Starting /dee2/code/volunteer_pipeline.sh SRR8618224 current disk space = 1544367415296 free memory = 1597974120 SRR8618224 SRAfilesize bedaa4d1724a00a8dd27285bc0921114 SRR8618224.sra SRR8618224.sra file validated SRR8618224 is paired end SRR8618224 is conventional basespace SRR8618224 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618224_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9495 34.0 33.0 34.0 31.0 34.0 2 33.25 34.0 34.0 34.0 31.0 34.0 3 33.3835 34.0 34.0 34.0 31.0 34.0 4 36.71125 37.0 37.0 37.0 35.0 37.0 5 36.66325 37.0 37.0 37.0 35.0 37.0 6 36.6715 37.0 37.0 37.0 35.0 37.0 7 36.64325 37.0 37.0 37.0 35.0 37.0 8 36.62925 37.0 37.0 37.0 35.0 37.0 9 38.5445 39.0 39.0 39.0 37.0 39.0 10-11 38.52975 39.0 39.0 39.0 37.0 39.0 12-13 38.503875 39.0 39.0 39.0 37.0 39.0 14-15 40.149 41.0 40.0 41.0 38.0 41.0 16-17 40.052875 41.0 40.0 41.0 38.0 41.0 18-19 40.101124999999996 41.0 40.0 41.0 38.0 41.0 20-21 40.067125000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.98075 41.0 40.0 41.0 38.0 41.0 24-25 39.963499999999996 41.0 40.0 41.0 38.0 41.0 26-27 39.890375000000006 41.0 40.0 41.0 38.0 41.0 28-29 39.873875 41.0 40.0 41.0 37.5 41.0 30-31 39.876875 41.0 40.0 41.0 38.0 41.0 32-33 39.828875 41.0 40.0 41.0 37.5 41.0 34-35 39.78375 41.0 40.0 41.0 37.0 41.0 36-37 39.650625 41.0 39.0 41.0 37.0 41.0 38-39 39.481125 41.0 39.0 41.0 36.0 41.0 40-41 39.37525 40.5 39.0 41.0 35.5 41.0 42-43 39.191 40.0 38.0 41.0 35.0 41.0 44-45 39.07125 40.0 38.0 41.0 35.0 41.0 46-47 38.810249999999996 40.0 38.0 41.0 35.0 41.0 48-49 38.651250000000005 40.0 37.0 41.0 35.0 41.0 50-51 38.3615 40.0 36.5 41.0 34.5 41.0 52-53 38.067499999999995 39.0 35.5 41.0 34.0 41.0 54-55 37.835499999999996 39.0 35.0 41.0 34.0 41.0 56-57 37.425375 38.5 35.0 40.5 33.0 41.0 58-59 37.067875 38.0 35.0 40.0 33.0 41.0 60-61 36.700874999999996 37.0 35.0 40.0 32.5 41.0 62-63 36.379875 36.5 35.0 39.5 32.5 41.0 64-65 35.9965 36.0 34.0 39.0 31.5 41.0 66-67 35.621875 35.5 34.0 39.0 31.0 40.0 68-69 35.13525 35.0 34.0 38.0 30.5 40.0 70-71 34.577 35.0 33.5 37.0 30.0 39.5 72-73 33.99875 35.0 33.0 36.5 29.0 39.0 74-75 34.093999999999994 35.0 33.0 36.0 29.0 39.0 76-77 32.998625000000004 34.0 31.5 35.0 28.0 37.0 78-79 33.626875 35.0 33.0 35.0 29.0 37.0 80-81 33.312375 35.0 33.0 35.0 29.0 37.0 82-83 32.778999999999996 34.5 32.5 35.0 28.0 36.0 84-85 32.070625 34.0 32.0 35.0 26.0 36.0 86-87 31.432875000000003 34.0 31.0 35.0 24.5 35.5 88-89 30.631 34.0 30.5 35.0 21.5 35.0 90-91 29.864875 34.0 29.5 35.0 18.5 35.0 92-93 29.086624999999998 33.5 29.0 35.0 11.0 35.0 94-95 28.174125 33.0 28.0 35.0 2.0 35.0 96-97 27.15925 33.0 26.0 35.0 2.0 35.0 98-99 26.03375 32.0 24.0 34.0 2.0 35.0 100 25.25225 32.0 20.0 34.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.2898511744665626 1101 2 -0.148838341146039 1101 3 0.01656036271420902 1101 4 0.0280488742027174 1101 5 0.04320038935423298 1101 6 0.051141166525781045 1101 7 0.05719921104536496 1101 8 0.12018750480289242 1101 9 0.07652603806450031 1101 10-11 0.06249519711058582 1101 12-13 0.06970593509054623 1101 14-15 0.16518097287328004 1101 16-17 0.09944542636850429 1101 18-19 0.05564307487384923 1101 20-21 0.14774968621122042 1101 22-23 0.23133917364686596 1101 24-25 0.15821358129050367 1101 26-27 0.24937242244934055 1101 28-29 0.20108737416430245 1101 30-31 0.21069315300084668 1101 32-33 0.07932452163221626 1101 34-35 0.1893234970158062 1101 36-37 0.2666308050923405 1101 38-39 0.3253157099310968 1101 40-41 0.341459822229055 1101 42-43 0.49343605112835576 1101 44-45 0.4503829503829522 1101 46-47 0.5290862983170683 1101 48-49 0.43993826686133986 1101 50-51 0.5944760367837318 1101 52-53 0.4674300058915435 1101 54-55 0.39247931555624405 1101 56-57 0.47120827890058337 1101 58-59 0.22373139680831855 1101 60-61 0.26933963472424693 1101 62-63 0.19702733164271535 1101 64-65 0.08723968339353405 1101 66-67 0.23859473859474178 1101 68-69 0.16504008811701 1101 70-71 0.0911460334537253 1101 72-73 0.048489971566894496 1101 74-75 -0.11283588206664774 1101 76-77 0.05344014959399601 1101 78-79 -0.08312200619893417 1101 80-81 -0.14012910166756143 1101 82-83 -0.14350393196546918 1101 84-85 -0.29337329337329976 1101 86-87 -0.7611362995978368 1101 88-89 -0.7870847101616327 1101 90-91 -0.8792489561720309 1101 92-93 -0.851910909603216 1101 94-95 -1.058102154255998 1101 96-97 -1.0926637465098992 1101 98-99 -2.007671815364123 1101 100 -2.137670022285409 1106 1 0.2898511744665555 1106 2 0.1488383411460319 1106 3 -0.01656036271420902 1106 4 -0.0280488742027174 1106 5 -0.04320038935423298 1106 6 -0.051141166525781045 1106 7 -0.05719921104536496 1106 8 -0.12018750480288531 1106 9 -0.07652603806450031 1106 10-11 -0.062495197110578715 1106 12-13 -0.06970593509055334 1106 14-15 -0.16518097287328004 1106 16-17 -0.09944542636850429 1106 18-19 -0.055643074873842124 1106 20-21 -0.14774968621122753 1106 22-23 -0.23133917364686596 1106 24-25 -0.15821358129050367 1106 26-27 -0.24937242244934765 1106 28-29 -0.20108737416429534 1106 30-31 -0.21069315300083957 1106 32-33 -0.07932452163221626 1106 34-35 -0.1893234970158062 1106 36-37 -0.2666308050923476 1106 38-39 -0.3253157099310897 1106 40-41 -0.3414598222290479 1106 42-43 -0.49343605112836286 1106 44-45 -0.4503829503829522 1106 46-47 -0.5290862983170683 1106 48-49 -0.43993826686133986 1106 50-51 -0.5944760367837318 1106 52-53 -0.4674300058915435 1106 54-55 -0.39247931555623694 1106 56-57 -0.47120827890058337 1106 58-59 -0.22373139680831855 1106 60-61 -0.26933963472425404 1106 62-63 -0.19702733164271535 1106 64-65 -0.08723968339353405 1106 66-67 -0.23859473859473468 1106 68-69 -0.16504008811701 1106 70-71 -0.0911460334537253 1106 72-73 -0.048489971566894496 1106 74-75 0.11283588206664774 1106 76-77 -0.05344014959399601 1106 78-79 0.08312200619892707 1106 80-81 0.14012910166756853 1106 82-83 0.14350393196546918 1106 84-85 0.29337329337329265 1106 86-87 0.7611362995978368 1106 88-89 0.7870847101616327 1106 90-91 0.8792489561720345 1106 92-93 0.851910909603216 1106 94-95 1.0581021542560016 1106 96-97 1.0926637465098992 1106 98-99 2.007671815364123 1106 100 2.1376700222854055 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 5.0 28 24.0 29 51.0 30 88.0 31 157.0 32 196.0 33 207.0 34 309.0 35 481.0 36 711.0 37 928.0 38 754.0 39 88.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.421741318570707 11.701056869652742 15.702063412179164 46.17513839959738 2 24.95 19.325 33.6 22.125 3 26.025 22.400000000000002 23.925 27.650000000000002 4 27.474999999999998 28.199999999999996 16.925 27.400000000000002 5 30.7 30.225 18.375 20.7 6 21.8 34.675 19.825 23.7 7 20.674999999999997 14.549999999999999 40.725 24.05 8 22.175 19.75 26.05 32.025 9 22.3 19.0 28.775000000000002 29.925 10-11 26.0375 27.8625 20.0 26.1 12-13 24.925 22.8625 25.174999999999997 27.037499999999998 14-15 25.0125 24.75 24.8 25.4375 16-17 25.137500000000003 23.925 24.224999999999998 26.7125 18-19 25.137500000000003 24.775 24.0125 26.075 20-21 25.25 24.712500000000002 24.375 25.662499999999998 22-23 25.124999999999996 25.162499999999998 24.5125 25.2 24-25 25.162499999999998 25.387500000000003 23.674999999999997 25.775 26-27 25.275 24.462500000000002 25.2 25.0625 28-29 24.9125 24.7875 24.337500000000002 25.9625 30-31 23.674999999999997 25.0125 25.525 25.7875 32-33 24.8125 24.95 24.3625 25.874999999999996 34-35 24.887500000000003 24.25 23.9125 26.950000000000003 36-37 24.5625 25.05 24.2875 26.1 38-39 24.575 24.925 25.2125 25.2875 40-41 25.8125 24.7875 23.8125 25.587500000000002 42-43 23.7875 24.462500000000002 25.224999999999998 26.525 44-45 25.525 24.3625 24.4125 25.7 46-47 25.087500000000002 25.0375 24.375 25.5 48-49 24.7875 24.2875 25.424999999999997 25.5 50-51 25.0625 25.25 24.7 24.9875 52-53 26.3625 25.074999999999996 23.225 25.337500000000002 54-55 24.125 24.9125 24.5375 26.424999999999997 56-57 25.2875 25.912499999999998 24.224999999999998 24.575 58-59 25.974999999999998 24.15 24.275 25.6 60-61 24.637500000000003 25.624999999999996 24.6125 25.124999999999996 62-63 25.2625 25.124999999999996 24.8125 24.8 64-65 24.887500000000003 24.9125 24.462500000000002 25.7375 66-67 23.8375 25.674999999999997 25.087500000000002 25.4 68-69 24.95 25.0625 24.975 25.0125 70-71 25.0 24.6875 25.137500000000003 25.174999999999997 72-73 24.975 25.0375 25.087500000000002 24.9 74-75 25.074999999999996 26.0 25.112499999999997 23.8125 76-77 25.05 23.974999999999998 25.1875 25.7875 78-79 25.087500000000002 25.7625 24.025 25.124999999999996 80-81 25.1 25.0375 24.462500000000002 25.4 82-83 26.424999999999997 23.3625 24.0625 26.150000000000002 84-85 25.2875 24.6875 24.9 25.124999999999996 86-87 25.2125 24.8125 24.7375 25.2375 88-89 25.837500000000002 23.7375 24.5625 25.8625 90-91 25.8 24.575 24.575 25.05 92-93 25.087500000000002 24.75 25.0125 25.15 94-95 25.474999999999998 24.1125 24.7375 25.674999999999997 96-97 25.7375 23.525 24.6 26.137500000000003 98-99 25.6 25.0 23.425 25.974999999999998 100 26.924999999999997 24.099999999999998 23.125 25.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.0 29 4.0 30 3.5 31 4.0 32 9.0 33 15.0 34 19.5 35 28.0 36 41.0 37 54.0 38 72.5 39 92.5 40 111.0 41 123.5 42 147.5 43 164.0 44 163.5 45 167.0 46 173.5 47 185.5 48 179.0 49 158.0 50 147.5 51 145.5 52 138.0 53 122.5 54 111.5 55 103.5 56 98.5 57 107.0 58 113.0 59 107.0 60 112.0 61 110.5 62 94.5 63 75.0 64 69.0 65 67.0 66 60.5 67 57.0 68 46.0 69 41.5 70 36.0 71 28.0 72 23.0 73 16.5 74 12.5 75 10.0 76 8.5 77 7.0 78 4.0 79 2.5 80 1.0 81 1.0 82 1.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06542056074767 98.05 2 0.8335438241980297 1.6500000000000001 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618224 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618224_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6985 34.0 31.0 34.0 31.0 34.0 2 33.13325 34.0 33.0 34.0 31.0 34.0 3 33.259 34.0 33.0 34.0 31.0 34.0 4 36.6645 37.0 37.0 37.0 35.0 37.0 5 36.63425 37.0 37.0 37.0 35.0 37.0 6 36.647 37.0 37.0 37.0 35.0 37.0 7 36.626 37.0 37.0 37.0 35.0 37.0 8 36.5675 37.0 37.0 37.0 35.0 37.0 9 38.4365 39.0 39.0 39.0 37.0 39.0 10-11 38.448875 39.0 39.0 39.0 37.0 39.0 12-13 38.36225 39.0 39.0 39.0 37.0 39.0 14-15 39.860375 41.0 40.0 41.0 38.0 41.0 16-17 39.718375 41.0 39.5 41.0 37.5 41.0 18-19 39.508125 41.0 39.0 41.0 37.0 41.0 20-21 39.441500000000005 40.0 39.0 41.0 36.5 41.0 22-23 39.26625 40.0 39.0 41.0 36.0 41.0 24-25 39.085625 40.0 38.0 41.0 36.0 41.0 26-27 38.889875 40.0 38.0 41.0 35.0 41.0 28-29 38.5225 40.0 38.0 41.0 34.0 41.0 30-31 38.155375 40.0 38.0 41.0 33.5 41.0 32-33 38.64375 40.0 38.0 41.0 35.0 41.0 34-35 38.710875 40.0 38.0 41.0 34.5 41.0 36-37 38.573125 40.0 38.0 41.0 34.0 41.0 38-39 38.6275 40.0 38.0 41.0 34.5 41.0 40-41 38.535250000000005 40.0 38.0 41.0 34.0 41.0 42-43 38.245125 40.0 37.5 41.0 33.5 41.0 44-45 37.905874999999995 40.0 37.0 41.0 33.0 41.0 46-47 37.32 39.0 36.0 41.0 32.0 41.0 48-49 36.91525 39.0 35.0 40.0 31.0 41.0 50-51 36.12625 38.0 34.0 39.5 30.0 40.5 52-53 36.23625 38.0 34.5 39.5 30.5 40.0 54-55 36.97775 38.0 35.0 40.0 31.5 41.0 56-57 36.93475 38.0 35.0 40.0 32.0 41.0 58-59 36.738 38.0 35.0 40.0 31.5 41.0 60-61 36.397 37.5 34.5 40.0 31.0 41.0 62-63 35.974875 36.5 34.0 40.0 30.5 41.0 64-65 35.61024999999999 36.0 34.0 39.0 30.0 41.0 66-67 35.331875 35.5 34.0 39.0 30.0 41.0 68-69 34.970749999999995 35.0 33.5 38.5 29.0 40.0 70-71 34.541625 35.0 33.0 37.5 29.0 40.0 72-73 34.109875 35.0 33.0 37.0 28.5 39.0 74-75 33.664625 35.0 32.5 36.5 27.5 39.0 76-77 33.36025 35.0 32.5 36.0 27.0 38.5 78-79 33.064625 35.0 32.0 35.5 27.0 37.0 80-81 32.651624999999996 34.5 31.5 35.0 26.0 37.0 82-83 32.277375000000006 34.0 31.0 35.0 25.0 36.0 84-85 32.173500000000004 34.0 31.0 35.0 25.5 36.0 86-87 31.73775 34.0 31.0 35.0 25.0 35.5 88-89 31.36025 34.0 30.5 35.0 24.0 35.0 90-91 30.94475 34.0 30.0 35.0 23.5 35.0 92-93 30.461875 34.0 29.5 35.0 21.5 35.0 94-95 29.933500000000002 34.0 29.5 35.0 19.5 35.0 96-97 29.289375 33.5 29.0 35.0 15.5 35.0 98-99 28.602625 33.0 29.0 35.0 4.5 35.0 100 28.062 33.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.2965111811265615 1101 2 0.024180947257868013 1101 3 0.13422474960936626 1101 4 0.11361715207868883 1101 5 0.07292707292707235 1101 6 -0.045339276108506965 1101 7 -0.004572350726192553 1101 8 0.11859934936857996 1101 9 0.15639488716411876 1101 10-11 0.04775993237531395 1101 12-13 0.01531801531801591 1101 14-15 0.08025948410563899 1101 16-17 -0.16738389815312615 1101 18-19 -0.2500576346730199 1101 20-21 -0.1370232331770822 1101 22-23 -0.04950818412356739 1101 24-25 -0.1901239785855111 1101 26-27 -0.19605394605394366 1101 28-29 -0.2795665872588913 1101 30-31 -0.1694139194139197 1101 32-33 0.07610338379569015 1101 34-35 0.014165321857632307 1101 36-37 -0.18861266938190369 1101 38-39 -0.10902558979482535 1101 40-41 -0.07128768667230645 1101 42-43 -0.08205896667435297 1101 44-45 0.01623376623376771 1101 46-47 -0.2644278798124944 1101 48-49 -0.17031045877200057 1101 50-51 0.01459437997899471 1101 52-53 -0.25356694587463835 1101 54-55 -0.1674479366787054 1101 56-57 -0.10833397371859377 1101 58-59 -0.13353953738569402 1101 60-61 -0.21835856451241398 1101 62-63 0.04211813827198796 1101 64-65 -0.07611619150080173 1101 66-67 -0.1726350572504458 1101 68-69 -0.1338917492763656 1101 70-71 -0.46801275647429463 1101 72-73 -0.17242373011603718 1101 74-75 -0.1598593713978289 1101 76-77 -0.558159788929018 1101 78-79 -0.3550744127667187 1101 80-81 -0.4599439022515881 1101 82-83 -0.5468441814595657 1101 84-85 -0.4406426906426901 1101 86-87 -0.5358423627654396 1101 88-89 -0.49727195881042263 1101 90-91 -0.7521773098696158 1101 92-93 -0.5749186710725169 1101 94-95 -0.7973244704013958 1101 96-97 -0.9230256922564593 1101 98-99 -1.1578485616947134 1101 100 -0.796178180793568 1106 1 0.2965111811265686 1106 2 -0.02418094725787512 1106 3 -0.13422474960936626 1106 4 -0.11361715207869594 1106 5 -0.07292707292707235 1106 6 0.045339276108506965 1106 7 0.004572350726199659 1106 8 -0.11859934936857996 1106 9 -0.15639488716411876 1106 10-11 -0.04775993237531395 1106 12-13 -0.01531801531801591 1106 14-15 -0.08025948410563899 1106 16-17 0.16738389815312615 1106 18-19 0.2500576346730199 1106 20-21 0.1370232331770751 1106 22-23 0.04950818412356739 1106 24-25 0.19012397858551822 1106 26-27 0.19605394605394366 1106 28-29 0.2795665872588984 1106 30-31 0.1694139194139197 1106 32-33 -0.07610338379569015 1106 34-35 -0.014165321857625202 1106 36-37 0.18861266938189658 1106 38-39 0.10902558979482535 1106 40-41 0.07128768667229934 1106 42-43 0.08205896667435297 1106 44-45 -0.01623376623376771 1106 46-47 0.2644278798124944 1106 48-49 0.17031045877199347 1106 50-51 -0.01459437997899471 1106 52-53 0.25356694587464546 1106 54-55 0.1674479366787125 1106 56-57 0.10833397371858666 1106 58-59 0.1335395373856869 1106 60-61 0.21835856451241398 1106 62-63 -0.04211813827198796 1106 64-65 0.07611619150080884 1106 66-67 0.1726350572504458 1106 68-69 0.1338917492763656 1106 70-71 0.46801275647429463 1106 72-73 0.17242373011604428 1106 74-75 0.15985937139783601 1106 76-77 0.5581597889290251 1106 78-79 0.3550744127667187 1106 80-81 0.4599439022515952 1106 82-83 0.5468441814595693 1106 84-85 0.4406426906426901 1106 86-87 0.5358423627654396 1106 88-89 0.4972719588104191 1106 90-91 0.7521773098696194 1106 92-93 0.5749186710725205 1106 94-95 0.7973244704013922 1106 96-97 0.9230256922564628 1106 98-99 1.157848561694717 1106 100 0.7961781807935644 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 18.0 28 56.0 29 94.0 30 121.0 31 161.0 32 217.0 33 249.0 34 343.0 35 463.0 36 599.0 37 879.0 38 721.0 39 76.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.474999999999998 10.25 15.75 47.525 2 25.1 18.7 32.5 23.7 3 26.674999999999997 22.900000000000002 23.875 26.55 4 27.650000000000002 28.95 17.299999999999997 26.1 5 29.349999999999998 31.4 20.875 18.375 6 21.675 33.975 20.65 23.7 7 19.05 15.0 41.25 24.7 8 21.475 21.675 25.5 31.35 9 21.85 20.175 29.475 28.499999999999996 10-11 25.9625 28.512500000000003 20.6125 24.9125 12-13 23.8875 22.9875 26.8125 26.3125 14-15 23.45 24.9 26.2125 25.4375 16-17 24.6625 24.2875 24.5625 26.487500000000004 18-19 25.1875 25.162499999999998 24.0375 25.6125 20-21 24.762500000000003 25.3125 24.837500000000002 25.087500000000002 22-23 24.9125 25.6 24.3125 25.174999999999997 24-25 24.975 25.2125 24.3 25.5125 26-27 24.7875 26.0375 23.9875 25.1875 28-29 26.0625 24.4375 24.4375 25.0625 30-31 23.962500000000002 25.924999999999997 23.974999999999998 26.137500000000003 32-33 24.8625 25.7 24.8125 24.625 34-35 26.4125 24.474999999999998 23.8875 25.224999999999998 36-37 24.65 25.525 25.362499999999997 24.462500000000002 38-39 24.8 26.2125 23.6875 25.3 40-41 25.825 24.762500000000003 24.55 24.8625 42-43 23.724999999999998 25.35 24.9125 26.0125 44-45 24.5625 25.474999999999998 24.525 25.4375 46-47 25.64295571446494 25.10350018818216 23.823861497929997 25.42968259942291 48-49 24.328058276814872 25.131876412961567 25.257472996734485 25.282592313489072 50-51 25.9625 24.725 25.1 24.212500000000002 52-53 25.0375 25.15 24.6625 25.15 54-55 24.6875 25.275 24.2625 25.775 56-57 25.25 25.174999999999997 24.55 25.025 58-59 24.6875 25.3125 24.15 25.85 60-61 25.0 24.1625 24.4125 26.424999999999997 62-63 25.15 25.662499999999998 24.9875 24.2 64-65 25.362499999999997 24.95 24.462500000000002 25.224999999999998 66-67 24.349999999999998 24.9 24.887500000000003 25.8625 68-69 25.4375 24.9375 24.762500000000003 24.8625 70-71 25.75 24.1125 24.525 25.6125 72-73 24.4375 24.3875 24.9375 26.237500000000004 74-75 24.6625 25.924999999999997 25.087500000000002 24.325 76-77 25.2 24.837500000000002 24.0125 25.95 78-79 24.9 25.674999999999997 23.8375 25.587500000000002 80-81 24.8625 25.025 25.087500000000002 25.025 82-83 25.3125 25.112499999999997 24.4 25.174999999999997 84-85 25.45 24.125 24.925 25.5 86-87 25.624999999999996 24.8125 24.3125 25.25 88-89 24.9875 24.349999999999998 24.925 25.7375 90-91 24.7375 25.05 24.5125 25.7 92-93 25.387500000000003 23.974999999999998 25.0625 25.575 94-95 26.7625 24.9875 23.425 24.825 96-97 25.650000000000002 23.95 24.45 25.95 98-99 26.637499999999996 25.4 23.8875 24.075 100 25.974999999999998 23.0 25.874999999999996 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.5 29 3.5 30 6.0 31 9.5 32 11.5 33 16.5 34 20.0 35 25.5 36 33.5 37 49.5 38 75.0 39 94.0 40 103.5 41 131.5 42 162.5 43 166.5 44 172.5 45 186.5 46 193.5 47 180.0 48 165.5 49 156.5 50 146.0 51 144.0 52 151.5 53 134.5 54 107.5 55 98.5 56 93.0 57 95.0 58 106.0 59 112.5 60 117.0 61 107.0 62 80.0 63 67.0 64 65.0 65 62.5 66 57.5 67 58.0 68 55.0 69 39.5 70 32.0 71 29.5 72 19.0 73 14.0 74 12.0 75 9.5 76 6.0 77 4.0 78 3.0 79 2.0 80 1.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.36250000000000004 48-49 0.475 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98989898989899 98.0 2 1.0101010101010102 2.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574432 spots for SRR8618224.sra Written 574432 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra Read 574413 spots for SRR8618224.sra Written 574413 spots for SRR8618224.sra SRR ids: ['SRR8618224.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3g2a8v7w SRR8618224.sra spots: 11488279 blocks: [[1, 574413], [574414, 1148826], [1148827, 1723239], [1723240, 2297652], [2297653, 2872065], [2872066, 3446478], [3446479, 4020891], [4020892, 4595304], [4595305, 5169717], [5169718, 5744130], [5744131, 6318543], [6318544, 6892956], [6892957, 7467369], [7467370, 8041782], [8041783, 8616195], [8616196, 9190608], [9190609, 9765021], [9765022, 10339434], [10339435, 10913847], [10913848, 11488279]] SRR8618224 file size 2990251 SRR8618224 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618224 SRR8618224_1.fastq SRR8618224_2.fastq Input file: SRR8618224_1.fastq Paired file: SRR8618224_2.fastq trimmed: SRR8618224-trimmed-pair1.fastq, SRR8618224-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:41:05 2024 >> started Sat Dec 7 07:41:17 2024 >> done (12.000s) 11488279 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11488279 (100.00%) read pairs available; of these: 3517827 (30.62%) trimmed read pairs available after processing 7970452 (69.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 71 1 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 1 0.00% 77 0 0.00% 78 1 0.00% 79 2 0.00% 80 0 0.00% 81 71 0.00% 82 301 0.00% 83 852 0.01% 84 7215 0.06% 85 8845 0.08% 86 11536 0.10% 87 15227 0.13% 88 20850 0.18% 89 29764 0.26% 90 56335 0.49% 91 101617 0.88% 92 135795 1.18% 93 175367 1.53% 94 218014 1.90% 95 266500 2.32% 96 325572 2.83% 97 427846 3.72% 98 607543 5.29% 99 1108572 9.65% 100 7970452 69.38% 11488279 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=19 prefix-density=0.51 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=23 fanout-score=7.96 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=4.5 sequence=CAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCCAAGCCTTGTTCATGCTCAGAGCATCCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=22 prefix-density=0.54 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=37 fanout-score=7.70 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=2.6 sequence=ACGACCTGGCAGGCCCAAATAGCAAGGATGCTCTGAGCATGAACAAGGCTTGGGTTGCCAAGGTAGTCGAGGCCGCCCTCGCTGAAGATCTGGGAGCCGGCCTTGAACCAGACGGCCTCGCCGAACTTGACGCCGTTGCGGGCGAGCAGCTCGGG SRR8618224 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:41:43 Started mapping on | Dec 07 07:41:43 Finished on | Dec 07 07:42:26 Mapping speed, Million of reads per hour | 961.81 Number of input reads | 11488279 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 11230528 Uniquely mapped reads % | 97.76% Average mapped length | 197.29 Number of splices: Total | 7031643 Number of splices: Annotated (sjdb) | 6719508 Number of splices: GT/AG | 6938572 Number of splices: GC/AG | 78845 Number of splices: AT/AC | 1954 Number of splices: Non-canonical | 12272 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 103462 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 7745 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.01% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 154289 154289 154289 N_multimapping 103462 103462 103462 N_noFeature 215028 5525466 5708199 N_ambiguous 247562 17971 19474 UnstrandedReadsAssigned:10767938 PositiveStrandReadsAssigned:5687091 NegativeStrandReadsAssigned:5502855 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618224 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618224-trimmed-pair1.fastq SRR8618224-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,488,279 reads, 10,992,774 reads pseudoaligned [quant] estimated average fragment length: 161.666 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52973 SRR8618224.ke.tsv 35125 SRR8618224.se.tsv 88098 total ==> SRR8618224.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 775.398 0 0 PNS24247 1044 883.334 16.8363 2.39786 PNS24249 1928 1767.33 52.9748 3.77096 PNS24246 1044 883.334 16.8363 2.39786 PNS24248 1044 883.334 16.8363 2.39786 PNS24244 1471 1310.33 21.5163 2.0658 PNS24243 293 138.222 6 5.46102 KQK14069 1603 1442.33 2854.32 248.965 KQK14071 474 314.402 111.06 44.4401 ==> SRR8618224.se.tsv <== BRADI_1g14170v3 3212 BRADI_1g53295v3 90 BRADI_1g59795v3 170 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 262 BRADI_1g74790v3 32 BRADI_1g09890v3 1 BRADI_1g77505v3 109 BRADI_1g48960v3 0 SRR8618224 completed mapping pipeline successfully