Starting /dee2/code/volunteer_pipeline.sh SRR8618226 current disk space = 1544427053056 free memory = 1601064324 SRR8618226 SRAfilesize 0855066a8e008ee8d1dc55c723367abb SRR8618226.sra SRR8618226.sra file validated SRR8618226 is paired end SRR8618226 is conventional basespace SRR8618226 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618226_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.81875 34.0 31.0 34.0 2.0 34.0 2 31.57425 34.0 31.0 34.0 19.0 34.0 3 32.76225 34.0 31.0 34.0 28.0 34.0 4 36.471 37.0 37.0 37.0 35.0 37.0 5 36.404 37.0 37.0 37.0 35.0 37.0 6 36.528 37.0 37.0 37.0 35.0 37.0 7 36.353 37.0 37.0 37.0 35.0 37.0 8 36.456 37.0 37.0 37.0 35.0 37.0 9 38.3285 39.0 39.0 39.0 37.0 39.0 10-11 38.41475 39.0 39.0 39.0 37.0 39.0 12-13 38.195375 39.0 39.0 39.0 37.0 39.0 14-15 39.88225 41.0 40.0 41.0 38.0 41.0 16-17 39.882374999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.61725 41.0 39.0 41.0 37.0 41.0 20-21 39.539125 40.5 39.0 41.0 37.0 41.0 22-23 39.50625 40.0 39.0 41.0 37.0 41.0 24-25 39.49975 40.5 39.0 41.0 37.0 41.0 26-27 39.286500000000004 40.0 39.0 41.0 36.0 41.0 28-29 39.129374999999996 40.0 38.5 41.0 36.0 41.0 30-31 39.057874999999996 40.0 38.0 41.0 35.5 41.0 32-33 38.845875 40.0 38.0 41.0 35.0 41.0 34-35 38.679375 40.0 38.0 41.0 34.5 41.0 36-37 38.443125 40.0 38.0 41.0 34.0 41.0 38-39 38.224374999999995 40.0 37.0 41.0 33.5 41.0 40-41 38.47025 40.0 37.0 41.0 34.0 41.0 42-43 38.538125 40.0 37.0 41.0 35.0 41.0 44-45 38.427875 40.0 37.0 41.0 35.0 41.0 46-47 38.255375 40.0 36.5 41.0 34.5 41.0 48-49 37.98125 39.5 35.0 41.0 34.0 41.0 50-51 37.739625000000004 39.0 35.0 41.0 33.0 41.0 52-53 37.405249999999995 39.0 35.0 41.0 33.0 41.0 54-55 36.981 38.0 35.0 41.0 33.0 41.0 56-57 36.84625 37.5 35.0 40.0 33.0 41.0 58-59 36.585499999999996 37.0 35.0 40.0 33.0 41.0 60-61 36.241125 36.0 35.0 40.0 31.5 41.0 62-63 35.869875 35.5 34.5 39.5 31.0 41.0 64-65 35.553124999999994 35.0 34.0 39.0 31.0 41.0 66-67 35.164875 35.0 34.0 39.0 30.5 41.0 68-69 35.113 35.0 34.0 37.5 31.0 40.0 70-71 34.756625 35.0 34.0 37.0 30.5 40.0 72-73 34.385875 35.0 33.5 36.5 29.5 39.0 74-75 34.106125000000006 35.0 33.0 36.0 29.5 39.0 76-77 32.918625 34.0 31.5 35.0 28.0 37.0 78-79 33.702625 35.0 33.0 35.0 29.0 37.0 80-81 33.766125 35.0 33.0 35.0 30.0 37.0 82-83 33.7375 35.0 33.0 35.0 30.0 36.0 84-85 33.469750000000005 35.0 33.0 35.0 29.5 36.0 86-87 33.36425 35.0 33.0 35.0 29.5 36.0 88-89 33.168375 35.0 33.0 35.0 29.0 35.5 90-91 32.945875 35.0 33.0 35.0 29.0 35.0 92-93 32.794875000000005 35.0 33.0 35.0 29.0 35.0 94-95 32.558375 35.0 33.0 35.0 28.0 35.0 96-97 32.3745 35.0 33.0 35.0 27.0 35.0 98-99 32.030375 35.0 33.0 35.0 27.0 35.0 100 31.652 35.0 32.0 35.0 26.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -2.7177566023719884 1101 2 -1.4501652193959877 1101 3 -0.519659827352136 1101 4 -0.22408360869899013 1101 5 0.07688465380773124 1101 6 0.02817695125387587 1101 7 0.3466149235380058 1101 8 -0.08713081790004651 1101 9 -0.05559824790594092 1101 10-11 -0.05007812700120695 1101 12-13 -0.059844002151692166 1101 14-15 0.05130126283972203 1101 16-17 0.04574912267219844 1101 18-19 0.18810676502984336 1101 20-21 0.05190962883271055 1101 22-23 0.08552985476062247 1101 24-25 0.08156587002740423 1101 26-27 0.032019262788494984 1101 28-29 -0.1550885012423464 1101 30-31 -0.019352442429365624 1101 32-33 0.017533748302980712 1101 34-35 -0.01095058787366554 1101 36-37 -0.27451394759086867 1101 38-39 -0.34283665052895884 1101 40-41 -0.08403775711467887 1101 42-43 -0.09377801685494092 1101 44-45 -0.06891185737340066 1101 46-47 -0.17064345910500123 1101 48-49 -0.1325469402392514 1101 50-51 0.055169189784571415 1101 52-53 0.1382335613104786 1101 54-55 0.18072312303081617 1101 56-57 0.14832603294141933 1101 58-59 0.153020056866211 1101 60-61 0.22398114705806904 1101 62-63 0.4369476677169004 1101 64-65 0.10638079868849104 1101 66-67 0.45708778401085937 1101 68-69 0.09382284382284212 1101 70-71 0.1055034708880882 1101 72-73 0.40253976792438095 1101 74-75 0.5947898255590616 1101 76-77 0.17538871385025345 1101 78-79 0.150580189041726 1101 80-81 0.20764491918338024 1101 82-83 0.027209969517656418 1101 84-85 -0.32270934194011147 1101 86-87 -0.44726427418735426 1101 88-89 -0.35627833704756995 1101 90-91 -0.4813904044673265 1101 92-93 -0.27959220266912865 1101 94-95 -0.6374202720356585 1101 96-97 -0.6471541279233577 1101 98-99 -0.802601244908935 1101 100 -0.9369348600117817 1104 1 2.717756602371985 1104 2 1.4501652193959877 1104 3 0.519659827352136 1104 4 0.22408360869899724 1104 5 -0.07688465380773124 1104 6 -0.02817695125387587 1104 7 -0.3466149235379987 1104 8 0.08713081790004651 1104 9 0.05559824790593382 1104 10-11 0.05007812700120695 1104 12-13 0.05984400215169927 1104 14-15 -0.051301262839729134 1104 16-17 -0.04574912267219844 1104 18-19 -0.18810676502983625 1104 20-21 -0.05190962883270345 1104 22-23 -0.08552985476062247 1104 24-25 -0.08156587002741134 1104 26-27 -0.032019262788494984 1104 28-29 0.1550885012423464 1104 30-31 0.019352442429365624 1104 32-33 -0.017533748302980712 1104 34-35 0.010950587873658435 1104 36-37 0.27451394759086867 1104 38-39 0.34283665052895884 1104 40-41 0.08403775711467887 1104 42-43 0.09377801685494092 1104 44-45 0.06891185737340066 1104 46-47 0.17064345910500123 1104 48-49 0.1325469402392514 1104 50-51 -0.05516918978457852 1104 52-53 -0.1382335613104857 1104 54-55 -0.18072312303080906 1104 56-57 -0.14832603294141933 1104 58-59 -0.153020056866211 1104 60-61 -0.22398114705806904 1104 62-63 -0.4369476677169004 1104 64-65 -0.10638079868849104 1104 66-67 -0.45708778401085937 1104 68-69 -0.09382284382284922 1104 70-71 -0.1055034708880811 1104 72-73 -0.40253976792438806 1104 74-75 -0.5947898255590545 1104 76-77 -0.17538871385025345 1104 78-79 -0.150580189041726 1104 80-81 -0.20764491918338024 1104 82-83 -0.027209969517663524 1104 84-85 0.32270934194011147 1104 86-87 0.44726427418735426 1104 88-89 0.35627833704756995 1104 90-91 0.4813904044673265 1104 92-93 0.27959220266912865 1104 94-95 0.637420272035655 1104 96-97 0.6471541279233577 1104 98-99 0.8026012449089421 1104 100 0.9369348600117817 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 11.0 28 25.0 29 53.0 30 68.0 31 101.0 32 124.0 33 176.0 34 303.0 35 497.0 36 781.0 37 926.0 38 811.0 39 123.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.22023975466964 10.091998884862003 13.632562029551156 46.055199330917205 2 27.250000000000004 17.75 31.724999999999998 23.275000000000002 3 27.900000000000002 22.225 22.525000000000002 27.35 4 30.325000000000003 26.525 16.125 27.025 5 30.225 29.25 18.425 22.1 6 22.3 33.25 18.975 25.474999999999998 7 21.075 13.600000000000001 40.0 25.324999999999996 8 23.05 17.9 23.35 35.699999999999996 9 22.675 19.625 27.35 30.349999999999998 10-11 27.474999999999998 27.525 18.0375 26.9625 12-13 24.725 21.0 26.174999999999997 28.1 14-15 25.7 22.9375 23.8375 27.525 16-17 27.3625 22.3625 22.6 27.675 18-19 25.837500000000002 24.0125 22.7375 27.4125 20-21 26.0625 22.787499999999998 23.9875 27.1625 22-23 26.474999999999998 23.0875 23.200000000000003 27.237499999999997 24-25 26.337500000000002 24.05 22.2125 27.400000000000002 26-27 27.175 22.9875 22.650000000000002 27.187499999999996 28-29 26.637499999999996 22.912499999999998 22.8 27.650000000000002 30-31 26.125 24.0125 22.6125 27.250000000000004 32-33 25.974999999999998 23.4875 22.775000000000002 27.762500000000003 34-35 26.6625 23.5 22.7375 27.1 36-37 26.075 23.525 23.025000000000002 27.375 38-39 27.3625 23.375 23.1 26.1625 40-41 27.075 23.3125 22.9875 26.625 42-43 26.775 22.85 23.599999999999998 26.775 44-45 26.575 22.3375 23.3125 27.775 46-47 27.075 22.3375 22.95 27.6375 48-49 25.887500000000003 22.9375 22.9375 28.237499999999997 50-51 27.1375 22.662499999999998 22.875 27.325 52-53 26.8375 22.725 22.625 27.8125 54-55 26.2125 23.425 23.0625 27.3 56-57 26.487500000000004 23.2375 22.95 27.325 58-59 26.7125 21.85 23.3 28.1375 60-61 26.1 23.1125 23.799999999999997 26.987499999999997 62-63 26.687499999999996 23.7375 22.8 26.775 64-65 26.787499999999998 23.025000000000002 22.162499999999998 28.025 66-67 25.7 24.175 23.1625 26.9625 68-69 26.85 23.275000000000002 22.237499999999997 27.6375 70-71 26.8625 23.474999999999998 22.55 27.1125 72-73 26.55 22.9375 23.8375 26.674999999999997 74-75 26.7125 22.5125 23.8375 26.937499999999996 76-77 27.3125 22.900000000000002 23.2125 26.575 78-79 26.187500000000004 22.3375 23.65 27.825 80-81 26.775 23.0125 23.5125 26.700000000000003 82-83 27.6 22.8875 22.325 27.187499999999996 84-85 26.375 23.5125 24.0 26.1125 86-87 27.275 22.05 24.0125 26.6625 88-89 28.525 21.987499999999997 22.4625 27.025 90-91 27.125 23.825 22.237499999999997 26.8125 92-93 27.1125 23.3625 23.1375 26.387500000000003 94-95 27.750000000000004 23.674999999999997 22.8375 25.7375 96-97 26.55 23.7125 22.775000000000002 26.9625 98-99 28.1125 22.912499999999998 22.7 26.275 100 27.224999999999998 23.05 22.925 26.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.5 28 3.0 29 4.0 30 4.0 31 6.0 32 10.0 33 12.0 34 15.0 35 22.5 36 27.5 37 36.0 38 59.5 39 72.5 40 82.5 41 97.5 42 114.0 43 129.5 44 127.5 45 132.0 46 150.0 47 145.0 48 126.5 49 126.5 50 127.5 51 123.5 52 123.5 53 120.5 54 106.0 55 89.5 56 87.0 57 93.5 58 99.5 59 113.5 60 135.5 61 132.5 62 109.0 63 108.5 64 111.0 65 100.5 66 98.5 67 93.0 68 84.0 69 79.0 70 63.5 71 54.0 72 49.0 73 41.5 74 34.0 75 26.0 76 25.0 77 19.0 78 12.0 79 9.0 80 7.5 81 6.0 82 2.5 83 4.0 84 4.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618226 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618226_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61075 34.0 31.0 34.0 31.0 34.0 2 33.17125 34.0 33.0 34.0 31.0 34.0 3 33.24875 34.0 33.0 34.0 31.0 34.0 4 36.58225 37.0 37.0 37.0 35.0 37.0 5 36.58625 37.0 37.0 37.0 35.0 37.0 6 36.60775 37.0 37.0 37.0 35.0 37.0 7 36.54025 37.0 37.0 37.0 35.0 37.0 8 36.59925 37.0 37.0 37.0 35.0 37.0 9 38.425 39.0 39.0 39.0 37.0 39.0 10-11 38.509 39.0 39.0 39.0 37.0 39.0 12-13 38.488125 39.0 39.0 39.0 37.0 39.0 14-15 40.12975 41.0 40.0 41.0 38.0 41.0 16-17 40.108999999999995 41.0 40.0 41.0 38.0 41.0 18-19 40.036874999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.917125 41.0 40.0 41.0 38.0 41.0 22-23 39.855999999999995 41.0 40.0 41.0 38.0 41.0 24-25 39.779875000000004 41.0 40.0 41.0 37.5 41.0 26-27 39.69125 41.0 39.5 41.0 37.5 41.0 28-29 39.608375 41.0 39.0 41.0 37.0 41.0 30-31 39.42175 41.0 39.0 41.0 36.0 41.0 32-33 39.218374999999995 40.0 38.5 41.0 35.0 41.0 34-35 39.09525 40.0 38.0 41.0 35.0 41.0 36-37 38.861000000000004 40.0 38.0 41.0 35.0 41.0 38-39 38.63575 40.0 38.0 41.0 35.0 41.0 40-41 38.33125 40.0 37.0 41.0 34.5 41.0 42-43 38.0895 40.0 36.5 41.0 33.0 41.0 44-45 37.988749999999996 40.0 36.0 41.0 33.0 41.0 46-47 37.7405 39.0 35.0 41.0 33.0 41.0 48-49 37.41 39.0 35.0 41.0 33.0 41.0 50-51 36.284375 38.0 34.0 40.0 31.5 40.5 52-53 36.173500000000004 37.5 34.5 39.5 31.0 40.5 54-55 36.533 38.0 35.0 40.0 31.5 41.0 56-57 36.431375 37.0 35.0 40.0 31.0 41.0 58-59 36.149 36.5 34.5 40.0 31.0 41.0 60-61 36.303375 36.0 35.0 40.0 32.0 41.0 62-63 36.248374999999996 36.0 35.0 40.0 32.5 41.0 64-65 36.067750000000004 35.0 35.0 39.0 32.5 41.0 66-67 35.76925 35.0 35.0 39.0 32.0 41.0 68-69 35.53775 35.0 35.0 38.5 32.0 41.0 70-71 35.2115 35.0 34.5 37.0 31.0 40.0 72-73 34.8215 35.0 34.0 37.0 31.0 39.0 74-75 34.568875 35.0 34.0 36.0 31.0 39.0 76-77 34.19925 35.0 34.0 36.0 30.5 38.0 78-79 33.891625000000005 35.0 33.5 35.0 29.5 37.0 80-81 33.699 35.0 33.0 35.0 29.0 37.0 82-83 33.504625 35.0 33.0 35.0 29.0 36.0 84-85 33.2285 35.0 33.0 35.0 29.0 36.0 86-87 32.947375 35.0 33.0 35.0 29.0 36.0 88-89 32.764125 35.0 33.0 35.0 27.0 35.0 90-91 32.549875 35.0 33.0 35.0 27.0 35.0 92-93 32.316375 35.0 33.0 35.0 27.0 35.0 94-95 31.81125 34.5 32.0 35.0 25.0 35.0 96-97 31.451 34.0 32.0 35.0 25.0 35.0 98-99 30.79525 34.0 31.0 35.0 23.5 35.0 100 30.49 34.0 31.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.38225876687415195 1101 2 0.007710238479468501 1101 3 0.02119675196598081 1101 4 0.034375880529722735 1101 5 0.03798765337226939 1101 6 0.06640795102333641 1101 7 -0.03784676861599934 1101 8 0.09787648249186987 1101 9 0.009785086708163249 1101 10-11 -0.04950178027101515 1101 12-13 0.023380465688155994 1101 14-15 0.05717999948768693 1101 16-17 0.08542098926714203 1101 18-19 -0.019775096698175787 1101 20-21 0.025653833346140686 1101 22-23 0.03335766797305695 1101 24-25 -0.13083711160634692 1101 26-27 -0.18726145649223014 1101 28-29 0.08824508824508825 1101 30-31 0.11849048387509953 1101 32-33 0.023213965521655666 1101 34-35 -0.08262890955198543 1101 36-37 -0.011891954199640509 1101 38-39 -0.20448781987243336 1101 40-41 -0.1756448679525633 1101 42-43 -0.029079894464508982 1101 44-45 0.005808294269833425 1101 46-47 -0.11254130484900315 1101 48-49 0.12316529624222028 1101 50-51 -0.02757498911344669 1101 52-53 -0.0432324086170226 1101 54-55 -0.09939419554803663 1101 56-57 -0.31791926022695094 1101 58-59 -0.5263838725377212 1101 60-61 -0.23721150644227862 1101 62-63 -0.3556507594969176 1101 64-65 -0.20140116293962507 1101 66-67 -0.1581879658802734 1101 68-69 -0.06927687696918383 1101 70-71 0.14301723917108689 1101 72-73 0.2777991239529669 1101 74-75 0.028996644381265924 1101 76-77 0.27594200671124014 1101 78-79 -0.13257255564947457 1101 80-81 0.1934155588001758 1101 82-83 -0.1334626911550032 1101 84-85 -0.07881221342759659 1101 86-87 -0.026159737698201013 1101 88-89 -0.13968723584108744 1101 90-91 -0.26079049155971745 1101 92-93 -0.1715848254309833 1101 94-95 -0.1911101718794015 1101 96-97 -0.28886498117267223 1101 98-99 -0.5741245933553643 1101 100 -0.7304234227311177 1104 1 0.38225876687415195 1104 2 -0.007710238479468501 1104 3 -0.02119675196598081 1104 4 -0.03437588052972984 1104 5 -0.03798765337226939 1104 6 -0.06640795102333641 1104 7 0.03784676861599934 1104 8 -0.09787648249186987 1104 9 -0.009785086708163249 1104 10-11 0.04950178027101515 1104 12-13 -0.0233804656881631 1104 14-15 -0.05717999948769403 1104 16-17 -0.08542098926714203 1104 18-19 0.019775096698175787 1104 20-21 -0.025653833346140686 1104 22-23 -0.03335766797304984 1104 24-25 0.13083711160633982 1104 26-27 0.18726145649223014 1104 28-29 -0.08824508824508825 1104 30-31 -0.11849048387509953 1104 32-33 -0.02321396552166277 1104 34-35 0.08262890955198543 1104 36-37 0.011891954199647614 1104 38-39 0.20448781987243336 1104 40-41 0.1756448679525633 1104 42-43 0.029079894464516087 1104 44-45 -0.005808294269833425 1104 46-47 0.11254130484899605 1104 48-49 -0.12316529624222028 1104 50-51 0.027574989113453796 1104 52-53 0.0432324086170226 1104 54-55 0.09939419554804374 1104 56-57 0.31791926022695804 1104 58-59 0.5263838725377212 1104 60-61 0.23721150644227862 1104 62-63 0.3556507594969105 1104 64-65 0.20140116293962507 1104 66-67 0.1581879658802663 1104 68-69 0.06927687696918383 1104 70-71 -0.14301723917108689 1104 72-73 -0.2777991239529669 1104 74-75 -0.028996644381258818 1104 76-77 -0.27594200671123303 1104 78-79 0.13257255564948167 1104 80-81 -0.1934155588001758 1104 82-83 0.1334626911550032 1104 84-85 0.07881221342759659 1104 86-87 0.026159737698193908 1104 88-89 0.13968723584108034 1104 90-91 0.26079049155971745 1104 92-93 0.1715848254309762 1104 94-95 0.1911101718794015 1104 96-97 0.28886498117267223 1104 98-99 0.5741245933553643 1104 100 0.7304234227311142 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 7.0 28 21.0 29 52.0 30 88.0 31 106.0 32 121.0 33 193.0 34 320.0 35 436.0 36 737.0 37 912.0 38 855.0 39 151.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.725 11.025 12.15 47.099999999999994 2 27.970978233675257 17.788341255941955 30.34776082061546 23.892919689767325 3 27.213606803401703 22.536268134067033 22.661330665332667 27.5887943971986 4 29.139569784892444 27.03851925962982 15.78289144572286 28.039019509754876 5 30.48262065516379 29.332333083270818 17.90447611902976 22.280570142535634 6 22.675 31.275 19.425 26.625 7 20.7 13.575000000000001 38.275 27.450000000000003 8 22.85 19.75 23.724999999999998 33.675 9 23.45 18.224999999999998 28.025 30.3 10-11 26.700000000000003 26.85 18.425 28.025 12-13 24.75 20.65 25.724999999999998 28.875 14-15 25.412499999999998 23.474999999999998 23.962500000000002 27.150000000000002 16-17 26.5125 22.5875 23.0625 27.8375 18-19 26.150000000000002 23.150000000000002 22.625 28.075 20-21 26.900000000000002 22.5875 23.4375 27.075 22-23 27.175 22.9625 22.475 27.3875 24-25 25.837500000000002 23.1375 22.3125 28.712500000000002 26-27 26.224999999999998 22.9875 23.175 27.6125 28-29 26.474999999999998 22.7 23.075000000000003 27.750000000000004 30-31 25.7125 23.2625 24.224999999999998 26.8 32-33 25.9875 23.474999999999998 23.3 27.237499999999997 34-35 26.437500000000004 22.25 23.5625 27.750000000000004 36-37 26.075 23.2625 22.6875 27.975 38-39 26.200000000000003 23.2125 23.45 27.1375 40-41 26.150000000000002 23.4875 22.162499999999998 28.199999999999996 42-43 26.275 23.0 22.95 27.775 44-45 26.650000000000002 23.425 22.3625 27.5625 46-47 27.975 23.0875 22.537499999999998 26.400000000000002 48-49 26.2125 23.125 22.9875 27.675 50-51 26.6125 23.1625 23.325000000000003 26.900000000000002 52-53 26.6125 23.6625 22.75 26.974999999999998 54-55 25.8625 22.75 23.25 28.1375 56-57 26.224999999999998 24.3125 22.7125 26.75 58-59 27.224999999999998 22.375 22.975 27.425 60-61 26.4625 23.325000000000003 23.375 26.8375 62-63 26.674999999999997 24.0 23.2375 26.087500000000002 64-65 26.875 23.35 22.625 27.150000000000002 66-67 25.7875 23.625 23.075000000000003 27.5125 68-69 27.625 22.375 22.8375 27.1625 70-71 27.6875 22.975 23.150000000000002 26.187500000000004 72-73 26.2125 23.974999999999998 22.8125 27.0 74-75 26.900000000000002 22.900000000000002 23.1375 27.0625 76-77 27.075 22.6875 22.9625 27.275 78-79 25.974999999999998 23.6875 23.0875 27.250000000000004 80-81 27.0 23.175 23.325000000000003 26.5 82-83 26.8625 22.3625 23.2375 27.537499999999998 84-85 27.962500000000002 22.662499999999998 22.8625 26.5125 86-87 26.5125 22.575 24.625 26.2875 88-89 27.3625 23.175 23.3375 26.125 90-91 27.287499999999998 24.0 22.3625 26.35 92-93 26.987499999999997 23.674999999999997 22.85 26.487500000000004 94-95 27.900000000000002 23.2375 22.225 26.637499999999996 96-97 27.8125 22.8375 22.825 26.525 98-99 27.762500000000003 23.175 23.0625 26.0 100 28.275 22.5 22.25 26.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 2.5 27 1.0 28 1.0 29 2.5 30 5.5 31 6.0 32 6.5 33 12.5 34 17.5 35 23.5 36 34.0 37 44.5 38 60.5 39 68.5 40 74.0 41 91.5 42 110.0 43 120.0 44 129.5 45 142.5 46 142.5 47 147.0 48 157.0 49 139.5 50 110.5 51 105.0 52 115.5 53 107.5 54 97.5 55 98.5 56 90.5 57 87.0 58 105.0 59 123.5 60 125.0 61 120.0 62 104.0 63 104.0 64 111.0 65 99.5 66 100.5 67 103.0 68 92.5 69 82.5 70 66.5 71 54.5 72 54.5 73 52.0 74 39.5 75 31.5 76 22.5 77 14.0 78 13.5 79 9.0 80 6.0 81 5.5 82 4.5 83 1.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.05 4 0.05 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8607594936709 97.625 2 1.0379746835443038 2.0500000000000003 3 0.0759493670886076 0.22499999999999998 4 0.025316455696202535 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566686 spots for SRR8618226.sra Written 566686 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra Read 566678 spots for SRR8618226.sra Written 566678 spots for SRR8618226.sra SRR ids: ['SRR8618226.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__l1lju_p SRR8618226.sra spots: 11333568 blocks: [[1, 566678], [566679, 1133356], [1133357, 1700034], [1700035, 2266712], [2266713, 2833390], [2833391, 3400068], [3400069, 3966746], [3966747, 4533424], [4533425, 5100102], [5100103, 5666780], [5666781, 6233458], [6233459, 6800136], [6800137, 7366814], [7366815, 7933492], [7933493, 8500170], [8500171, 9066848], [9066849, 9633526], [9633527, 10200204], [10200205, 10766882], [10766883, 11333568]] SRR8618226 file size 2949540 SRR8618226 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618226 SRR8618226_1.fastq SRR8618226_2.fastq Input file: SRR8618226_1.fastq Paired file: SRR8618226_2.fastq trimmed: SRR8618226-trimmed-pair1.fastq, SRR8618226-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:54:35 2024 >> started Sat Dec 7 07:54:47 2024 >> done (11.573s) 11333568 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11333568 (100.00%) read pairs available; of these: 1300967 (11.48%) trimmed read pairs available after processing 10032601 (88.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 7 0.00% 82 29 0.00% 83 108 0.00% 84 6155 0.05% 85 6566 0.06% 86 7263 0.06% 87 7941 0.07% 88 9507 0.08% 89 11679 0.10% 90 18493 0.16% 91 32346 0.29% 92 45488 0.40% 93 61538 0.54% 94 80921 0.71% 95 102468 0.90% 96 134115 1.18% 97 184083 1.62% 98 256663 2.26% 99 335596 2.96% 100 10032601 88.52% 11333568 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=20 fanout-score=9.33 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=3.8 sequence=CAGAGCATCCTCGCCAT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=19 fanout-score=9.84 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=4.0 sequence=CAGAGCATCCTCGCCAT SRR8618226 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:55:16 Started mapping on | Dec 07 07:55:16 Finished on | Dec 07 07:56:00 Mapping speed, Million of reads per hour | 927.29 Number of input reads | 11333568 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11099029 Uniquely mapped reads % | 97.93% Average mapped length | 198.39 Number of splices: Total | 6813911 Number of splices: Annotated (sjdb) | 6491306 Number of splices: GT/AG | 6719711 Number of splices: GC/AG | 78970 Number of splices: AT/AC | 2001 Number of splices: Non-canonical | 13229 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 94824 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 6212 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 139715 139715 139715 N_multimapping 94824 94824 94824 N_noFeature 245387 5544489 5591657 N_ambiguous 250513 21162 22531 UnstrandedReadsAssigned:10603129 PositiveStrandReadsAssigned:5533378 NegativeStrandReadsAssigned:5484841 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618226 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618226-trimmed-pair1.fastq SRR8618226-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,333,568 reads, 10,815,046 reads pseudoaligned [quant] estimated average fragment length: 164.693 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52973 SRR8618226.ke.tsv 35125 SRR8618226.se.tsv 88098 total ==> SRR8618226.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 772.451 0 0 PNS24247 1044 880.307 15.12 2.16507 PNS24249 1928 1764.31 72.4166 5.1739 PNS24246 1044 880.307 15.12 2.16507 PNS24248 1044 880.307 15.12 2.16507 PNS24244 1471 1307.31 23.2233 2.23923 PNS24243 293 136.421 4 3.69599 KQK14069 1603 1439.31 2347.78 205.617 KQK14071 474 311.609 201.963 81.6986 ==> SRR8618226.se.tsv <== BRADI_1g14170v3 2750 BRADI_1g53295v3 137 BRADI_1g59795v3 175 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 222 BRADI_1g74790v3 24 BRADI_1g09890v3 0 BRADI_1g77505v3 139 BRADI_1g48960v3 0 SRR8618226 completed mapping pipeline successfully