Starting /dee2/code/volunteer_pipeline.sh SRR8618225 current disk space = 1544371064832 free memory = 1593556036 SRR8618225 SRAfilesize f5bb7e17d8e8e0eb14925edb80fdeae7 SRR8618225.sra SRR8618225.sra file validated SRR8618225 is paired end SRR8618225 is conventional basespace SRR8618225 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618225_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94275 34.0 31.0 34.0 31.0 34.0 2 33.13725 34.0 33.0 34.0 31.0 34.0 3 33.23875 34.0 34.0 34.0 31.0 34.0 4 35.44 37.0 37.0 37.0 35.0 37.0 5 35.98175 37.0 37.0 37.0 35.0 37.0 6 36.34325 37.0 37.0 37.0 35.0 37.0 7 36.1645 37.0 37.0 37.0 35.0 37.0 8 36.4345 37.0 37.0 37.0 35.0 37.0 9 38.3245 39.0 39.0 39.0 37.0 39.0 10-11 38.349625 39.0 39.0 39.0 37.0 39.0 12-13 38.36625 39.0 39.0 39.0 37.0 39.0 14-15 40.01525 41.0 40.0 41.0 38.0 41.0 16-17 39.96025 41.0 40.0 41.0 38.0 41.0 18-19 39.932500000000005 41.0 40.0 41.0 38.0 41.0 20-21 39.844625 41.0 40.0 41.0 38.0 41.0 22-23 39.7795 41.0 40.0 41.0 38.0 41.0 24-25 39.647625 41.0 39.5 41.0 37.0 41.0 26-27 39.490375 40.5 39.0 41.0 37.0 41.0 28-29 39.370625000000004 40.5 39.0 41.0 36.0 41.0 30-31 39.11024999999999 40.0 38.0 41.0 35.5 41.0 32-33 39.0745 40.0 38.0 41.0 35.5 41.0 34-35 39.217375000000004 40.5 39.0 41.0 35.0 41.0 36-37 39.265 41.0 39.0 41.0 35.0 41.0 38-39 39.10425 40.5 38.0 41.0 35.0 41.0 40-41 38.977125 40.0 38.0 41.0 35.0 41.0 42-43 38.760625000000005 40.0 37.0 41.0 35.0 41.0 44-45 38.561875 40.0 37.0 41.0 35.0 41.0 46-47 38.313625 40.0 36.0 41.0 34.0 41.0 48-49 38.085125000000005 40.0 35.0 41.0 34.0 41.0 50-51 37.798125 39.0 35.0 41.0 34.0 41.0 52-53 37.530625 39.0 35.0 41.0 33.0 41.0 54-55 37.259 38.0 35.0 41.0 33.0 41.0 56-57 36.983999999999995 37.0 35.0 40.5 33.0 41.0 58-59 36.680375 37.0 35.0 40.0 33.0 41.0 60-61 36.414125 36.0 35.0 40.0 32.5 41.0 62-63 36.095875 36.0 35.0 39.5 32.0 41.0 64-65 35.813625 35.0 35.0 39.0 32.0 41.0 66-67 35.55375 35.0 34.5 39.0 31.0 41.0 68-69 35.274375000000006 35.0 34.0 37.5 31.0 40.0 70-71 34.9685 35.0 34.0 37.0 31.0 39.5 72-73 34.619249999999994 35.0 34.0 36.5 30.5 39.0 74-75 34.336875000000006 35.0 34.0 36.0 30.0 39.0 76-77 33.543 34.5 32.5 35.0 29.0 37.0 78-79 33.915625000000006 35.0 33.5 35.0 30.0 37.0 80-81 33.87125 35.0 34.0 35.0 30.0 36.5 82-83 33.708625 35.0 33.5 35.0 30.0 36.0 84-85 33.49625 35.0 33.0 35.0 30.0 36.0 86-87 33.174625 35.0 33.0 35.0 29.0 35.5 88-89 32.963875 35.0 33.0 35.0 29.0 35.0 90-91 32.7415 35.0 33.0 35.0 28.0 35.0 92-93 32.507375 35.0 33.0 35.0 27.0 35.0 94-95 32.40025 35.0 33.0 35.0 27.0 35.0 96-97 32.202375 35.0 33.0 35.0 27.0 35.0 98-99 31.77025 34.5 32.5 35.0 27.0 35.0 100 31.271 35.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.10996279454320046 1101 2 0.1479950392724234 1101 3 0.14065729640347513 1101 4 -0.8965998346424158 1101 5 -0.4142207523770196 1101 6 -0.11347664324100748 1101 7 -0.4347871021083094 1101 8 -0.06640140553948015 1101 9 -0.0179826374534926 1101 10-11 0.12531004547333424 1101 12-13 0.10882596114096543 1101 14-15 0.18693158329888604 1101 16-17 0.26945535345183913 1101 18-19 0.13988218272012887 1101 20-21 0.23535035138486649 1101 22-23 0.2555549813972675 1101 24-25 0.29766949152542566 1101 26-27 0.281960520876396 1101 28-29 0.35122984704423743 1101 30-31 0.2565884663083935 1101 32-33 0.2567176519222869 1101 34-35 0.18855932203389614 1101 36-37 0.1520773046713515 1101 38-39 0.32862236461348004 1101 40-41 0.37572343943777753 1101 42-43 0.37192538238941353 1101 44-45 0.29374224886316824 1101 46-47 0.280823687474161 1101 48-49 0.17597664324101459 1101 50-51 0.21460314179412876 1101 52-53 0.28857482430756676 1101 54-55 0.3390863993385693 1101 56-57 0.22452459694088844 1101 58-59 0.18501963621331186 1101 60-61 0.13254443985118058 1101 62-63 -0.12719615543613116 1101 64-65 -0.09528730880529679 1101 66-67 0.06616887143447059 1101 68-69 0.11624121537825971 1101 70-71 0.02209073997519795 1101 72-73 0.22168251343529732 1101 74-75 0.05459384042993065 1101 76-77 0.069424348904505 1101 78-79 0.19370090946672036 1101 80-81 0.15238735014468574 1101 82-83 0.027852418354690656 1101 84-85 0.0635851591566734 1101 86-87 0.1610944605208786 1101 88-89 0.11696465481603724 1101 90-91 0.39132906159569814 1101 92-93 0.47891690781315077 1101 94-95 0.22612649855312128 1101 96-97 0.008371227780074264 1101 98-99 -0.12841050020669798 1101 100 -0.15161223646134658 1104 1 -0.10996279454320046 1104 2 -0.14799503927243052 1104 3 -0.14065729640346802 1104 4 0.8965998346424158 1104 5 0.4142207523770125 1104 6 0.11347664324100748 1104 7 0.4347871021083094 1104 8 0.06640140553948015 1104 9 0.0179826374534926 1104 10-11 -0.12531004547334135 1104 12-13 -0.10882596114097254 1104 14-15 -0.18693158329887893 1104 16-17 -0.26945535345183913 1104 18-19 -0.13988218272012887 1104 20-21 -0.2353503513848736 1104 22-23 -0.2555549813972675 1104 24-25 -0.29766949152542566 1104 26-27 -0.281960520876396 1104 28-29 -0.35122984704423743 1104 30-31 -0.2565884663083935 1104 32-33 -0.2567176519222798 1104 34-35 -0.18855932203389614 1104 36-37 -0.1520773046713515 1104 38-39 -0.32862236461347294 1104 40-41 -0.37572343943778463 1104 42-43 -0.37192538238942063 1104 44-45 -0.29374224886316824 1104 46-47 -0.2808236874741681 1104 48-49 -0.17597664324100748 1104 50-51 -0.21460314179412876 1104 52-53 -0.28857482430756676 1104 54-55 -0.3390863993385693 1104 56-57 -0.22452459694088844 1104 58-59 -0.18501963621331186 1104 60-61 -0.13254443985117348 1104 62-63 0.12719615543613116 1104 64-65 0.09528730880528968 1104 66-67 -0.0661688714344777 1104 68-69 -0.11624121537825971 1104 70-71 -0.022090739975190843 1104 72-73 -0.22168251343530443 1104 74-75 -0.05459384042993065 1104 76-77 -0.069424348904505 1104 78-79 -0.19370090946672036 1104 80-81 -0.15238735014469285 1104 82-83 -0.02785241835469776 1104 84-85 -0.0635851591566734 1104 86-87 -0.1610944605208715 1104 88-89 -0.11696465481603724 1104 90-91 -0.39132906159570524 1104 92-93 -0.47891690781314367 1104 94-95 -0.22612649855312128 1104 96-97 -0.008371227780074264 1104 98-99 0.12841050020669798 1104 100 0.15161223646134658 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 11.0 28 31.0 29 44.0 30 64.0 31 83.0 32 123.0 33 166.0 34 236.0 35 442.0 36 768.0 37 946.0 38 919.0 39 165.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.563204005006256 10.312891113892366 14.192740926157695 44.931163954943685 2 26.825 17.875 31.25 24.05 3 26.8 22.625 22.45 28.125 4 30.20186335403727 27.044513457556935 16.589026915113873 26.164596273291924 5 30.375000000000004 29.725 17.8 22.1 6 22.925 33.300000000000004 19.25 24.525 7 21.775 14.274999999999999 38.1 25.85 8 23.825 19.75 24.275 32.15 9 24.55 17.675 27.625 30.15 10-11 26.5375 27.375 18.8875 27.200000000000003 12-13 24.1780222527816 21.627703462932867 25.328166020752597 28.86610826353294 14-15 25.7875 22.912499999999998 23.5625 27.737499999999997 16-17 26.237500000000004 22.6875 23.4375 27.6375 18-19 26.487500000000004 22.725 23.4625 27.325 20-21 26.825 22.6875 23.3625 27.125 22-23 26.55 23.200000000000003 22.8875 27.3625 24-25 26.6 23.325000000000003 22.237499999999997 27.8375 26-27 25.6 23.3 23.3125 27.787499999999998 28-29 25.75 23.325000000000003 22.325 28.599999999999998 30-31 25.937500000000004 23.65 23.1125 27.3 32-33 25.900000000000002 23.175 23.275000000000002 27.650000000000002 34-35 26.924999999999997 23.65 22.0875 27.3375 36-37 26.875 23.0625 22.6125 27.450000000000003 38-39 26.625 24.1625 22.45 26.7625 40-41 27.275 23.2375 22.875 26.6125 42-43 26.474999999999998 22.625 23.5375 27.3625 44-45 26.787499999999998 23.575 22.8875 26.75 46-47 26.6125 23.75 21.837500000000002 27.800000000000004 48-49 26.5375 23.375 23.0125 27.075 50-51 27.4125 23.1125 22.6125 26.8625 52-53 26.900000000000002 23.0625 22.725 27.3125 54-55 26.8125 23.0 22.3 27.8875 56-57 26.6 24.2625 22.325 26.8125 58-59 27.6125 23.0875 22.650000000000002 26.650000000000002 60-61 27.237499999999997 22.6 23.05 27.1125 62-63 26.5375 23.775 22.8 26.887499999999996 64-65 27.075 23.1875 23.0 26.737499999999997 66-67 26.787499999999998 23.175 22.037499999999998 28.000000000000004 68-69 26.450000000000003 23.325000000000003 22.900000000000002 27.325 70-71 26.900000000000002 23.1375 22.55 27.4125 72-73 26.375 22.475 23.0125 28.1375 74-75 26.737499999999997 23.7 23.0875 26.474999999999998 76-77 27.762500000000003 23.1 22.675 26.4625 78-79 27.250000000000004 22.537499999999998 22.625 27.5875 80-81 27.487499999999997 23.1125 22.650000000000002 26.75 82-83 27.1 22.6875 22.650000000000002 27.5625 84-85 27.0 22.6125 23.025000000000002 27.3625 86-87 26.6625 23.0125 23.525 26.8 88-89 27.962500000000002 22.0625 23.625 26.35 90-91 27.025 23.1375 22.8625 26.974999999999998 92-93 27.61988230875172 22.937273068736697 22.486540628521347 26.956303993990232 94-95 28.291036379547442 22.840355044380548 22.477809726215778 26.390798849856235 96-97 27.3375 23.1875 21.825 27.650000000000002 98-99 27.675 22.6875 23.2625 26.375 100 28.325 22.225 22.2 27.250000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 1.0 28 1.0 29 1.5 30 3.5 31 6.0 32 5.0 33 4.5 34 10.5 35 20.0 36 28.0 37 44.5 38 58.5 39 72.5 40 86.5 41 99.0 42 121.5 43 128.5 44 124.5 45 125.0 46 129.5 47 136.0 48 131.5 49 129.0 50 141.0 51 141.5 52 120.5 53 100.5 54 98.5 55 97.5 56 89.0 57 104.5 58 114.5 59 112.5 60 116.5 61 122.0 62 112.5 63 106.5 64 112.0 65 107.5 66 111.0 67 99.0 68 80.0 69 70.0 70 63.0 71 54.5 72 47.5 73 49.0 74 39.5 75 28.0 76 24.5 77 18.5 78 14.5 79 13.0 80 9.0 81 5.0 82 4.5 83 2.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 3.4000000000000004 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.1625 94-95 0.0125 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618225 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618225_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37925 34.0 31.0 34.0 31.0 34.0 2 32.78625 34.0 31.0 34.0 31.0 34.0 3 33.07325 34.0 33.0 34.0 31.0 34.0 4 36.5095 37.0 37.0 37.0 35.0 37.0 5 36.54375 37.0 37.0 37.0 35.0 37.0 6 36.5745 37.0 37.0 37.0 35.0 37.0 7 36.45375 37.0 37.0 37.0 35.0 37.0 8 36.52425 37.0 37.0 37.0 35.0 37.0 9 38.32675 39.0 39.0 39.0 37.0 39.0 10-11 38.409499999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.377624999999995 39.0 39.0 39.0 37.0 39.0 14-15 40.013374999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.99912500000001 41.0 40.0 41.0 38.0 41.0 18-19 39.963625 41.0 40.0 41.0 38.0 41.0 20-21 39.8635 41.0 40.0 41.0 38.0 41.0 22-23 39.815375 41.0 40.0 41.0 38.0 41.0 24-25 39.694374999999994 41.0 40.0 41.0 37.0 41.0 26-27 39.630875 41.0 39.5 41.0 37.0 41.0 28-29 39.472625 41.0 39.0 41.0 36.0 41.0 30-31 39.238625 40.0 39.0 41.0 35.5 41.0 32-33 39.301 41.0 39.0 41.0 35.5 41.0 34-35 39.198875 40.0 39.0 41.0 35.0 41.0 36-37 39.027875 40.0 38.0 41.0 35.0 41.0 38-39 38.733125 40.0 38.0 41.0 35.0 41.0 40-41 38.528625 40.0 37.0 41.0 34.0 41.0 42-43 38.284125 40.0 36.5 41.0 34.0 41.0 44-45 38.0625 40.0 36.0 41.0 33.5 41.0 46-47 37.709 39.0 35.0 41.0 33.0 41.0 48-49 37.684625 39.0 35.0 41.0 33.0 41.0 50-51 37.002875 38.0 34.5 40.0 32.5 40.5 52-53 37.11425 38.0 35.0 40.0 33.0 41.0 54-55 37.33225 38.0 35.0 41.0 33.0 41.0 56-57 37.11625 37.0 35.0 41.0 33.0 41.0 58-59 36.862 37.0 35.0 40.5 33.0 41.0 60-61 36.61025 36.0 35.0 40.0 33.0 41.0 62-63 36.278 35.5 35.0 39.5 33.0 41.0 64-65 36.051500000000004 35.0 35.0 39.0 32.5 41.0 66-67 35.8145 35.0 35.0 39.0 32.5 41.0 68-69 35.505125 35.0 35.0 37.5 32.0 40.5 70-71 35.164875 35.0 34.5 37.0 31.5 39.5 72-73 34.89125 35.0 34.0 36.5 31.0 39.0 74-75 34.579499999999996 35.0 34.0 36.0 30.5 39.0 76-77 34.217625 35.0 34.0 35.5 30.5 38.0 78-79 34.068375 35.0 34.0 35.0 30.0 37.0 80-81 33.91175 35.0 34.0 35.0 30.0 37.0 82-83 33.6435 35.0 33.0 35.0 29.5 36.0 84-85 33.445375 35.0 33.0 35.0 29.5 36.0 86-87 33.338125 35.0 33.0 35.0 29.5 36.0 88-89 33.091499999999996 35.0 33.0 35.0 29.0 35.0 90-91 32.8245 35.0 33.0 35.0 28.5 35.0 92-93 32.70575 35.0 33.0 35.0 29.0 35.0 94-95 32.3965 35.0 33.0 35.0 27.5 35.0 96-97 31.635875 34.0 32.0 35.0 25.5 35.0 98-99 31.341 34.0 32.0 35.0 25.0 35.0 100 30.98175 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.2504650682100049 1101 2 0.011316659776767324 1101 3 0.13936544026456943 1101 4 0.09073997519636379 1101 5 0.09621744522529951 1101 6 0.02986771393138099 1101 7 0.13357792476229946 1101 8 0.04810872261265331 1101 9 0.14721992558908426 1101 10-11 0.11058288548987605 1101 12-13 0.18734497726332933 1101 14-15 0.30379288962381423 1101 16-17 0.15429929723025992 1101 18-19 0.1517414220752329 1101 20-21 0.02896341463414842 1101 22-23 0.02110892930962649 1101 24-25 -0.0012401818933440723 1101 26-27 0.0038238941711483676 1101 28-29 -0.056118230673831704 1101 30-31 -0.1431118230673789 1101 32-33 0.07182720132286136 1101 34-35 0.03891070690367826 1101 36-37 0.03475093013641839 1101 38-39 0.0025578751550199286 1101 40-41 0.0635851591566734 1101 42-43 0.018576891277390928 1101 44-45 -0.05500723439437394 1101 46-47 -0.012686027284004808 1101 48-49 -0.00441814799503959 1101 50-51 0.16236047953699995 1101 52-53 0.14763331955353465 1101 54-55 0.1854588673005324 1101 56-57 0.160086812732537 1101 58-59 0.18610479536999236 1101 60-61 0.13745349317900235 1101 62-63 0.14618644067796538 1101 64-65 0.021005580818517444 1101 66-67 -0.10877428689541802 1101 68-69 -0.22173418768086606 1101 70-71 -0.20757544439851472 1101 72-73 -0.17370297643654453 1101 74-75 -0.15401508887970294 1101 76-77 -0.2945173625465074 1101 78-79 -0.35500206696982417 1101 80-81 -0.34360789582472506 1101 82-83 -0.29854795369987386 1101 84-85 -0.5097147581645345 1101 86-87 -0.7110634559735445 1101 88-89 -0.0753927242662229 1101 90-91 -0.07500516742455687 1101 92-93 -0.11342496899544585 1101 94-95 -0.14437784208350024 1101 96-97 0.11970338983050866 1101 98-99 -0.06839086399338612 1101 100 -0.18602728400165347 1104 1 -0.25046506821000136 1104 2 -0.011316659776767324 1104 3 -0.13936544026457653 1104 4 -0.09073997519636379 1104 5 -0.09621744522529951 1104 6 -0.029867713931373885 1104 7 -0.13357792476229946 1104 8 -0.048108722612646204 1104 9 -0.14721992558909136 1104 10-11 -0.11058288548986894 1104 12-13 -0.18734497726332933 1104 14-15 -0.30379288962381423 1104 16-17 -0.15429929723025992 1104 18-19 -0.1517414220752329 1104 20-21 -0.02896341463414842 1104 22-23 -0.021108929309633595 1104 24-25 0.0012401818933440723 1104 26-27 -0.003823894171141262 1104 28-29 0.056118230673831704 1104 30-31 0.143111823067386 1104 32-33 -0.07182720132286136 1104 34-35 -0.038910706903685366 1104 36-37 -0.03475093013641839 1104 38-39 -0.002557875155027034 1104 40-41 -0.0635851591566734 1104 42-43 -0.018576891277390928 1104 44-45 0.055007234394381044 1104 46-47 0.012686027284004808 1104 48-49 0.00441814799503959 1104 50-51 -0.16236047953699995 1104 52-53 -0.14763331955353465 1104 54-55 -0.1854588673005324 1104 56-57 -0.1600868127325299 1104 58-59 -0.18610479536998525 1104 60-61 -0.13745349317900235 1104 62-63 -0.14618644067796538 1104 64-65 -0.021005580818517444 1104 66-67 0.10877428689541091 1104 68-69 0.22173418768085895 1104 70-71 0.20757544439851472 1104 72-73 0.17370297643654453 1104 74-75 0.15401508887970294 1104 76-77 0.2945173625465074 1104 78-79 0.35500206696982417 1104 80-81 0.34360789582472506 1104 82-83 0.29854795369987386 1104 84-85 0.5097147581645274 1104 86-87 0.7110634559735374 1104 88-89 0.07539272426623 1104 90-91 0.07500516742455687 1104 92-93 0.11342496899545296 1104 94-95 0.14437784208350024 1104 96-97 -0.11970338983050866 1104 98-99 0.06839086399338612 1104 100 0.18602728400165347 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 10.0 28 23.0 29 46.0 30 62.0 31 85.0 32 121.0 33 167.0 34 276.0 35 455.0 36 736.0 37 937.0 38 915.0 39 166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.120603015075375 9.798994974874372 13.71859296482412 47.36180904522613 2 26.85 17.549999999999997 30.95 24.65 3 27.200000000000003 22.125 22.8 27.875 4 31.900000000000002 27.625 15.6 24.875 5 30.425 29.15 18.275 22.15 6 23.625 31.95 19.375 25.05 7 20.290217663247436 14.310733049787341 38.22867150362772 27.1703777833375 8 23.417563172379285 17.81336002001501 23.792844633475106 34.9762321741306 9 22.85571392848212 18.35458864716179 27.056764191047762 31.732933233308323 10-11 27.628453556694588 26.24078009751219 18.789848731091386 27.340917614701837 12-13 25.624999999999996 20.9125 25.35 28.1125 14-15 26.2125 22.675 23.1375 27.975 16-17 26.8375 21.75 23.325000000000003 28.0875 18-19 26.8125 23.3125 22.725 27.150000000000002 20-21 26.1625 23.4125 23.3625 27.0625 22-23 26.575 23.075000000000003 22.85 27.500000000000004 24-25 26.4125 22.8875 21.8625 28.8375 26-27 26.950000000000003 22.625 23.150000000000002 27.275 28-29 26.5 23.0125 22.7625 27.725 30-31 25.8 23.1 22.8875 28.212500000000002 32-33 26.937499999999996 22.3375 23.150000000000002 27.575 34-35 27.825 22.25 22.162499999999998 27.762500000000003 36-37 27.437499999999996 23.425 22.075 27.0625 38-39 26.625 23.425 23.1375 26.8125 40-41 27.200000000000003 22.975 23.05 26.775 42-43 26.150000000000002 23.0125 22.787499999999998 28.050000000000004 44-45 27.375 23.1625 22.5625 26.900000000000002 46-47 26.424999999999997 23.200000000000003 22.6375 27.737499999999997 48-49 26.2125 23.6125 22.8875 27.287499999999998 50-51 26.8375 22.7375 22.95 27.474999999999998 52-53 25.924999999999997 23.3375 23.0125 27.725 54-55 26.35 22.55 23.375 27.725 56-57 27.025 23.3 23.3125 26.3625 58-59 26.974999999999998 22.3375 22.7 27.987499999999997 60-61 26.5875 22.825 22.7 27.8875 62-63 26.5 22.6375 23.4125 27.450000000000003 64-65 26.2125 24.05 22.6875 27.05 66-67 26.424999999999997 22.8625 23.1375 27.575 68-69 26.025 22.925 23.5875 27.462500000000002 70-71 27.500000000000004 22.4875 22.5625 27.450000000000003 72-73 26.85 22.912499999999998 23.05 27.187499999999996 74-75 27.200000000000003 22.925 23.3 26.575 76-77 27.2625 23.05 22.55 27.1375 78-79 26.275 22.900000000000002 23.7625 27.0625 80-81 26.7625 23.2375 21.65 28.349999999999998 82-83 26.9625 23.3375 21.85 27.85 84-85 27.0125 23.0875 23.25 26.650000000000002 86-87 27.187499999999996 23.625 22.1375 27.05 88-89 28.012500000000003 22.3125 22.675 27.0 90-91 27.4125 23.025000000000002 22.3625 27.200000000000003 92-93 26.62832854106763 23.47793474184273 22.127765970746342 27.765970746343292 94-95 26.974999999999998 22.8625 22.75 27.4125 96-97 28.000000000000004 22.8 22.8375 26.3625 98-99 27.900000000000002 23.45 22.400000000000002 26.25 100 27.425 22.3 22.15 28.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 1.5 29 2.5 30 2.0 31 3.0 32 7.0 33 8.5 34 11.0 35 20.0 36 34.0 37 47.5 38 60.5 39 68.5 40 81.5 41 99.5 42 110.0 43 118.0 44 124.0 45 133.0 46 140.5 47 139.0 48 136.0 49 133.0 50 124.0 51 110.5 52 106.0 53 111.0 54 101.5 55 89.0 56 89.5 57 98.0 58 106.0 59 116.5 60 123.0 61 117.0 62 115.0 63 117.5 64 108.5 65 106.5 66 103.5 67 84.0 68 85.0 69 81.0 70 75.0 71 69.5 72 58.5 73 53.5 74 45.0 75 36.5 76 26.0 77 17.0 78 12.0 79 10.5 80 7.0 81 5.5 82 3.5 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.075 8 0.075 9 0.025 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564552 spots for SRR8618225.sra Written 564552 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra Read 564542 spots for SRR8618225.sra Written 564542 spots for SRR8618225.sra SRR ids: ['SRR8618225.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fmh2oqh3 SRR8618225.sra spots: 11290850 blocks: [[1, 564542], [564543, 1129084], [1129085, 1693626], [1693627, 2258168], [2258169, 2822710], [2822711, 3387252], [3387253, 3951794], [3951795, 4516336], [4516337, 5080878], [5080879, 5645420], [5645421, 6209962], [6209963, 6774504], [6774505, 7339046], [7339047, 7903588], [7903589, 8468130], [8468131, 9032672], [9032673, 9597214], [9597215, 10161756], [10161757, 10726298], [10726299, 11290850]] SRR8618225 file size 2938549 SRR8618225 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618225 SRR8618225_1.fastq SRR8618225_2.fastq Input file: SRR8618225_1.fastq Paired file: SRR8618225_2.fastq trimmed: SRR8618225-trimmed-pair1.fastq, SRR8618225-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:44:44 2024 >> started Sat Dec 7 07:44:54 2024 >> done (10.113s) 11290850 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11290850 (100.00%) read pairs available; of these: 1444919 (12.80%) trimmed read pairs available after processing 9845931 (87.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 15 0.00% 82 34 0.00% 83 102 0.00% 84 6471 0.06% 85 7008 0.06% 86 7607 0.07% 87 8420 0.07% 88 10048 0.09% 89 12491 0.11% 90 19874 0.18% 91 34834 0.31% 92 48961 0.43% 93 66603 0.59% 94 89441 0.79% 95 112714 1.00% 96 146043 1.29% 97 199489 1.77% 98 287500 2.55% 99 387263 3.43% 100 9845931 87.20% 11290850 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.21 sequence-density-rank=12 fanout-score=8.29 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=3.5 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=23 prefix-density=0.39 prefix-fanout=2.5 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTCATAGTACCCAGGGGAGCTGTTGTGCTCGCGGAAGACGAAGCCGACCTTGCTGAACTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=30 fanout-score=7.98 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.7 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618225 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:45:20 Started mapping on | Dec 07 07:45:21 Finished on | Dec 07 07:45:50 Mapping speed, Million of reads per hour | 1401.62 Number of input reads | 11290850 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11051768 Uniquely mapped reads % | 97.88% Average mapped length | 198.31 Number of splices: Total | 6662319 Number of splices: Annotated (sjdb) | 6343792 Number of splices: GT/AG | 6570580 Number of splices: GC/AG | 76271 Number of splices: AT/AC | 1988 Number of splices: Non-canonical | 13480 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 97227 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 7303 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 141855 141855 141855 N_multimapping 97227 97227 97227 N_noFeature 246638 5524386 5575998 N_ambiguous 238684 20497 21907 UnstrandedReadsAssigned:10566446 PositiveStrandReadsAssigned:5506885 NegativeStrandReadsAssigned:5453863 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618225 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618225-trimmed-pair1.fastq SRR8618225-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,290,850 reads, 10,774,361 reads pseudoaligned [quant] estimated average fragment length: 164.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52973 SRR8618225.ke.tsv 35125 SRR8618225.se.tsv 88098 total ==> SRR8618225.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.145 0 0 PNS24247 1044 880.95 10.8463 1.57377 PNS24249 1928 1764.95 86.2995 6.25013 PNS24246 1044 880.95 10.8463 1.57377 PNS24248 1044 880.95 10.8463 1.57377 PNS24244 1471 1307.95 15.1617 1.48173 PNS24243 293 136.908 7 6.53555 KQK14069 1603 1439.95 2910.92 258.402 KQK14071 474 312.523 237.29 97.0536 ==> SRR8618225.se.tsv <== BRADI_1g14170v3 3421 BRADI_1g53295v3 111 BRADI_1g59795v3 205 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 299 BRADI_1g74790v3 39 BRADI_1g09890v3 3 BRADI_1g77505v3 118 BRADI_1g48960v3 0 SRR8618225 completed mapping pipeline successfully