500000000002 26.275 64-65 26.724999999999998 22.0875 22.3625 28.825 66-67 27.0125 22.975 22.6375 27.375 68-69 27.187499999999996 23.2875 23.6375 25.887500000000003 70-71 26.950000000000003 23.3 22.3625 27.3875 72-73 26.887499999999996 22.0125 23.7125 27.3875 74-75 26.75 23.1875 23.0125 27.05 76-77 27.1375 23.125 23.3375 26.400000000000002 78-79 26.974999999999998 23.6125 22.537499999999998 26.875 80-81 26.650000000000002 23.1 23.325000000000003 26.924999999999997 82-83 26.937499999999996 23.1875 22.8375 27.037499999999998 84-85 26.825 23.799999999999997 22.8125 26.5625 86-87 27.212500000000002 22.3125 23.3625 27.1125 88-89 27.700000000000003 22.0 23.3 27.0 90-91 27.125 23.5 22.85 26.525 92-93 26.761797471523348 22.581048942295656 23.0692201777444 27.587933408436598 94-95 27.372764786795052 23.42128298111792 22.070776541202953 27.135175690884083 96-97 27.2625 22.650000000000002 23.4625 26.625 98-99 28.19102387798475 23.31541442680335 22.927865983247905 25.565695711963997 100 27.650000000000002 23.125 22.1 27.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.5 29 3.5 30 6.5 31 6.0 32 6.5 33 11.5 34 17.0 35 23.5 36 31.0 37 41.0 38 56.0 39 63.0 40 78.0 41 96.0 42 114.0 43 127.5 44 130.5 45 133.0 46 135.0 47 151.0 48 149.5 49 130.0 50 124.0 51 125.5 52 124.0 53 117.0 54 103.0 55 95.0 56 88.5 57 90.5 58 106.5 59 120.5 60 119.5 61 105.5 62 103.0 63 106.0 64 104.0 65 96.5 66 92.5 67 98.0 68 96.0 69 95.0 70 78.0 71 53.5 72 48.5 73 48.0 74 40.0 75 28.5 76 22.0 77 13.0 78 11.0 79 11.0 80 8.5 81 6.5 82 4.5 83 3.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 3.5000000000000004 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.13749999999999998 94-95 0.0375 96-97 0.0 98-99 0.0125 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.175 0.025 0.0 0.0 0.0 88 0.225 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618221 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618221_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4575 34.0 31.0 34.0 31.0 34.0 2 32.69175 34.0 31.0 34.0 31.0 34.0 3 33.032 34.0 33.0 34.0 31.0 34.0 4 36.45475 37.0 37.0 37.0 35.0 37.0 5 36.50625 37.0 37.0 37.0 35.0 37.0 6 36.49075 37.0 37.0 37.0 35.0 37.0 7 36.4505 37.0 37.0 37.0 35.0 37.0 8 36.48675 37.0 37.0 37.0 35.0 37.0 9 38.2395 39.0 39.0 39.0 37.0 39.0 10-11 38.29575 39.0 39.0 39.0 37.0 39.0 12-13 38.37975 39.0 39.0 39.0 37.0 39.0 14-15 39.98375 41.0 40.0 41.0 38.0 41.0 16-17 39.940124999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.896125 41.0 40.0 41.0 38.0 41.0 20-21 39.833625 41.0 40.0 41.0 38.0 41.0 22-23 39.722625 41.0 40.0 41.0 37.5 41.0 24-25 39.644625000000005 41.0 40.0 41.0 37.0 41.0 26-27 39.57125 41.0 39.0 41.0 36.5 41.0 28-29 39.433 41.0 39.0 41.0 36.0 41.0 30-31 39.19025 40.0 39.0 41.0 35.0 41.0 32-33 39.1875 40.5 39.0 41.0 35.0 41.0 34-35 39.091 40.0 38.0 41.0 35.0 41.0 36-37 38.99975 40.0 38.0 41.0 35.0 41.0 38-39 38.813875 40.0 38.0 41.0 35.0 41.0 40-41 38.527874999999995 40.0 37.5 41.0 34.5 41.0 42-43 38.337 40.0 37.0 41.0 34.5 41.0 44-45 38.06925 40.0 36.0 41.0 33.5 41.0 46-47 37.80825 39.0 35.5 41.0 33.0 41.0 48-49 37.645375 39.0 35.0 41.0 33.0 41.0 50-51 37.077375 38.0 34.5 40.0 32.5 40.5 52-53 37.13125 38.5 35.0 40.0 33.0 41.0 54-55 37.281375 38.5 35.0 41.0 33.0 41.0 56-57 37.121 38.0 35.0 41.0 33.0 41.0 58-59 36.973375000000004 37.0 35.0 41.0 33.0 41.0 60-61 36.7225 36.5 35.0 40.0 33.0 41.0 62-63 36.435 36.0 35.0 40.0 33.0 41.0 64-65 36.16 35.5 35.0 39.0 33.0 41.0 66-67 35.8275 35.0 35.0 39.0 32.0 41.0 68-69 35.460499999999996 35.0 35.0 38.5 31.0 41.0 70-71 35.15925 35.0 34.5 37.0 31.0 40.0 72-73 34.938874999999996 35.0 34.0 37.0 31.0 39.0 74-75 34.651875000000004 35.0 34.0 36.0 31.0 39.0 76-77 34.193124999999995 35.0 34.0 36.0 30.0 38.0 78-79 34.1065 35.0 34.0 35.0 30.0 37.0 80-81 33.934875 35.0 34.0 35.0 30.0 37.0 82-83 33.671875 35.0 33.5 35.0 30.0 36.0 84-85 33.419624999999996 35.0 33.0 35.0 29.0 36.0 86-87 33.285124999999994 35.0 33.0 35.0 29.0 36.0 88-89 33.077 35.0 33.0 35.0 29.0 35.0 90-91 32.827 35.0 33.0 35.0 29.0 35.0 92-93 32.602500000000006 35.0 33.0 35.0 28.0 35.0 94-95 32.251374999999996 35.0 33.0 35.0 27.0 35.0 96-97 31.927125 35.0 32.0 35.0 27.0 35.0 98-99 31.391624999999998 34.0 31.5 35.0 25.0 35.0 100 30.8555 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.459062676453982 1101 2 0.15634158801861275 1101 3 0.08539700465166078 1101 4 0.12624021940792574 1101 5 0.05733914119007011 1101 6 0.06598370573525614 1101 7 0.04502433384420357 1101 8 -0.0023661638568484022 1101 9 0.12849883036218301 1101 10-11 0.11179452017961466 1101 12-13 0.13888440751794917 1101 14-15 0.20541259982253735 1101 16-17 0.1373450565997132 1101 18-19 0.11597563926756038 1101 20-21 0.2030531580221009 1101 22-23 0.11991476432470449 1101 24-25 0.07093786131052582 1101 26-27 0.22016079158935753 1101 28-29 0.24735823183028316 1101 30-31 0.05255303702508485 1101 32-33 0.08260735124089535 1101 34-35 0.12796106584926292 1101 36-37 0.21239009437767464 1101 38-39 0.3941881100266187 1101 40-41 0.21673926487591189 1101 42-43 0.1781681051867352 1101 44-45 0.06441746659137948 1101 46-47 0.0735258530289542 1101 48-49 0.1383668091742578 1101 50-51 -0.03605711059127259 1101 52-53 -0.17684386007366726 1101 54-55 0.013181952622943527 1101 56-57 0.17592293834530182 1101 58-59 0.021839961280953446 1101 60-61 0.09456588959694301 1101 62-63 0.06387298002204744 1101 64-65 0.08350810680003207 1101 66-67 -0.0521564356968085 1101 68-69 0.16405178672259524 1101 70-71 -0.031203785862167877 1101 72-73 -0.07789518969643439 1101 74-75 0.3072651985695458 1101 76-77 -0.09609851845876705 1101 78-79 -0.07126724207468982 1101 80-81 0.144698986313891 1101 82-83 0.28259525153934817 1101 84-85 0.12035169799145251 1101 86-87 -0.10138877685461267 1101 88-89 -0.01656986905433655 1101 90-91 0.048640800193595624 1101 92-93 -0.3012691242504886 1101 94-95 -0.14698448549379606 1101 96-97 -0.29577048210588686 1101 98-99 -0.24685407759941924 1101 100 0.10553628566050932 1104 1 -0.459062676453982 1104 2 -0.15634158801860565 1104 3 -0.08539700465166078 1104 4 -0.12624021940791863 1104 5 -0.057339141190077214 1104 6 -0.06598370573526324 1104 7 -0.04502433384421067 1104 8 0.002366163856841297 1104 9 -0.12849883036218301 1104 10-11 -0.11179452017961466 1104 12-13 -0.13888440751794207 1104 14-15 -0.20541259982253735 1104 16-17 -0.1373450565997132 1104 18-19 -0.11597563926756749 1104 20-21 -0.2030531580221009 1104 22-23 -0.11991476432470449 1104 24-25 -0.07093786131053292 1104 26-27 -0.22016079158936464 1104 28-29 -0.24735823183027605 1104 30-31 -0.05255303702508485 1104 32-33 -0.08260735124089535 1104 34-35 -0.12796106584926292 1104 36-37 -0.21239009437766754 1104 38-39 -0.3941881100266187 1104 40-41 -0.21673926487591189 1104 42-43 -0.1781681051867352 1104 44-45 -0.06441746659137948 1104 46-47 -0.0735258530289542 1104 48-49 -0.13836680917426492 1104 50-51 0.03605711059127259 1104 52-53 0.17684386007367436 1104 54-55 -0.013181952622943527 1104 56-57 -0.17592293834530182 1104 58-59 -0.021839961280953446 1104 60-61 -0.09456588959694301 1104 62-63 -0.06387298002204744 1104 64-65 -0.08350810680003207 1104 66-67 0.0521564356968085 1104 68-69 -0.16405178672259524 1104 70-71 0.031203785862174982 1104 72-73 0.07789518969642728 1104 74-75 -0.3072651985695529 1104 76-77 0.09609851845876705 1104 78-79 0.07126724207469692 1104 80-81 -0.1446989863138981 1104 82-83 -0.2825952515393553 1104 84-85 -0.12035169799145251 1104 86-87 0.10138877685461267 1104 88-89 0.01656986905433655 1104 90-91 -0.048640800193595624 1104 92-93 0.3012691242504886 1104 94-95 0.14698448549380316 1104 96-97 0.29577048210588686 1104 98-99 0.2468540775994228 1104 100 -0.10553628566050932 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 10.0 28 23.0 29 42.0 30 75.0 31 99.0 32 114.0 33 169.0 34 281.0 35 440.0 36 703.0 37 945.0 38 925.0 39 171.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.320290945573113 10.032605969400551 14.773012289942313 45.87409079508402 2 26.724999999999998 18.05 30.85 24.375 3 27.950000000000003 22.3 21.475 28.275 4 29.125 27.775 16.35 26.75 5 29.725 29.725 18.8 21.75 6 22.400000000000002 32.4 19.35 25.85 7 21.827284105131415 13.81727158948686 37.07133917396746 27.284105131414265 8 22.8342513770656 19.028542814221332 24.2864296444667 33.85077616424637 9 22.71703777833375 19.83987990993245 26.51988991743808 30.92319239429572 10-11 28.157039259814955 26.506626656664167 18.842210552638157 26.494123530882717 12-13 24.9875 21.212500000000002 24.7375 29.062500000000004 14-15 25.324999999999996 22.7 24.4875 27.487499999999997 16-17 25.9625 23.150000000000002 22.8625 28.025 18-19 26.7625 23.2375 22.6375 27.3625 20-21 26.474999999999998 23.200000000000003 22.287499999999998 28.037499999999998 22-23 26.950000000000003 23.400000000000002 22.5 27.150000000000002 24-25 26.5125 23.4875 22.825 27.175 26-27 26.275 23.825 22.975 26.924999999999997 28-29 26.6125 22.9625 22.95 27.474999999999998 30-31 26.3625 23.05 23.25 27.3375 32-33 26.887499999999996 22.9625 22.775000000000002 27.375 34-35 26.187500000000004 22.75 23.2875 27.775 36-37 26.0375 23.125 23.325000000000003 27.5125 38-39 26.3 22.9625 23.7875 26.950000000000003 40-41 28.4125 22.2625 23.1625 26.1625 42-43 26.2875 22.8625 23.025000000000002 27.825 44-45 26.7125 23.9125 22.6875 26.687499999999996 46-47 26.700000000000003 23.2125 22.8375 27.250000000000004 48-49 27.0625 22.8875 23.8375 26.2125 50-51 27.275 23.3875 23.0875 26.25 52-53 26.8625 23.474999999999998 23.0125 26.650000000000002 54-55 26.775 22.2125 23.1625 27.85 56-57 26.137500000000003 23.525 23.8625 26.474999999999998 58-59 26.474999999999998 22.825 23.375 27.325 60-61 27.375 23.0625 22.112499999999997 27.450000000000003 62-63 27.250000000000004 23.5625 22.900000000000002 26.2875 64-65 26.474999999999998 22.0125 24.2375 27.275 66-67 26.2625 23.025000000000002 23.2125 27.500000000000004 68-69 27.212500000000002 22.900000000000002 23.875 26.0125 70-71 27.462500000000002 23.3 22.5 26.737499999999997 72-73 26.4125 22.7 23.5 27.3875 74-75 26.8625 22.725 22.9375 27.474999999999998 76-77 27.287499999999998 23.1 23.1875 26.424999999999997 78-79 26.900000000000002 23.2625 22.925 26.9125 80-81 27.400000000000002 23.0 22.925 26.674999999999997 82-83 28.325 23.7875 22.425 25.4625 84-85 26.700000000000003 22.400000000000002 24.0375 26.8625 86-87 26.424999999999997 23.6375 22.55 27.3875 88-89 27.9375 21.75 23.375 26.937499999999996 90-91 26.987499999999997 22.8125 23.4125 26.787499999999998 92-93 28.028503562945367 22.7903487935992 22.652831603950492 26.52831603950494 94-95 27.5875 23.0875 23.200000000000003 26.125 96-97 27.487499999999997 22.6875 22.9625 26.8625 98-99 27.737499999999997 22.875 22.55 26.8375 100 26.674999999999997 23.3 22.225 27.800000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 2.5 29 2.5 30 3.5 31 8.0 32 11.5 33 11.0 34 14.5 35 22.0 36 28.5 37 40.5 38 60.5 39 71.5 40 86.5 41 104.0 42 103.0 43 120.5 44 138.5 45 136.0 46 140.0 47 152.5 48 153.0 49 134.0 50 131.0 51 124.0 52 109.0 53 102.5 54 99.0 55 88.0 56 83.5 57 98.0 58 109.0 59 107.0 60 106.0 61 115.0 62 112.0 63 97.5 64 95.0 65 107.0 66 94.0 67 86.5 68 87.5 69 84.0 70 77.0 71 60.0 72 55.0 73 55.5 74 45.5 75 31.0 76 23.0 77 16.5 78 16.0 79 14.5 80 8.5 81 3.5 82 3.0 83 3.5 84 2.0 85 0.5 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.125 8 0.15 9 0.075 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564785 spots for SRR8618221.sra Written 564785 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra Read 564776 spots for SRR8618221.sra Written 564776 spots for SRR8618221.sra SRR ids: ['SRR8618221.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7nz08dx3 SRR8618221.sra spots: 11295529 blocks: [[1, 564776], [564777, 1129552], [1129553, 1694328], [1694329, 2259104], [2259105, 2823880], [2823881, 3388656], [3388657, 3953432], [3953433, 4518208], [4518209, 5082984], [5082985, 5647760], [5647761, 6212536], [6212537, 6777312], [6777313, 7342088], [7342089, 7906864], [7906865, 8471640], [8471641, 9036416], [9036417, 9601192], [9601193, 10165968], [10165969, 10730744], [10730745, 11295529]] SRR8618221 file size 2939767 SRR8618221 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618221 SRR8618221_1.fastq SRR8618221_2.fastq Input file: SRR8618221_1.fastq Paired file: SRR8618221_2.fastq trimmed: SRR8618221-trimmed-pair1.fastq, SRR8618221-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:15:25 2024 >> started Sat Dec 7 07:15:40 2024 >> done (15.208s) 11295529 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11295529 (100.00%) read pairs available; of these: 1445194 (12.79%) trimmed read pairs available after processing 9850335 (87.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 79 1 0.00% 80 0 0.00% 81 0 0.00% 82 35 0.00% 83 106 0.00% 84 5953 0.05% 85 6488 0.06% 86 7087 0.06% 87 8200 0.07% 88 9619 0.09% 89 11971 0.11% 90 18924 0.17% 91 34149 0.30% 92 47401 0.42% 93 65398 0.58% 94 87045 0.77% 95 112672 1.00% 96 146564 1.30% 97 203099 1.80% 98 289961 2.57% 99 390521 3.46% 100 9850335 87.21% 11295529 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.07 fanout-score-rank=20 prefix-density=0.43 prefix-fanout=2.7 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=34 fanout-score=40.60 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=21 prefix-density=0.44 prefix-fanout=2.6 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=35 fanout-score=44.32 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=9.6 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618221 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:16:19 Started mapping on | Dec 07 07:16:19 Finished on | Dec 07 07:17:07 Mapping speed, Million of reads per hour | 847.16 Number of input reads | 11295529 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11022115 Uniquely mapped reads % | 97.58% Average mapped length | 198.20 Number of splices: Total | 6814918 Number of splices: Annotated (sjdb) | 6492318 Number of splices: GT/AG | 6716169 Number of splices: GC/AG | 79948 Number of splices: AT/AC | 1960 Number of splices: Non-canonical | 16841 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 111647 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 8541 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 161767 161767 161767 N_multimapping 111647 111647 111647 N_noFeature 281773 5519138 5572250 N_ambiguous 252585 19939 21355 UnstrandedReadsAssigned:10487757 PositiveStrandReadsAssigned:5483038 NegativeStrandReadsAssigned:5428510 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618221 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618221-trimmed-pair1.fastq SRR8618221-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,295,529 reads, 10,710,449 reads pseudoaligned [quant] estimated average fragment length: 161.451 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR8618221.ke.tsv 35125 SRR8618221.se.tsv 88098 total ==> SRR8618221.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.616 33.2455 5.44349 PNS24247 1044 883.549 8.18605 1.17661 PNS24249 1928 1767.55 60.8218 4.36997 PNS24246 1044 883.549 8.18605 1.17661 PNS24248 1044 883.549 8.18605 1.17661 PNS24244 1471 1310.55 14.3745 1.39293 PNS24243 293 138.547 3 2.74988 KQK14069 1603 1442.55 3583.77 315.501 KQK14071 474 314.611 355.279 143.412 ==> SRR8618221.se.tsv <== BRADI_1g14170v3 4247 BRADI_1g53295v3 189 BRADI_1g59795v3 269 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 211 BRADI_1g74790v3 29 BRADI_1g09890v3 1 BRADI_1g77505v3 146 BRADI_1g48960v3 0 SRR8618221 completed mapping pipeline successfully