Starting /dee2/code/volunteer_pipeline.sh SRR8618223 current disk space = 1544366043136 free memory = 1597099368 SRR8618223 SRAfilesize 31befea43fe9ebd05a20b38a48dec595 SRR8618223.sra SRR8618223.sra file validated SRR8618223 is paired end SRR8618223 is conventional basespace SRR8618223 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618223_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97375 34.0 31.0 34.0 31.0 34.0 2 33.2175 34.0 33.0 34.0 31.0 34.0 3 33.306 34.0 34.0 34.0 31.0 34.0 4 35.35325 37.0 37.0 37.0 35.0 37.0 5 35.9545 37.0 37.0 37.0 35.0 37.0 6 36.367 37.0 37.0 37.0 35.0 37.0 7 36.079 37.0 37.0 37.0 35.0 37.0 8 36.41875 37.0 37.0 37.0 35.0 37.0 9 38.31475 39.0 39.0 39.0 37.0 39.0 10-11 38.38075 39.0 39.0 39.0 37.0 39.0 12-13 38.385625 39.0 39.0 39.0 37.0 39.0 14-15 40.069500000000005 41.0 40.0 41.0 38.0 41.0 16-17 39.9805 41.0 40.0 41.0 38.0 41.0 18-19 39.945875 41.0 40.0 41.0 38.0 41.0 20-21 39.9015 41.0 40.0 41.0 38.0 41.0 22-23 39.799875 41.0 40.0 41.0 37.5 41.0 24-25 39.665375 41.0 39.5 41.0 37.0 41.0 26-27 39.516375 41.0 39.0 41.0 36.5 41.0 28-29 39.37287499999999 40.5 39.0 41.0 36.5 41.0 30-31 39.150999999999996 40.0 38.5 41.0 35.5 41.0 32-33 39.08325 40.0 38.5 41.0 35.0 41.0 34-35 39.21625 40.5 39.0 41.0 35.0 41.0 36-37 39.314750000000004 41.0 39.0 41.0 35.0 41.0 38-39 39.201750000000004 41.0 38.5 41.0 35.0 41.0 40-41 39.033625 40.5 38.0 41.0 35.0 41.0 42-43 38.795125 40.0 37.5 41.0 35.0 41.0 44-45 38.530625 40.0 37.0 41.0 35.0 41.0 46-47 38.298375 40.0 36.0 41.0 34.0 41.0 48-49 38.033125 39.5 35.0 41.0 34.0 41.0 50-51 37.651375 39.0 35.0 41.0 33.0 41.0 52-53 37.43375 39.0 35.0 41.0 33.0 41.0 54-55 37.142624999999995 38.0 35.0 41.0 33.0 41.0 56-57 36.902625 37.0 35.0 40.5 33.0 41.0 58-59 36.58175 36.5 35.0 40.0 33.0 41.0 60-61 36.31625 36.0 35.0 40.0 32.5 41.0 62-63 36.055625 35.0 35.0 39.5 32.0 41.0 64-65 35.713625 35.0 35.0 39.0 31.5 41.0 66-67 35.585875 35.0 35.0 39.0 31.5 41.0 68-69 35.1335 35.0 34.0 37.5 31.0 40.0 70-71 34.98425 35.0 34.0 37.0 31.0 39.5 72-73 34.579625 35.0 34.0 36.0 30.5 39.0 74-75 34.361875 35.0 34.0 36.0 30.0 39.0 76-77 33.50475 34.5 32.5 35.0 29.0 37.0 78-79 33.899125 35.0 33.5 35.0 30.0 37.0 80-81 33.815375 35.0 34.0 35.0 30.0 36.5 82-83 33.59075 35.0 33.0 35.0 30.0 36.0 84-85 33.468875 35.0 33.5 35.0 29.5 36.0 86-87 33.183375 35.0 33.0 35.0 29.0 35.5 88-89 32.840999999999994 35.0 33.0 35.0 29.0 35.0 90-91 32.693 35.0 33.0 35.0 29.0 35.0 92-93 32.36 35.0 33.0 35.0 27.0 35.0 94-95 32.288250000000005 35.0 33.0 35.0 27.0 35.0 96-97 32.049625 35.0 33.0 35.0 27.0 35.0 98-99 31.6435 35.0 32.5 35.0 26.0 35.0 100 31.265 35.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.16882427843803072 1101 2 -0.14579796264855815 1101 3 -0.07693123938879154 1101 4 -0.8785016977928706 1101 5 -0.4284804753820026 1101 6 -0.08658743633277055 1101 7 -0.5154923599320824 1101 8 -0.049235993208831985 1101 9 -0.3071943972835314 1101 10-11 -0.07369482173174902 1101 12-13 -0.02668718166383144 1101 14-15 -0.035441426146014976 1101 16-17 0.05210101867572092 1101 18-19 -0.07385398981324443 1101 20-21 -0.14171264855686871 1101 22-23 -0.12070246179965949 1101 24-25 -0.20214346349744972 1101 26-27 -0.18962224108658887 1101 28-29 -0.16468590831919272 1101 30-31 0.09948005093378498 1101 32-33 0.15317275042444578 1101 34-35 -0.0780454159592523 1101 36-37 -0.025042444821728793 1101 38-39 -0.13253395585738303 1101 40-41 -0.038624787775887626 1101 42-43 -0.013529286926996065 1101 44-45 0.05592105263158231 1101 46-47 -0.018039049235987648 1101 48-49 0.030931663837009182 1101 50-51 0.10887096774193594 1101 52-53 -0.03130305602716277 1101 54-55 -0.10388370118845813 1101 56-57 -0.03650254668930586 1101 58-59 0.054859932088284324 1101 60-61 0.007480899830220267 1101 62-63 0.03682088285229668 1101 64-65 -0.11651103565365162 1101 66-67 -0.21036714770797715 1101 68-69 -0.023450764006788916 1101 70-71 -0.05305602716468627 1101 72-73 -0.25525254668930586 1101 74-75 -0.17529711375212287 1101 76-77 -0.13179117147707586 1101 78-79 -0.46880305602716277 1101 80-81 -0.2572686757215621 1101 82-83 -0.4356430390492321 1101 84-85 -0.38598259762309084 1101 86-87 -0.3206175721562019 1101 88-89 -0.15232385398981307 1101 90-91 -0.5082767402376902 1101 92-93 -0.44354838709677225 1101 94-95 -0.21609719864176213 1101 96-97 -0.514696519524616 1101 98-99 -0.4662033106960948 1101 100 -0.5782045840407477 1104 1 0.16882427843803072 1104 2 0.14579796264855815 1104 3 0.07693123938879154 1104 4 0.8785016977928706 1104 5 0.4284804753820026 1104 6 0.08658743633276345 1104 7 0.5154923599320895 1104 8 0.04923599320882488 1104 9 0.3071943972835314 1104 10-11 0.07369482173174902 1104 12-13 0.026687181663838544 1104 14-15 0.03544142614600787 1104 16-17 -0.05210101867572092 1104 18-19 0.07385398981324443 1104 20-21 0.14171264855687582 1104 22-23 0.12070246179965949 1104 24-25 0.20214346349745682 1104 26-27 0.18962224108658887 1104 28-29 0.16468590831918561 1104 30-31 -0.09948005093378498 1104 32-33 -0.15317275042444578 1104 34-35 0.0780454159592523 1104 36-37 0.025042444821728793 1104 38-39 0.13253395585739014 1104 40-41 0.03862478777589473 1104 42-43 0.013529286926996065 1104 44-45 -0.05592105263158231 1104 46-47 0.018039049235994753 1104 48-49 -0.030931663837016288 1104 50-51 -0.10887096774193594 1104 52-53 0.03130305602716987 1104 54-55 0.10388370118845103 1104 56-57 0.03650254668930586 1104 58-59 -0.054859932088284324 1104 60-61 -0.007480899830220267 1104 62-63 -0.03682088285228957 1104 64-65 0.11651103565365162 1104 66-67 0.21036714770797715 1104 68-69 0.02345076400679602 1104 70-71 0.05305602716468627 1104 72-73 0.25525254668930586 1104 74-75 0.17529711375212287 1104 76-77 0.13179117147707586 1104 78-79 0.4688030560271699 1104 80-81 0.2572686757215621 1104 82-83 0.4356430390492392 1104 84-85 0.38598259762309084 1104 86-87 0.3206175721561948 1104 88-89 0.15232385398981307 1104 90-91 0.5082767402376902 1104 92-93 0.4435483870967758 1104 94-95 0.21609719864176924 1104 96-97 0.5146965195246125 1104 98-99 0.4662033106960948 1104 100 0.5782045840407477 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 11.0 28 27.0 29 57.0 30 73.0 31 90.0 32 102.0 33 154.0 34 245.0 35 437.0 36 773.0 37 961.0 38 901.0 39 165.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.894842263395095 10.665998998497747 12.819228843264895 46.619929894842265 2 26.3 17.45 33.0 23.25 3 26.450000000000003 21.7 22.15 29.7 4 29.517133956386292 26.9730010384216 17.315680166147455 26.194184839044652 5 31.1 29.075 17.875 21.95 6 23.625 32.300000000000004 19.15 24.925 7 21.825 13.950000000000001 37.9 26.325 8 23.0 17.974999999999998 25.624999999999996 33.4 9 23.95 17.525 27.650000000000002 30.875000000000004 10-11 27.8625 26.637499999999996 18.35 27.150000000000002 12-13 26.2875 20.962500000000002 24.5625 28.1875 14-15 25.124999999999996 23.7625 23.4125 27.700000000000003 16-17 26.1125 22.925 23.5 27.462500000000002 18-19 27.85 22.5 22.45 27.200000000000003 20-21 25.474999999999998 23.799999999999997 22.8875 27.8375 22-23 27.325 23.674999999999997 21.4875 27.5125 24-25 27.037499999999998 22.775000000000002 21.825 28.3625 26-27 26.0 23.3875 23.200000000000003 27.4125 28-29 26.924999999999997 22.6375 23.45 26.987499999999997 30-31 26.8 23.0875 22.4625 27.650000000000002 32-33 26.737499999999997 23.125 22.55 27.5875 34-35 26.275 22.225 23.825 27.675 36-37 26.424999999999997 23.125 22.8 27.650000000000002 38-39 26.337500000000002 22.5125 22.9625 28.1875 40-41 26.9625 23.025000000000002 22.425 27.5875 42-43 26.5625 23.3 22.725 27.4125 44-45 28.075 21.975 22.6875 27.2625 46-47 26.400000000000002 23.5625 21.9625 28.075 48-49 27.987499999999997 21.975 22.075 27.962500000000002 50-51 27.224999999999998 22.725 22.175 27.875 52-53 27.1625 23.4125 22.125 27.3 54-55 26.950000000000003 23.150000000000002 22.2 27.700000000000003 56-57 27.425 22.075 23.5125 26.987499999999997 58-59 26.737499999999997 23.0625 22.3 27.900000000000002 60-61 27.3625 22.775000000000002 22.025 27.8375 62-63 27.650000000000002 22.0125 23.35 26.987499999999997 64-65 27.1 22.287499999999998 22.6 28.012500000000003 66-67 27.025 22.3625 22.6375 27.975 68-69 26.1125 22.9625 23.95 26.974999999999998 70-71 27.1 22.4875 22.900000000000002 27.5125 72-73 25.9875 22.650000000000002 23.3125 28.050000000000004 74-75 27.125 23.625 22.4875 26.7625 76-77 26.337500000000002 23.7125 22.912499999999998 27.037499999999998 78-79 27.025 22.875 22.537499999999998 27.5625 80-81 27.0875 22.3625 23.6125 26.937499999999996 82-83 27.275 21.825 23.1375 27.762500000000003 84-85 27.05 22.537499999999998 23.2375 27.175 86-87 27.487499999999997 23.25 22.650000000000002 26.6125 88-89 27.487499999999997 22.6375 22.287499999999998 27.5875 90-91 27.6 23.0625 22.725 26.6125 92-93 27.618570892253786 22.82567888874984 22.92579151545489 26.629958703541483 94-95 27.962500000000002 22.075 22.9875 26.974999999999998 96-97 26.6125 23.9375 21.8875 27.5625 98-99 26.637499999999996 23.8625 22.5125 26.987499999999997 100 27.474999999999998 23.525 22.575 26.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.0 29 1.0 30 3.0 31 4.0 32 3.5 33 5.5 34 10.5 35 16.5 36 27.5 37 38.5 38 44.5 39 63.0 40 79.5 41 107.0 42 124.5 43 128.0 44 136.5 45 136.5 46 138.0 47 139.5 48 134.0 49 120.0 50 120.0 51 115.5 52 109.5 53 107.5 54 98.5 55 85.5 56 80.0 57 97.0 58 108.5 59 119.0 60 131.5 61 123.5 62 114.0 63 113.5 64 115.0 65 116.5 66 111.5 67 104.5 68 104.0 69 92.5 70 71.0 71 55.0 72 48.0 73 49.5 74 42.5 75 32.5 76 23.5 77 15.5 78 11.0 79 7.5 80 6.5 81 3.0 82 1.0 83 1.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 3.6999999999999997 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.11249999999999999 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78481012658227 97.55 2 1.1645569620253164 2.3 3 0.05063291139240507 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618223 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618223_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54475 34.0 31.0 34.0 31.0 34.0 2 32.77175 34.0 31.0 34.0 31.0 34.0 3 33.08075 34.0 33.0 34.0 31.0 34.0 4 36.48675 37.0 37.0 37.0 35.0 37.0 5 36.5375 37.0 37.0 37.0 35.0 37.0 6 36.57875 37.0 37.0 37.0 35.0 37.0 7 36.4635 37.0 37.0 37.0 35.0 37.0 8 36.51525 37.0 37.0 37.0 35.0 37.0 9 38.34475 39.0 39.0 39.0 37.0 39.0 10-11 38.37425 39.0 39.0 39.0 37.0 39.0 12-13 38.379999999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.9975 41.0 40.0 41.0 38.0 41.0 16-17 39.966875 41.0 40.0 41.0 38.0 41.0 18-19 39.999624999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.911500000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.845749999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.73950000000001 41.0 40.0 41.0 37.5 41.0 26-27 39.607 41.0 39.5 41.0 37.0 41.0 28-29 39.450874999999996 41.0 39.0 41.0 36.5 41.0 30-31 39.272625 40.5 39.0 41.0 36.0 41.0 32-33 39.360625 41.0 39.0 41.0 35.5 41.0 34-35 39.217 40.5 38.5 41.0 35.0 41.0 36-37 38.968875 40.0 38.0 41.0 35.0 41.0 38-39 38.817875 40.0 38.0 41.0 35.0 41.0 40-41 38.586625 40.0 37.5 41.0 34.5 41.0 42-43 38.352375 40.0 37.0 41.0 34.0 41.0 44-45 38.06075 40.0 36.0 41.0 33.5 41.0 46-47 37.750625 39.0 35.0 41.0 33.0 41.0 48-49 37.683499999999995 39.0 35.0 41.0 33.0 41.0 50-51 37.048 38.5 34.5 40.0 32.0 40.5 52-53 37.135000000000005 38.0 35.0 40.0 33.0 41.0 54-55 37.294124999999994 38.0 35.0 41.0 33.0 41.0 56-57 37.096375 37.5 35.0 41.0 33.0 41.0 58-59 36.854749999999996 37.0 35.0 40.5 33.0 41.0 60-61 36.590875 36.0 35.0 40.0 33.0 41.0 62-63 36.28675 35.5 35.0 39.5 33.0 41.0 64-65 35.99875 35.0 35.0 39.0 32.5 41.0 66-67 35.681375 35.0 35.0 39.0 31.5 41.0 68-69 35.386125 35.0 35.0 37.5 31.0 40.5 70-71 35.1035 35.0 34.0 37.0 31.5 39.5 72-73 34.81975 35.0 34.0 36.5 31.0 39.0 74-75 34.539625 35.0 34.0 36.0 31.0 39.0 76-77 34.08775 35.0 34.0 35.5 30.0 37.0 78-79 33.922 35.0 33.5 35.0 30.0 37.0 80-81 33.726749999999996 35.0 33.0 35.0 30.0 36.5 82-83 33.633250000000004 35.0 33.5 35.0 30.0 36.0 84-85 33.381875 35.0 33.0 35.0 29.0 36.0 86-87 33.15925 35.0 33.0 35.0 29.0 35.5 88-89 33.03675 35.0 33.0 35.0 29.0 35.0 90-91 32.789249999999996 35.0 33.0 35.0 28.0 35.0 92-93 32.407375 35.0 33.0 35.0 27.0 35.0 94-95 32.177 35.0 33.0 35.0 27.0 35.0 96-97 31.503375 34.0 31.5 35.0 24.0 35.0 98-99 31.094125 34.0 31.0 35.0 24.0 35.0 100 30.711 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.110674872665534 1101 2 -0.2574278438030575 1101 3 -0.05019100169779023 1101 4 -0.05008488964346469 1101 5 -0.001485568760614342 1101 6 0.028013582342957477 1101 7 0.14558573853989287 1101 8 0.0026528013582378662 1101 9 -0.004456706281828815 1101 10-11 0.05501910016977973 1101 12-13 0.05602716468590785 1101 14-15 0.07947792869269676 1101 16-17 0.05374575551783067 1101 18-19 0.0740662139218955 1101 20-21 0.10165534804753662 1101 22-23 -0.015863752122236008 1101 24-25 -0.11200127334465293 1101 26-27 0.001963073005093463 1101 28-29 0.031727504244486227 1101 30-31 -0.07507427843803072 1101 32-33 0.2884656196943993 1101 34-35 0.23158955857385166 1101 36-37 0.046795415959252296 1101 38-39 0.2892084040747065 1101 40-41 0.14298599320882488 1101 42-43 -0.0075339558573830345 1101 44-45 0.17768463497453268 1101 46-47 -0.07576400679116801 1101 48-49 -0.18410441426145496 1101 50-51 0.14526740237690916 1101 52-53 -0.044673174872663424 1101 54-55 0.02551994906621502 1101 56-57 -0.10743845500848437 1101 58-59 -0.2135505093378569 1101 60-61 -0.1460632427843791 1101 62-63 0.05374575551783067 1101 64-65 -0.26496179966044053 1101 66-67 -0.21068548387096797 1101 68-69 -0.058573853989813074 1101 70-71 -0.12176358234295748 1101 72-73 -0.23625848896433865 1101 74-75 -0.1301994906621431 1101 76-77 -0.18951612903225623 1101 78-79 -0.30517826825127514 1101 80-81 -0.21795415959253006 1101 82-83 -0.07380093378608166 1101 84-85 -0.1215513582342993 1101 86-87 -0.3624257215619693 1101 88-89 -0.4360674872665484 1101 90-91 -0.5049872665534778 1101 92-93 -0.4066213921901465 1101 94-95 -0.38460314091680914 1101 96-97 0.05767190152801405 1101 98-99 -0.410282258064516 1101 100 -0.4328310696095059 1104 1 -0.110674872665534 1104 2 0.2574278438030504 1104 3 0.05019100169779023 1104 4 0.05008488964346469 1104 5 0.0014855687606072365 1104 6 -0.02801358234295037 1104 7 -0.14558573853989998 1104 8 -0.002652801358230761 1104 9 0.0044567062818359204 1104 10-11 -0.05501910016977263 1104 12-13 -0.05602716468590785 1104 14-15 -0.07947792869269676 1104 16-17 -0.05374575551783067 1104 18-19 -0.0740662139219026 1104 20-21 -0.10165534804753662 1104 22-23 0.015863752122243113 1104 24-25 0.11200127334465293 1104 26-27 -0.001963073005093463 1104 28-29 -0.031727504244486227 1104 30-31 0.07507427843803072 1104 32-33 -0.2884656196943993 1104 34-35 -0.23158955857385166 1104 36-37 -0.046795415959252296 1104 38-39 -0.2892084040746994 1104 40-41 -0.14298599320882488 1104 42-43 0.00753395585739014 1104 44-45 -0.1776846349745398 1104 46-47 0.07576400679117512 1104 48-49 0.18410441426145496 1104 50-51 -0.14526740237690916 1104 52-53 0.04467317487267053 1104 54-55 -0.02551994906621502 1104 56-57 0.10743845500848437 1104 58-59 0.2135505093378569 1104 60-61 0.1460632427843791 1104 62-63 -0.05374575551783067 1104 64-65 0.26496179966044053 1104 66-67 0.21068548387096797 1104 68-69 0.058573853989813074 1104 70-71 0.12176358234295037 1104 72-73 0.23625848896434576 1104 74-75 0.1301994906621431 1104 76-77 0.18951612903225623 1104 78-79 0.30517826825126804 1104 80-81 0.21795415959253006 1104 82-83 0.07380093378608166 1104 84-85 0.1215513582342922 1104 86-87 0.3624257215619693 1104 88-89 0.4360674872665484 1104 90-91 0.5049872665534778 1104 92-93 0.4066213921901536 1104 94-95 0.38460314091680914 1104 96-97 -0.05767190152801405 1104 98-99 0.410282258064516 1104 100 0.43283106960950946 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 12.0 28 38.0 29 44.0 30 58.0 31 93.0 32 114.0 33 181.0 34 251.0 35 428.0 36 746.0 37 969.0 38 920.0 39 141.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.64635063957863 10.208176573865062 12.064208678204164 48.081264108352144 2 27.125 17.45 31.374999999999996 24.05 3 27.675 22.0 22.225 28.1 4 30.2 28.050000000000004 16.375 25.374999999999996 5 30.349999999999998 28.95 17.375 23.325000000000003 6 22.625 32.824999999999996 19.375 25.174999999999997 7 20.785392696348172 14.432216108054027 36.86843421710855 27.913956978489246 8 23.617713284963724 18.188641481110835 24.0180135101326 34.17563172379284 9 22.900000000000002 18.525 28.050000000000004 30.525000000000002 10-11 26.865858232279034 26.740842605325664 19.202400300037507 27.19089886235779 12-13 25.587500000000002 21.1875 25.2875 27.9375 14-15 25.5375 23.25 23.2625 27.950000000000003 16-17 26.437500000000004 22.4375 23.05 28.075 18-19 26.474999999999998 24.0 22.05 27.474999999999998 20-21 26.150000000000002 24.087500000000002 22.275 27.487499999999997 22-23 26.075 22.9375 22.975 28.012500000000003 24-25 26.525 23.7625 22.0875 27.625 26-27 27.3125 23.3 22.6875 26.700000000000003 28-29 27.0 21.9 22.4875 28.6125 30-31 26.337500000000002 23.5375 22.2625 27.8625 32-33 26.0375 23.3125 22.912499999999998 27.737499999999997 34-35 26.700000000000003 23.275000000000002 22.625 27.400000000000002 36-37 26.55 23.3625 22.675 27.4125 38-39 26.687499999999996 23.95 22.15 27.212500000000002 40-41 27.075 22.55 22.7625 27.6125 42-43 26.9625 22.675 23.325000000000003 27.037499999999998 44-45 27.187499999999996 22.575 23.4625 26.775 46-47 27.212500000000002 23.6875 22.075 27.025 48-49 26.2625 22.3875 22.25 29.099999999999998 50-51 26.724999999999998 23.4375 22.7 27.1375 52-53 27.35 22.35 22.025 28.275 54-55 26.2625 23.275000000000002 23.0875 27.375 56-57 26.6125 22.5 23.0 27.8875 58-59 27.0 22.5 22.6875 27.8125 60-61 26.05 22.675 22.537499999999998 28.7375 62-63 28.025 22.9875 22.912499999999998 26.075 64-65 26.737499999999997 22.925 22.45 27.8875 66-67 26.450000000000003 22.650000000000002 23.0 27.900000000000002 68-69 27.3 22.6125 22.787499999999998 27.3 70-71 26.487500000000004 23.325000000000003 22.6875 27.500000000000004 72-73 27.287499999999998 22.662499999999998 23.425 26.625 74-75 26.8125 22.725 22.6125 27.85 76-77 26.6625 22.425 22.8375 28.075 78-79 27.3375 23.0625 22.45 27.150000000000002 80-81 27.6375 22.5625 23.0 26.8 82-83 26.85 22.400000000000002 23.2375 27.5125 84-85 26.75 23.525 22.8375 26.887499999999996 86-87 26.737499999999997 22.675 23.125 27.462500000000002 88-89 27.425 22.3125 23.1 27.1625 90-91 27.85 22.8875 23.1 26.1625 92-93 26.415801975246904 23.665458182272783 23.40292536567071 26.515814476809602 94-95 28.050000000000004 22.575 21.4 27.975 96-97 26.7625 23.1375 22.537499999999998 27.5625 98-99 27.6625 23.075000000000003 22.4375 26.825 100 28.775000000000002 22.2 21.95 27.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.5 29 4.0 30 4.5 31 4.5 32 9.5 33 11.0 34 13.5 35 19.5 36 26.0 37 38.5 38 46.0 39 52.5 40 81.0 41 108.5 42 113.0 43 125.0 44 131.5 45 138.5 46 140.0 47 128.0 48 126.5 49 131.0 50 136.5 51 127.0 52 111.0 53 94.0 54 86.0 55 94.0 56 93.5 57 85.0 58 99.5 59 125.0 60 132.0 61 134.0 62 123.0 63 105.5 64 108.5 65 110.5 66 99.5 67 98.0 68 91.5 69 82.5 70 80.5 71 63.5 72 45.0 73 47.0 74 48.0 75 39.5 76 26.0 77 16.0 78 16.5 79 10.5 80 5.0 81 3.0 82 2.0 83 1.5 84 0.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.075 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06542056074767 98.05 2 0.8335438241980297 1.6500000000000001 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563462 spots for SRR8618223.sra Written 563462 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra Read 563448 spots for SRR8618223.sra Written 563448 spots for SRR8618223.sra SRR ids: ['SRR8618223.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bcz6esop SRR8618223.sra spots: 11268974 blocks: [[1, 563448], [563449, 1126896], [1126897, 1690344], [1690345, 2253792], [2253793, 2817240], [2817241, 3380688], [3380689, 3944136], [3944137, 4507584], [4507585, 5071032], [5071033, 5634480], [5634481, 6197928], [6197929, 6761376], [6761377, 7324824], [7324825, 7888272], [7888273, 8451720], [8451721, 9015168], [9015169, 9578616], [9578617, 10142064], [10142065, 10705512], [10705513, 11268974]] SRR8618223 file size 2932844 SRR8618223 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618223 SRR8618223_1.fastq SRR8618223_2.fastq Input file: SRR8618223_1.fastq Paired file: SRR8618223_2.fastq trimmed: SRR8618223-trimmed-pair1.fastq, SRR8618223-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:32:31 2024 >> started Sat Dec 7 07:32:41 2024 >> done (10.559s) 11268974 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11268974 (100.00%) read pairs available; of these: 1421974 (12.62%) trimmed read pairs available after processing 9847000 (87.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 73 1 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 10 0.00% 82 36 0.00% 83 89 0.00% 84 5047 0.04% 85 5628 0.05% 86 6173 0.05% 87 6941 0.06% 88 8583 0.08% 89 10797 0.10% 90 17588 0.16% 91 32745 0.29% 92 45779 0.41% 93 63418 0.56% 94 85434 0.76% 95 109786 0.97% 96 144782 1.28% 97 199840 1.77% 98 289916 2.57% 99 389381 3.46% 100 9847000 87.38% 11268974 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=23 prefix-density=0.46 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.24 sequence-density-rank=13 fanout-score=8.41 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=3.4 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=26 prefix-density=0.46 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=31 fanout-score=7.79 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=4.6 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618223 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:33:09 Started mapping on | Dec 07 07:33:09 Finished on | Dec 07 07:33:36 Mapping speed, Million of reads per hour | 1502.53 Number of input reads | 11268974 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11049347 Uniquely mapped reads % | 98.05% Average mapped length | 198.38 Number of splices: Total | 6518834 Number of splices: Annotated (sjdb) | 6219740 Number of splices: GT/AG | 6431283 Number of splices: GC/AG | 73179 Number of splices: AT/AC | 1781 Number of splices: Non-canonical | 12591 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 91444 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 6739 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.79% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 128183 128183 128183 N_multimapping 91444 91444 91444 N_noFeature 206088 5501445 5553134 N_ambiguous 242943 20792 22792 UnstrandedReadsAssigned:10600316 PositiveStrandReadsAssigned:5527110 NegativeStrandReadsAssigned:5473421 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618223 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618223-trimmed-pair1.fastq SRR8618223-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,268,974 reads, 10,793,132 reads pseudoaligned [quant] estimated average fragment length: 163.809 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR8618223.ke.tsv 35125 SRR8618223.se.tsv 88098 total ==> SRR8618223.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.253 0 0 PNS24247 1044 881.191 14.7397 2.07267 PNS24249 1928 1765.19 53.3178 3.74276 PNS24246 1044 881.191 14.7397 2.07267 PNS24248 1044 881.191 14.7397 2.07267 PNS24244 1471 1308.19 14.463 1.36993 PNS24243 293 136.543 1 0.907489 KQK14069 1603 1440.19 2509.4 215.905 KQK14071 474 312.194 163.763 64.9987 ==> SRR8618223.se.tsv <== BRADI_1g14170v3 2795 BRADI_1g53295v3 90 BRADI_1g59795v3 172 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 178 BRADI_1g74790v3 26 BRADI_1g09890v3 0 BRADI_1g77505v3 81 BRADI_1g48960v3 0 SRR8618223 completed mapping pipeline successfully