Starting /dee2/code/volunteer_pipeline.sh SRR8618222 current disk space = 1544407683072 free memory = 1601749296 SRR8618222 SRAfilesize 15b44a928cfa18ad924f35cb431ad0e4 SRR8618222.sra SRR8618222.sra file validated SRR8618222 is paired end SRR8618222 is conventional basespace SRR8618222 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618222_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.28025 34.0 31.0 34.0 31.0 34.0 2 32.27075 34.0 31.0 34.0 31.0 34.0 3 32.95925 34.0 31.0 34.0 31.0 34.0 4 36.51125 37.0 37.0 37.0 35.0 37.0 5 36.421 37.0 37.0 37.0 35.0 37.0 6 36.51025 37.0 37.0 37.0 35.0 37.0 7 36.5005 37.0 37.0 37.0 35.0 37.0 8 36.44325 37.0 37.0 37.0 35.0 37.0 9 38.302 39.0 39.0 39.0 37.0 39.0 10-11 38.360125 39.0 39.0 39.0 37.0 39.0 12-13 38.2445 39.0 39.0 39.0 37.0 39.0 14-15 39.828625 41.0 40.0 41.0 38.0 41.0 16-17 39.799 41.0 40.0 41.0 38.0 41.0 18-19 39.658375 41.0 40.0 41.0 37.5 41.0 20-21 39.638875 41.0 39.5 41.0 37.0 41.0 22-23 39.54175 40.5 39.0 41.0 37.0 41.0 24-25 39.3945 40.0 39.0 41.0 36.5 41.0 26-27 39.233875 40.0 39.0 41.0 36.0 41.0 28-29 39.13825 40.0 38.0 41.0 36.0 41.0 30-31 38.916125 40.0 38.0 41.0 35.0 41.0 32-33 38.634 40.0 38.0 41.0 34.5 41.0 34-35 38.506125 40.0 38.0 41.0 34.5 41.0 36-37 38.299625000000006 40.0 37.5 41.0 34.0 41.0 38-39 38.01375 39.5 37.0 41.0 33.5 41.0 40-41 38.18875 40.0 37.0 41.0 34.0 41.0 42-43 38.210499999999996 40.0 36.5 41.0 34.0 41.0 44-45 38.10225 40.0 36.0 41.0 34.0 41.0 46-47 37.8525 39.0 35.0 41.0 33.5 41.0 48-49 37.722125 39.0 35.0 41.0 33.0 41.0 50-51 37.451625 39.0 35.0 41.0 33.0 41.0 52-53 37.137875 38.0 35.0 41.0 33.0 41.0 54-55 36.8985 37.0 35.0 40.0 33.0 41.0 56-57 36.639125 37.0 35.0 40.0 33.0 41.0 58-59 36.269375 36.0 35.0 40.0 32.0 41.0 60-61 36.013125 35.0 35.0 39.5 31.5 41.0 62-63 35.703875 35.0 34.0 39.0 31.0 41.0 64-65 35.46 35.0 34.0 39.0 31.0 41.0 66-67 35.252875 35.0 34.0 38.0 31.0 40.5 68-69 34.851749999999996 35.0 34.0 37.0 30.5 40.0 70-71 34.61025 35.0 34.0 36.5 30.5 39.0 72-73 34.4325 35.0 33.5 36.0 30.5 39.0 74-75 34.046125 35.0 33.0 35.5 29.5 38.5 76-77 32.784499999999994 34.0 31.5 35.0 28.0 36.5 78-79 33.59975 35.0 33.0 35.0 29.0 37.0 80-81 33.670625 35.0 33.0 35.0 29.5 36.5 82-83 33.6215 35.0 33.0 35.0 30.0 36.0 84-85 33.349875 35.0 33.0 35.0 29.0 36.0 86-87 33.047375 35.0 33.0 35.0 29.0 35.0 88-89 32.865125000000006 35.0 33.0 35.0 29.0 35.0 90-91 32.764624999999995 35.0 33.0 35.0 29.0 35.0 92-93 32.5925 35.0 33.0 35.0 28.0 35.0 94-95 32.245125 35.0 33.0 35.0 27.0 35.0 96-97 32.046875 35.0 32.5 35.0 27.0 35.0 98-99 31.688375 34.5 32.0 35.0 26.0 35.0 100 31.39375 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -1.7300000000000004 1101 2 -0.9625000000000057 1101 3 -0.32750000000000057 1101 4 -0.04999999999999716 1101 5 0.00999999999999801 1101 6 0.015000000000000568 1101 7 -0.1524999999999963 1101 8 -0.12750000000000483 1101 9 -0.125 1101 10-11 -0.14499999999999602 1101 12-13 -0.030000000000001137 1101 14-15 0.030000000000001137 1101 16-17 -0.0025000000000048317 1101 18-19 -0.09499999999999886 1101 20-21 -0.1074999999999946 1101 22-23 -0.11625000000000085 1101 24-25 -0.0800000000000054 1101 26-27 -0.1837500000000034 1101 28-29 -0.09499999999999886 1101 30-31 0.20624999999999716 1101 32-33 -0.05875000000000341 1101 34-35 -0.09875000000000256 1101 36-37 -0.08749999999999858 1101 38-39 0.07874999999999943 1101 40-41 0.240000000000002 1101 42-43 -0.07750000000000057 1101 44-45 -0.02125000000000199 1101 46-47 0.05124999999999602 1101 48-49 -0.015000000000000568 1101 50-51 0.10999999999999233 1101 52-53 -0.24249999999999972 1101 54-55 -0.20374999999999943 1101 56-57 -0.12750000000000483 1101 58-59 -0.16375000000000028 1101 60-61 -0.27250000000000085 1101 62-63 -0.054999999999999716 1101 64-65 -0.2875000000000014 1101 66-67 -0.1737499999999983 1101 68-69 -0.17999999999999972 1101 70-71 -0.22500000000000142 1101 72-73 -0.21374999999999744 1101 74-75 -0.3725000000000023 1101 76-77 -0.1875 1101 78-79 -0.042499999999996874 1101 80-81 -0.17874999999999375 1101 82-83 -0.27999999999999403 1101 84-85 -0.3062499999999986 1101 86-87 -0.49875000000000114 1101 88-89 -0.5275000000000034 1101 90-91 -0.20749999999999602 1101 92-93 -0.23874999999999602 1101 94-95 -0.3325000000000031 1101 96-97 -0.48125000000000284 1101 98-99 -0.8350000000000009 1101 100 -0.7300000000000004 1106 1 1.730000000000004 1106 2 0.9624999999999986 1106 3 0.32750000000000057 1106 4 0.05000000000000426 1106 5 -0.00999999999999801 1106 6 -0.015000000000000568 1106 7 0.1525000000000034 1106 8 0.12749999999999773 1106 9 0.125 1106 10-11 0.14500000000000313 1106 12-13 0.030000000000001137 1106 14-15 -0.030000000000001137 1106 16-17 0.0024999999999977263 1106 18-19 0.09499999999999886 1106 20-21 0.1075000000000017 1106 22-23 0.11625000000000085 1106 24-25 0.0800000000000054 1106 26-27 0.1837499999999963 1106 28-29 0.09499999999999886 1106 30-31 -0.20624999999999716 1106 32-33 0.058749999999996305 1106 34-35 0.09875000000000256 1106 36-37 0.08749999999999858 1106 38-39 -0.07874999999999943 1106 40-41 -0.240000000000002 1106 42-43 0.07750000000000057 1106 44-45 0.021249999999994884 1106 46-47 -0.051250000000003126 1106 48-49 0.015000000000000568 1106 50-51 -0.10999999999999943 1106 52-53 0.24249999999999972 1106 54-55 0.20374999999999943 1106 56-57 0.12749999999999773 1106 58-59 0.16375000000000028 1106 60-61 0.27250000000000085 1106 62-63 0.054999999999999716 1106 64-65 0.2875000000000014 1106 66-67 0.1737499999999983 1106 68-69 0.17999999999999972 1106 70-71 0.22500000000000142 1106 72-73 0.21374999999999744 1106 74-75 0.3725000000000023 1106 76-77 0.1875 1106 78-79 0.042499999999996874 1106 80-81 0.17875000000000085 1106 82-83 0.28000000000000114 1106 84-85 0.3062499999999986 1106 86-87 0.49875000000000114 1106 88-89 0.5274999999999963 1106 90-91 0.20749999999999602 1106 92-93 0.23875000000000313 1106 94-95 0.3325000000000031 1106 96-97 0.48124999999999574 1106 98-99 0.8350000000000009 1106 100 0.7300000000000004 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 8.0 28 32.0 29 45.0 30 69.0 31 100.0 32 166.0 33 198.0 34 288.0 35 551.0 36 805.0 37 904.0 38 729.0 39 103.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.082870002647606 10.40508339952343 12.946783161239079 45.56526343658989 2 27.224999999999998 17.7 30.15 24.925 3 28.025 21.224999999999998 21.625 29.125 4 29.125 27.975 15.2 27.700000000000003 5 31.682920730182545 29.15728932233058 19.30482620655164 19.854963740935233 6 23.45 32.550000000000004 18.6 25.4 7 20.724999999999998 13.975000000000001 38.1 27.200000000000003 8 22.625 18.4 23.575 35.4 9 23.075000000000003 18.95 27.35 30.625000000000004 10-11 27.5125 26.7125 18.85 26.924999999999997 12-13 25.15 21.15 24.0 29.7 14-15 25.837500000000002 23.0625 23.925 27.175 16-17 27.05 22.787499999999998 22.3 27.8625 18-19 27.5125 22.3375 22.537499999999998 27.6125 20-21 27.075 23.4875 22.7625 26.674999999999997 22-23 26.825 23.2875 21.95 27.9375 24-25 26.8125 23.825 21.3625 28.000000000000004 26-27 26.400000000000002 23.2375 22.975 27.3875 28-29 27.187499999999996 22.475 22.1 28.237499999999997 30-31 26.775 22.3625 23.375 27.487499999999997 32-33 27.5125 23.0875 22.55 26.85 34-35 27.5125 23.2625 22.0 27.224999999999998 36-37 27.35 22.1375 22.025 28.487499999999997 38-39 27.287499999999998 22.875 22.3 27.537499999999998 40-41 27.3875 23.225 21.95 27.437499999999996 42-43 26.8625 22.9375 22.425 27.775 44-45 28.15 23.4375 21.7875 26.625 46-47 27.325 22.7 22.3875 27.5875 48-49 27.025 22.275 22.6875 28.012500000000003 50-51 26.5 24.075 22.125 27.3 52-53 27.237499999999997 22.0125 22.225 28.525 54-55 26.424999999999997 22.912499999999998 22.7375 27.925 56-57 26.9625 23.200000000000003 22.650000000000002 27.187499999999996 58-59 27.3875 22.8125 21.725 28.075 60-61 27.1 22.1375 22.525000000000002 28.237499999999997 62-63 27.400000000000002 23.1 22.675 26.825 64-65 28.1125 22.6125 21.762500000000003 27.5125 66-67 26.674999999999997 22.1875 22.975 28.1625 68-69 27.200000000000003 22.8125 22.7 27.287499999999998 70-71 28.000000000000004 21.5375 22.525000000000002 27.9375 72-73 27.900000000000002 22.725 22.0875 27.287499999999998 74-75 27.05 22.775000000000002 23.05 27.125 76-77 26.900000000000002 22.6 21.65 28.849999999999998 78-79 27.3375 22.0125 22.825 27.825 80-81 27.3125 23.525 22.162499999999998 27.0 82-83 27.925 22.1875 22.75 27.1375 84-85 27.2625 22.05 23.0625 27.625 86-87 27.737499999999997 22.8125 22.825 26.625 88-89 28.7 21.837500000000002 22.125 27.3375 90-91 27.787499999999998 23.175 22.425 26.6125 92-93 27.762500000000003 22.7625 22.55 26.924999999999997 94-95 27.6125 21.525 23.175 27.6875 96-97 27.1 23.025000000000002 22.125 27.750000000000004 98-99 28.1 23.0125 22.25 26.637499999999996 100 28.65 21.9 22.2 27.250000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 2.0 27 1.5 28 0.5 29 3.0 30 4.5 31 3.5 32 3.0 33 7.5 34 9.5 35 16.0 36 29.0 37 43.5 38 50.0 39 53.5 40 73.0 41 95.5 42 109.0 43 119.5 44 134.0 45 122.0 46 114.5 47 122.5 48 122.5 49 130.5 50 122.0 51 108.0 52 107.5 53 99.5 54 86.5 55 99.0 56 117.0 57 111.5 58 114.0 59 129.0 60 139.0 61 134.5 62 123.5 63 115.0 64 110.0 65 102.0 66 100.0 67 103.0 68 93.0 69 85.0 70 83.0 71 74.5 72 58.5 73 47.5 74 42.5 75 33.0 76 20.5 77 17.0 78 17.0 79 11.5 80 9.0 81 7.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8363268403744 97.675 2 1.1383759170250443 2.25 3 0.025297242600556536 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618222 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618222_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5755 34.0 31.0 34.0 31.0 34.0 2 33.0365 34.0 33.0 34.0 31.0 34.0 3 33.0995 34.0 33.0 34.0 31.0 34.0 4 36.476 37.0 37.0 37.0 35.0 37.0 5 36.43625 37.0 37.0 37.0 35.0 37.0 6 36.48425 37.0 37.0 37.0 35.0 37.0 7 36.4415 37.0 37.0 37.0 35.0 37.0 8 36.508 37.0 37.0 37.0 35.0 37.0 9 38.38125 39.0 39.0 39.0 37.0 39.0 10-11 38.304125 39.0 39.0 39.0 37.0 39.0 12-13 38.343125 39.0 39.0 39.0 37.0 39.0 14-15 40.002624999999995 41.0 40.0 41.0 38.0 41.0 16-17 39.839875 41.0 40.0 41.0 38.0 41.0 18-19 39.7885 41.0 40.0 41.0 37.5 41.0 20-21 39.815625 41.0 40.0 41.0 38.0 41.0 22-23 39.732875 41.0 40.0 41.0 37.5 41.0 24-25 39.6655 41.0 39.5 41.0 37.0 41.0 26-27 39.59075 41.0 39.0 41.0 37.0 41.0 28-29 39.444 41.0 39.0 41.0 36.0 41.0 30-31 39.1595 40.0 39.0 41.0 35.0 41.0 32-33 39.07225 40.0 38.0 41.0 35.0 41.0 34-35 38.956625 40.0 38.0 41.0 35.0 41.0 36-37 38.6815 40.0 38.0 41.0 35.0 41.0 38-39 38.409 40.0 37.5 41.0 34.0 41.0 40-41 38.04275 40.0 36.5 41.0 33.5 41.0 42-43 37.781625000000005 39.5 35.5 41.0 33.0 41.0 44-45 37.696125 39.0 35.0 41.0 33.0 41.0 46-47 37.623125 39.0 35.0 41.0 33.0 41.0 48-49 37.18625 39.0 35.0 41.0 32.5 41.0 50-51 36.118375 37.0 34.0 40.0 30.5 40.5 52-53 36.024625 37.0 34.0 39.5 31.0 40.5 54-55 36.301 37.0 34.5 40.0 31.0 41.0 56-57 36.09325 36.5 34.5 40.0 31.0 41.0 58-59 35.879875 36.0 34.0 40.0 31.0 41.0 60-61 35.974625 36.0 34.5 40.0 31.5 41.0 62-63 35.915499999999994 35.0 35.0 39.0 31.5 41.0 64-65 35.777625 35.0 35.0 39.0 31.5 41.0 66-67 35.521125 35.0 35.0 39.0 31.5 41.0 68-69 35.191 35.0 34.0 37.5 31.0 40.5 70-71 34.873374999999996 35.0 34.0 37.0 31.0 39.5 72-73 34.604124999999996 35.0 34.0 36.5 30.0 39.0 74-75 34.31175 35.0 34.0 36.0 30.0 39.0 76-77 34.062250000000006 35.0 33.5 35.0 30.0 37.0 78-79 33.59925 35.0 33.0 35.0 29.0 37.0 80-81 33.51225 35.0 33.0 35.0 29.0 37.0 82-83 33.228625 35.0 33.0 35.0 29.0 36.0 84-85 32.955375000000004 35.0 33.0 35.0 27.5 36.0 86-87 32.871 35.0 33.0 35.0 28.0 35.5 88-89 32.510625000000005 35.0 32.0 35.0 27.0 35.0 90-91 32.23950000000001 35.0 32.0 35.0 27.0 35.0 92-93 31.945875 35.0 32.0 35.0 25.5 35.0 94-95 31.542375 35.0 32.0 35.0 24.5 35.0 96-97 30.804375 34.0 31.0 35.0 22.0 35.0 98-99 30.3495 34.0 31.0 35.0 20.0 35.0 100 29.73075 34.0 30.0 35.0 16.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.35249999999999915 1101 2 -0.09000000000000341 1101 3 0.03999999999999915 1101 4 0.012499999999995737 1101 5 0.07250000000000512 1101 6 0.14500000000000313 1101 7 -0.05500000000000682 1101 8 0.03499999999999659 1101 9 -0.0024999999999977263 1101 10-11 0.16874999999999574 1101 12-13 0.007500000000000284 1101 14-15 0.03125 1101 16-17 0.09250000000000114 1101 18-19 -0.05749999999999744 1101 20-21 -0.12749999999999773 1101 22-23 -0.12249999999999517 1101 24-25 -0.027499999999996305 1101 26-27 -0.0799999999999983 1101 28-29 -0.060000000000002274 1101 30-31 0.13250000000000028 1101 32-33 -0.042499999999996874 1101 34-35 -0.10875000000000057 1101 36-37 -0.166249999999998 1101 38-39 -0.2737499999999997 1101 40-41 -0.12250000000000227 1101 42-43 -0.22125000000000483 1101 44-45 -0.28000000000000114 1101 46-47 -0.42500000000000426 1101 48-49 -0.2987499999999983 1101 50-51 -0.426249999999996 1101 52-53 -0.261250000000004 1101 54-55 -0.2674999999999983 1101 56-57 -0.19250000000000256 1101 58-59 -0.3674999999999997 1101 60-61 -0.3712500000000034 1101 62-63 -0.26624999999999943 1101 64-65 -0.07000000000000028 1101 66-67 -0.291249999999998 1101 68-69 -0.4437499999999943 1101 70-71 -0.3062499999999986 1101 72-73 -0.25500000000000256 1101 74-75 -0.10374999999999801 1101 76-77 -0.35249999999999915 1101 78-79 -0.44624999999999915 1101 80-81 -0.5887500000000045 1101 82-83 -0.19500000000000028 1101 84-85 -0.3162500000000037 1101 86-87 -0.5412500000000051 1101 88-89 -0.35249999999999915 1101 90-91 -0.9912500000000009 1101 92-93 -0.9175000000000004 1101 94-95 -0.6162500000000009 1101 96-97 -0.5812500000000007 1101 98-99 -0.8637500000000031 1101 100 -0.9199999999999982 1106 1 0.35249999999999915 1106 2 0.0899999999999963 1106 3 -0.03999999999999915 1106 4 -0.012500000000002842 1106 5 -0.07249999999999801 1106 6 -0.14499999999999602 1106 7 0.054999999999999716 1106 8 -0.035000000000003695 1106 9 0.0024999999999977263 1106 10-11 -0.16875000000000284 1106 12-13 -0.007500000000000284 1106 14-15 -0.03125 1106 16-17 -0.09250000000000114 1106 18-19 0.05750000000000455 1106 20-21 0.12750000000000483 1106 22-23 0.12250000000000227 1106 24-25 0.027499999999996305 1106 26-27 0.0799999999999983 1106 28-29 0.060000000000002274 1106 30-31 -0.13250000000000028 1106 32-33 0.04250000000000398 1106 34-35 0.10875000000000057 1106 36-37 0.166249999999998 1106 38-39 0.2737499999999997 1106 40-41 0.12250000000000227 1106 42-43 0.22125000000000483 1106 44-45 0.28000000000000114 1106 46-47 0.42499999999999716 1106 48-49 0.2987499999999983 1106 50-51 0.4262500000000031 1106 52-53 0.261250000000004 1106 54-55 0.2675000000000054 1106 56-57 0.19249999999999545 1106 58-59 0.3674999999999997 1106 60-61 0.3712500000000034 1106 62-63 0.26624999999999943 1106 64-65 0.06999999999999318 1106 66-67 0.291249999999998 1106 68-69 0.4437500000000014 1106 70-71 0.3062499999999986 1106 72-73 0.25500000000000256 1106 74-75 0.10374999999999801 1106 76-77 0.35249999999999915 1106 78-79 0.44624999999999915 1106 80-81 0.5887499999999974 1106 82-83 0.19500000000000028 1106 84-85 0.3162500000000037 1106 86-87 0.541249999999998 1106 88-89 0.35249999999999915 1106 90-91 0.9912500000000009 1106 92-93 0.9175000000000004 1106 94-95 0.6162500000000009 1106 96-97 0.5812500000000007 1106 98-99 0.8637499999999996 1106 100 0.9200000000000017 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 1.0 27 12.0 28 41.0 29 72.0 30 89.0 31 118.0 32 136.0 33 224.0 34 320.0 35 479.0 36 741.0 37 881.0 38 764.0 39 120.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.325000000000003 9.950000000000001 13.225000000000001 47.5 2 27.820865649236925 17.28796597448086 30.2727045283963 24.618463847885916 3 28.564282141070535 22.086043021510758 21.710855427713856 27.63881940970485 4 30.472854640980735 26.670002501876404 15.911933950462847 26.945208906680012 5 31.10777694423606 28.557139284821204 19.154788697174293 21.180295073768445 6 23.724999999999998 32.025 19.875 24.375 7 20.424999999999997 13.375 37.9 28.299999999999997 8 23.200000000000003 19.8 22.675 34.325 9 24.45 18.65 26.25 30.65 10-11 27.55 26.1125 18.825 27.5125 12-13 25.137500000000003 20.7625 25.15 28.95 14-15 26.9125 22.400000000000002 22.2625 28.425 16-17 26.325 22.425 21.95 29.299999999999997 18-19 26.6125 23.1 23.1375 27.150000000000002 20-21 27.575 22.6375 22.225 27.5625 22-23 27.287499999999998 21.9375 22.85 27.925 24-25 26.625 23.0625 21.9625 28.349999999999998 26-27 26.7125 23.3125 22.4625 27.5125 28-29 28.4 22.112499999999997 22.4375 27.05 30-31 25.575 23.3375 22.8875 28.199999999999996 32-33 26.900000000000002 23.0625 22.287499999999998 27.750000000000004 34-35 26.7125 22.975 22.95 27.3625 36-37 26.3 23.200000000000003 22.4875 28.012500000000003 38-39 26.75 23.6125 21.875 27.762500000000003 40-41 27.1 22.5 22.175 28.225 42-43 26.7125 22.662499999999998 23.1 27.525 44-45 27.474999999999998 23.150000000000002 23.0 26.375 46-47 27.287499999999998 22.912499999999998 21.762500000000003 28.037499999999998 48-49 26.8125 22.3375 22.9375 27.9125 50-51 26.724999999999998 23.1625 22.0875 28.025 52-53 26.9125 23.2125 22.1875 27.6875 54-55 26.525 23.225 23.0875 27.1625 56-57 27.224999999999998 23.25 21.95 27.575 58-59 27.5875 21.8875 22.575 27.950000000000003 60-61 26.525 22.775000000000002 23.3125 27.3875 62-63 27.35 22.725 21.925 28.000000000000004 64-65 26.787499999999998 22.925 21.9375 28.349999999999998 66-67 26.0125 22.725 23.4125 27.85 68-69 27.537499999999998 22.412499999999998 22.475 27.575 70-71 27.737499999999997 21.6 21.95 28.712500000000002 72-73 27.025 22.5 21.8125 28.6625 74-75 27.737499999999997 23.1 22.3875 26.775 76-77 28.575 21.987499999999997 21.212500000000002 28.225 78-79 27.212500000000002 22.975 22.6875 27.125 80-81 27.0 22.5875 23.05 27.3625 82-83 27.900000000000002 22.1 22.912499999999998 27.0875 84-85 26.875 23.2125 22.7 27.212500000000002 86-87 27.900000000000002 23.150000000000002 22.0125 26.937499999999996 88-89 27.6375 21.55 22.35 28.462500000000002 90-91 26.7625 22.8125 23.425 27.0 92-93 26.325 23.2375 22.55 27.8875 94-95 28.537499999999998 21.9375 22.75 26.775 96-97 27.3 22.7 22.75 27.250000000000004 98-99 29.7 21.512500000000003 21.762500000000003 27.025 100 28.249999999999996 21.575 22.7 27.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 0.5 27 1.5 28 2.0 29 1.5 30 2.0 31 5.0 32 8.0 33 10.0 34 13.5 35 16.5 36 20.0 37 32.0 38 41.0 39 53.5 40 73.5 41 90.5 42 101.5 43 124.5 44 145.5 45 131.5 46 127.5 47 138.0 48 129.0 49 116.5 50 119.5 51 120.5 52 108.0 53 100.0 54 99.5 55 91.5 56 97.5 57 105.5 58 109.0 59 125.0 60 136.5 61 124.5 62 107.5 63 102.0 64 96.0 65 102.5 66 112.0 67 114.0 68 109.0 69 91.5 70 81.0 71 70.5 72 57.5 73 55.5 74 49.0 75 37.5 76 27.0 77 19.5 78 14.5 79 11.0 80 7.5 81 3.5 82 2.0 83 2.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.05 4 0.075 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70689655172413 97.32499999999999 2 1.1663286004056794 2.3 3 0.12677484787018256 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523173 spots for SRR8618222.sra Written 523173 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra Read 523160 spots for SRR8618222.sra Written 523160 spots for SRR8618222.sra SRR ids: ['SRR8618222.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wobr0xhb SRR8618222.sra spots: 10463213 blocks: [[1, 523160], [523161, 1046320], [1046321, 1569480], [1569481, 2092640], [2092641, 2615800], [2615801, 3138960], [3138961, 3662120], [3662121, 4185280], [4185281, 4708440], [4708441, 5231600], [5231601, 5754760], [5754761, 6277920], [6277921, 6801080], [6801081, 7324240], [7324241, 7847400], [7847401, 8370560], [8370561, 8893720], [8893721, 9416880], [9416881, 9940040], [9940041, 10463213]] SRR8618222 file size 2722214 SRR8618222 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618222 SRR8618222_1.fastq SRR8618222_2.fastq Input file: SRR8618222_1.fastq Paired file: SRR8618222_2.fastq trimmed: SRR8618222-trimmed-pair1.fastq, SRR8618222-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:28:12 2024 >> started Sat Dec 7 07:28:23 2024 >> done (11.227s) 10463213 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 10463213 (100.00%) read pairs available; of these: 1224980 (11.71%) trimmed read pairs available after processing 9238233 (88.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 4 0.00% 82 23 0.00% 83 89 0.00% 84 5654 0.05% 85 5945 0.06% 86 6531 0.06% 87 7194 0.07% 88 8768 0.08% 89 10683 0.10% 90 16770 0.16% 91 30379 0.29% 92 42386 0.41% 93 57596 0.55% 94 76959 0.74% 95 95970 0.92% 96 126039 1.20% 97 173826 1.66% 98 242014 2.31% 99 318149 3.04% 100 9238233 88.29% 10463213 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=17 prefix-density=0.58 prefix-fanout=2.4 sequence=CTCGCCATGTTCTCCATGTTCGG criterion=fanout-score sequence-density=0.27 sequence-density-rank=10 fanout-score=8.37 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=3.6 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=27 prefix-density=0.45 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.27 sequence-density-rank=7 fanout-score=8.76 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=3.6 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618222 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:29:07 Started mapping on | Dec 07 07:29:07 Finished on | Dec 07 07:29:42 Mapping speed, Million of reads per hour | 1076.22 Number of input reads | 10463213 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10265362 Uniquely mapped reads % | 98.11% Average mapped length | 198.38 Number of splices: Total | 5995834 Number of splices: Annotated (sjdb) | 5718952 Number of splices: GT/AG | 5915199 Number of splices: GC/AG | 67620 Number of splices: AT/AC | 1441 Number of splices: Non-canonical | 11574 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 77496 % of reads mapped to multiple loci | 0.74% Number of reads mapped to too many loci | 5014 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.88% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 120355 120355 120355 N_multimapping 77496 77496 77496 N_noFeature 194009 5119801 5156232 N_ambiguous 223305 19725 21740 UnstrandedReadsAssigned:9848048 PositiveStrandReadsAssigned:5125836 NegativeStrandReadsAssigned:5087390 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618222 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618222-trimmed-pair1.fastq SRR8618222-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,463,213 reads, 10,013,094 reads pseudoaligned [quant] estimated average fragment length: 161.43 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52973 SRR8618222.ke.tsv 35125 SRR8618222.se.tsv 88098 total ==> SRR8618222.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.666 0 0 PNS24247 1044 883.57 15.1172 2.27229 PNS24249 1928 1767.57 52.0772 3.91296 PNS24246 1044 883.57 15.1172 2.27229 PNS24248 1044 883.57 15.1172 2.27229 PNS24244 1471 1310.57 13.5713 1.37529 PNS24243 293 138.061 5 4.80985 KQK14069 1603 1442.57 3444.18 317.091 KQK14071 474 314.539 408.542 172.502 ==> SRR8618222.se.tsv <== BRADI_1g14170v3 4215 BRADI_1g53295v3 94 BRADI_1g59795v3 197 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 119 BRADI_1g74790v3 21 BRADI_1g09890v3 0 BRADI_1g77505v3 107 BRADI_1g48960v3 0 SRR8618222 completed mapping pipeline successfully