Starting /dee2/code/volunteer_pipeline.sh SRR8618227 current disk space = 1544430714880 free memory = 1597619156 SRR8618227 SRAfilesize 8ed56e6b70e6302575b2ebe08137c847 SRR8618227.sra SRR8618227.sra file validated SRR8618227 is paired end SRR8618227 is conventional basespace SRR8618227 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618227_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0525 34.0 31.0 34.0 31.0 34.0 2 33.19225 34.0 33.0 34.0 31.0 34.0 3 33.27725 34.0 34.0 34.0 31.0 34.0 4 34.8755 37.0 37.0 37.0 35.0 37.0 5 35.67575 37.0 37.0 37.0 35.0 37.0 6 36.234 37.0 37.0 37.0 35.0 37.0 7 36.28475 37.0 37.0 37.0 35.0 37.0 8 36.4035 37.0 37.0 37.0 35.0 37.0 9 38.377 39.0 39.0 39.0 37.0 39.0 10-11 38.400875 39.0 39.0 39.0 37.0 39.0 12-13 38.3635 39.0 39.0 39.0 37.0 39.0 14-15 39.907624999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.85825 41.0 40.0 41.0 38.0 41.0 18-19 39.867625000000004 41.0 40.0 41.0 38.0 41.0 20-21 39.662875 41.0 40.0 41.0 37.0 41.0 22-23 39.666375 41.0 39.5 41.0 37.0 41.0 24-25 39.513000000000005 41.0 39.0 41.0 37.0 41.0 26-27 39.37325 40.0 39.0 41.0 36.0 41.0 28-29 39.260625 40.0 39.0 41.0 36.0 41.0 30-31 38.97675 40.0 38.0 41.0 35.0 41.0 32-33 38.8575 40.0 38.0 41.0 35.0 41.0 34-35 39.066874999999996 40.0 38.0 41.0 35.0 41.0 36-37 39.023875000000004 40.0 38.0 41.0 35.0 41.0 38-39 38.916624999999996 40.0 38.0 41.0 35.0 41.0 40-41 38.72175 40.0 37.0 41.0 35.0 41.0 42-43 38.460499999999996 40.0 37.0 41.0 35.0 41.0 44-45 38.173375 40.0 36.0 41.0 34.0 41.0 46-47 38.029625 39.5 35.0 41.0 34.0 41.0 48-49 37.722750000000005 39.0 35.0 41.0 33.5 41.0 50-51 37.4995 39.0 35.0 41.0 33.0 41.0 52-53 37.126 38.0 35.0 41.0 33.0 41.0 54-55 36.913875000000004 37.5 35.0 40.5 33.0 41.0 56-57 36.67125 37.0 35.0 40.0 33.0 41.0 58-59 36.45425 36.0 35.0 40.0 32.5 41.0 60-61 36.223625 36.0 35.0 40.0 32.5 41.0 62-63 35.96225 35.0 35.0 39.0 32.0 41.0 64-65 35.63249999999999 35.0 34.5 39.0 31.5 41.0 66-67 35.372125 35.0 34.0 38.5 31.0 40.5 68-69 34.975875 35.0 34.0 37.0 31.0 40.0 70-71 34.733375 35.0 34.0 37.0 30.5 39.5 72-73 34.427625 35.0 34.0 36.0 30.0 39.0 74-75 34.074875 35.0 33.0 36.0 29.5 39.0 76-77 33.095124999999996 34.5 32.0 35.0 28.0 37.0 78-79 33.716875 35.0 33.0 35.0 29.5 37.0 80-81 33.6485 35.0 33.0 35.0 29.0 36.5 82-83 33.46625 35.0 33.0 35.0 29.0 36.0 84-85 33.187 35.0 33.0 35.0 29.0 36.0 86-87 33.101625 35.0 33.0 35.0 29.0 35.5 88-89 32.791125 35.0 33.0 35.0 28.0 35.0 90-91 32.494 35.0 32.5 35.0 27.0 35.0 92-93 32.252375 35.0 32.0 35.0 27.0 35.0 94-95 31.983375 35.0 32.0 35.0 26.0 35.0 96-97 31.690875 34.0 32.0 35.0 26.0 35.0 98-99 31.336125000000003 34.0 32.0 35.0 25.0 35.0 100 30.91325 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.18480138169257287 1101 2 0.16953267752997903 1101 3 0.16694200395484415 1101 4 -1.645603364121044 1101 5 -0.8204300267828089 1101 6 -0.04898500663312433 1101 7 -0.04625666441390308 1101 8 0.027746489449576472 1101 9 0.18003304047458357 1101 10-11 0.20898100172711764 1101 12-13 0.12601687066656808 1101 14-15 0.19023303546844517 1101 16-17 0.19086505969813317 1101 18-19 0.16149783484768676 1101 20-21 0.2535168080899055 1101 22-23 0.332113088533454 1101 24-25 0.19854321543891018 1101 26-27 -0.012965883206923934 1101 28-29 0.018053365372580288 1101 30-31 0.08606167555254984 1101 32-33 -0.0863057245125276 1101 34-35 -0.04691371930614707 1101 36-37 0.19743560862056597 1101 38-39 0.1528810292608398 1101 40-41 0.002897299191509717 1101 42-43 -0.08261995945032652 1101 44-45 -0.05280218267377279 1101 46-47 0.055887211834495076 1101 48-49 -0.03466746764787132 1101 50-51 -0.1630685089234305 1101 52-53 -0.16802458011063237 1101 54-55 -0.12095441916347482 1101 56-57 0.07816450151435106 1101 58-59 0.13527195814873494 1101 60-61 0.006395334284498233 1101 62-63 0.05958549222798126 1101 64-65 -0.015550299116419808 1101 66-67 -0.18018322444994794 1101 68-69 -0.05735776325999353 1101 70-71 0.1725989336937701 1101 72-73 0.17178543716052275 1101 74-75 -0.03592525844159411 1101 76-77 0.058121198468121804 1101 78-79 -0.1564791870040807 1101 80-81 -0.13379514905759748 1101 82-83 0.057639358213812386 1101 84-85 0.2193687266901918 1101 86-87 0.1007296438136791 1101 88-89 0.09880228279642722 1101 90-91 -0.14338815048434128 1101 92-93 -0.19555830892843318 1101 94-95 0.17246126504968728 1101 96-97 0.10358939701133707 1101 98-99 0.01815974568846812 1101 100 -0.02541863783134346 1104 1 -0.18480138169257287 1104 2 -0.16953267752997192 1104 3 -0.16694200395484415 1104 4 1.645603364121051 1104 5 0.8204300267828089 1104 6 0.04898500663312433 1104 7 0.04625666441391019 1104 8 -0.027746489449576472 1104 9 -0.18003304047457647 1104 10-11 -0.20898100172711054 1104 12-13 -0.12601687066656098 1104 14-15 -0.19023303546844517 1104 16-17 -0.19086505969812606 1104 18-19 -0.16149783484769387 1104 20-21 -0.2535168080899126 1104 22-23 -0.332113088533454 1104 24-25 -0.19854321543891018 1104 26-27 0.012965883206923934 1104 28-29 -0.018053365372580288 1104 30-31 -0.08606167555254984 1104 32-33 0.0863057245125276 1104 34-35 0.04691371930615418 1104 36-37 -0.19743560862055887 1104 38-39 -0.1528810292608469 1104 40-41 -0.002897299191509717 1104 42-43 0.08261995945032652 1104 44-45 0.052802182673779896 1104 46-47 -0.05588721183450218 1104 48-49 0.03466746764787132 1104 50-51 0.1630685089234305 1104 52-53 0.16802458011063948 1104 54-55 0.12095441916347482 1104 56-57 -0.07816450151435816 1104 58-59 -0.13527195814873494 1104 60-61 -0.006395334284498233 1104 62-63 -0.05958549222798126 1104 64-65 0.015550299116419808 1104 66-67 0.18018322444995505 1104 68-69 0.05735776325999353 1104 70-71 -0.1725989336937772 1104 72-73 -0.17178543716052275 1104 74-75 0.035925258441587005 1104 76-77 -0.058121198468121804 1104 78-79 0.1564791870040807 1104 80-81 0.13379514905759748 1104 82-83 -0.057639358213812386 1104 84-85 -0.2193687266901989 1104 86-87 -0.100729643813672 1104 88-89 -0.09880228279642012 1104 90-91 0.14338815048434128 1104 92-93 0.19555830892843318 1104 94-95 -0.17246126504968728 1104 96-97 -0.10358939701134062 1104 98-99 -0.01815974568846812 1104 100 0.02541863783134346 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 10.0 28 30.0 29 53.0 30 61.0 31 124.0 32 143.0 33 195.0 34 300.0 35 452.0 36 776.0 37 897.0 38 835.0 39 122.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.049999999999997 10.225 13.55 46.175 2 26.900000000000002 17.424999999999997 30.3 25.374999999999996 3 26.275 23.05 21.025 29.65 4 29.86842105263158 27.657894736842103 16.236842105263158 26.236842105263158 5 31.225 29.049999999999997 18.075 21.65 6 23.58679339669835 32.79139569784893 19.459729864932466 24.16208104052026 7 21.925 12.975 37.875 27.224999999999998 8 23.599999999999998 18.125 24.25 34.025 9 23.375 18.125 28.275 30.225 10-11 28.1125 26.5125 18.099999999999998 27.275 12-13 25.587500000000002 21.45 23.8875 29.075 14-15 25.924999999999997 23.075000000000003 23.0875 27.9125 16-17 27.525 22.825 22.662499999999998 26.987499999999997 18-19 27.175 22.4625 22.162499999999998 28.199999999999996 20-21 27.3375 22.825 22.6125 27.224999999999998 22-23 27.6125 22.537499999999998 22.425 27.425 24-25 27.237499999999997 21.975 22.5 28.287499999999998 26-27 27.6375 22.287499999999998 22.6875 27.3875 28-29 27.125 22.8875 21.6125 28.375 30-31 26.337500000000002 23.474999999999998 22.650000000000002 27.537499999999998 32-33 26.9125 23.2125 22.05 27.825 34-35 27.474999999999998 22.875 21.75 27.900000000000002 36-37 26.6125 23.375 23.125 26.887499999999996 38-39 27.250000000000004 22.95 22.625 27.175 40-41 27.962500000000002 22.1375 22.7625 27.1375 42-43 25.9875 22.4875 23.1 28.425 44-45 26.9625 22.675 23.3125 27.05 46-47 27.6375 23.150000000000002 21.762500000000003 27.450000000000003 48-49 26.3625 23.0 22.925 27.712500000000002 50-51 26.637499999999996 23.325000000000003 22.5875 27.450000000000003 52-53 27.1125 22.75 22.5 27.6375 54-55 25.900000000000002 22.912499999999998 23.0625 28.125 56-57 27.1125 22.775000000000002 22.925 27.187499999999996 58-59 27.35 22.900000000000002 22.787499999999998 26.9625 60-61 27.3625 22.5 22.5625 27.575 62-63 26.387500000000003 23.150000000000002 22.75 27.712500000000002 64-65 27.212500000000002 21.8 23.0 27.987499999999997 66-67 27.474999999999998 22.6 22.6375 27.287499999999998 68-69 26.75 24.025 22.400000000000002 26.825 70-71 26.737499999999997 22.525000000000002 22.6125 28.125 72-73 27.450000000000003 22.15 23.275000000000002 27.125 74-75 27.1 22.85 22.787499999999998 27.2625 76-77 27.575 23.4625 22.2125 26.75 78-79 27.9375 23.025000000000002 22.45 26.5875 80-81 26.55 24.1625 21.987499999999997 27.3 82-83 28.175 22.5625 21.9625 27.3 84-85 25.937500000000004 22.1875 23.7 28.175 86-87 27.1375 22.287499999999998 23.7375 26.8375 88-89 27.900000000000002 22.237499999999997 22.225 27.6375 90-91 27.237499999999997 22.325 23.075000000000003 27.3625 92-93 26.875 23.150000000000002 22.912499999999998 27.0625 94-95 28.8625 22.5 22.025 26.6125 96-97 28.0875 22.3125 22.1375 27.462500000000002 98-99 27.5875 22.5875 23.05 26.775 100 27.800000000000004 22.625 21.8 27.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 2.5 30 4.0 31 5.0 32 6.5 33 6.5 34 9.5 35 17.0 36 26.0 37 36.5 38 53.5 39 65.5 40 85.5 41 114.5 42 127.0 43 119.5 44 124.5 45 135.0 46 126.0 47 122.0 48 123.5 49 119.0 50 117.5 51 117.0 52 107.0 53 89.5 54 92.0 55 103.5 56 97.0 57 101.5 58 104.0 59 112.0 60 124.0 61 126.0 62 114.0 63 113.0 64 129.0 65 119.0 66 103.0 67 101.0 68 94.5 69 73.5 70 68.0 71 72.5 72 62.5 73 54.0 74 47.0 75 36.5 76 28.5 77 19.5 78 12.0 79 11.0 80 9.5 81 5.5 82 3.0 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14206409285894 98.225 2 0.7822356800403736 1.55 3 0.0757002271006813 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.1625 0.0 0.0 0.0 0.025 88 0.3 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618227 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618227_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.698 34.0 31.0 34.0 31.0 34.0 2 33.01575 34.0 33.0 34.0 31.0 34.0 3 33.05525 34.0 33.0 34.0 31.0 34.0 4 36.4425 37.0 37.0 37.0 35.0 37.0 5 36.50475 37.0 37.0 37.0 35.0 37.0 6 36.52925 37.0 37.0 37.0 35.0 37.0 7 36.52775 37.0 37.0 37.0 35.0 37.0 8 36.5465 37.0 37.0 37.0 35.0 37.0 9 38.43375 39.0 39.0 39.0 37.0 39.0 10-11 38.346875 39.0 39.0 39.0 37.0 39.0 12-13 38.34125 39.0 39.0 39.0 37.0 39.0 14-15 39.962 41.0 40.0 41.0 38.0 41.0 16-17 39.800625 41.0 40.0 41.0 38.0 41.0 18-19 39.829375 41.0 40.0 41.0 38.0 41.0 20-21 39.866875 41.0 40.0 41.0 38.0 41.0 22-23 39.752125 41.0 40.0 41.0 37.0 41.0 24-25 39.678 41.0 40.0 41.0 37.0 41.0 26-27 39.4875 41.0 39.0 41.0 36.5 41.0 28-29 39.454375 41.0 39.0 41.0 36.0 41.0 30-31 39.306375 40.0 39.0 41.0 36.0 41.0 32-33 39.167874999999995 40.0 38.5 41.0 35.0 41.0 34-35 39.056875 40.0 38.0 41.0 35.0 41.0 36-37 38.8695 40.0 38.0 41.0 35.0 41.0 38-39 38.694625 40.0 38.0 41.0 35.0 41.0 40-41 38.509874999999994 40.0 37.0 41.0 34.5 41.0 42-43 38.204 40.0 36.5 41.0 34.0 41.0 44-45 37.8495 39.5 35.5 41.0 33.0 41.0 46-47 37.580875 39.0 35.0 41.0 33.0 41.0 48-49 37.48775 39.0 35.0 41.0 33.0 41.0 50-51 36.871 38.0 34.5 40.0 32.0 40.5 52-53 36.75425 38.0 35.0 40.0 32.5 41.0 54-55 36.98025 37.5 35.0 40.5 33.0 41.0 56-57 36.911249999999995 37.0 35.0 41.0 33.0 41.0 58-59 36.776375 37.0 35.0 40.0 33.0 41.0 60-61 36.43 36.0 35.0 40.0 33.0 41.0 62-63 36.195125000000004 35.0 35.0 39.5 32.5 41.0 64-65 35.883624999999995 35.0 35.0 39.0 32.0 41.0 66-67 35.60675 35.0 35.0 38.5 31.5 41.0 68-69 35.327124999999995 35.0 34.5 37.5 31.5 40.5 70-71 34.99375 35.0 34.0 37.0 31.0 39.5 72-73 34.689375 35.0 34.0 36.5 31.0 39.0 74-75 34.464124999999996 35.0 34.0 36.0 30.5 39.0 76-77 34.19225 35.0 34.0 35.5 30.5 37.5 78-79 34.018875 35.0 34.0 35.0 30.5 37.0 80-81 33.752250000000004 35.0 33.5 35.0 29.5 36.5 82-83 33.533249999999995 35.0 33.0 35.0 29.0 36.0 84-85 33.368375 35.0 33.0 35.0 29.0 36.0 86-87 33.093500000000006 35.0 33.0 35.0 29.0 35.5 88-89 32.926625 35.0 33.0 35.0 29.0 35.0 90-91 32.693 35.0 33.0 35.0 28.0 35.0 92-93 32.406375 35.0 33.0 35.0 27.0 35.0 94-95 32.14025 35.0 32.5 35.0 27.0 35.0 96-97 31.66575 34.5 32.0 35.0 25.0 35.0 98-99 31.289625 34.0 31.5 35.0 24.5 35.0 100 30.8835 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.04292758629321014 1101 2 0.30551175189606994 1101 3 0.22744111536632516 1101 4 0.19497634602387848 1101 5 0.17060899602012114 1101 6 0.13042226727741735 1101 7 0.09639308152486592 1101 8 0.03491777427348808 1101 9 0.12282546118996152 1101 10-11 0.28197667142249827 1101 12-13 0.2777402317839375 1101 14-15 0.37371404971089817 1101 16-17 0.21858026081950044 1101 18-19 0.2272220970689034 1101 20-21 0.21433756351530775 1101 22-23 0.20469450076343776 1101 24-25 0.15845660934645167 1101 26-27 0.21321118370003234 1101 28-29 0.21122124602638337 1101 30-31 0.16288077895421793 1101 32-33 0.2546744762333901 1101 34-35 0.24736552276539214 1101 36-37 0.29102525593852135 1101 38-39 0.41156666916972995 1101 40-41 0.3574128307176281 1101 42-43 0.21244774849189696 1101 44-45 0.09163099797251562 1101 46-47 -0.014724287251880241 1101 48-49 0.16473930564941952 1101 50-51 0.16385697479412897 1101 52-53 0.17162899551951227 1101 54-55 -0.011126129508646443 1101 56-57 -0.10902105078721291 1101 58-59 0.2067595304247689 1101 60-61 0.2230294610898369 1101 62-63 0.16453906034892896 1101 64-65 0.08417186052914616 1101 66-67 0.32760756927235946 1101 68-69 0.22218467622838034 1101 70-71 0.22338614803133794 1101 72-73 0.07507321468799688 1101 74-75 0.18845585842657187 1101 76-77 0.17824334810142517 1101 78-79 0.20459437811318537 1101 80-81 0.3331956646892422 1101 82-83 0.09944682235738611 1101 84-85 -0.1228817801807196 1101 86-87 0.06437886410853366 1101 88-89 0.22404320292358193 1101 90-91 0.13987134239443577 1101 92-93 0.08200670821756972 1101 94-95 0.26037520963179617 1101 96-97 -0.041619734174361156 1101 98-99 0.28186403344096433 1101 100 0.1566919476358528 1104 1 -0.04292758629321014 1104 2 -0.30551175189607704 1104 3 -0.22744111536632516 1104 4 -0.19497634602388558 1104 5 -0.17060899602012825 1104 6 -0.13042226727741735 1104 7 -0.09639308152486592 1104 8 -0.03491777427348097 1104 9 -0.12282546118995441 1104 10-11 -0.28197667142249117 1104 12-13 -0.27774023178393037 1104 14-15 -0.37371404971089817 1104 16-17 -0.21858026081950044 1104 18-19 -0.2272220970689105 1104 20-21 -0.21433756351530775 1104 22-23 -0.20469450076343065 1104 24-25 -0.15845660934645167 1104 26-27 -0.21321118370003234 1104 28-29 -0.21122124602638337 1104 30-31 -0.16288077895421793 1104 32-33 -0.254674476233383 1104 34-35 -0.24736552276539214 1104 36-37 -0.29102525593852846 1104 38-39 -0.41156666916972995 1104 40-41 -0.3574128307176281 1104 42-43 -0.21244774849190406 1104 44-45 -0.09163099797251562 1104 46-47 0.014724287251887347 1104 48-49 -0.16473930564941952 1104 50-51 -0.16385697479412187 1104 52-53 -0.17162899551951227 1104 54-55 0.011126129508646443 1104 56-57 0.10902105078721291 1104 58-59 -0.2067595304247689 1104 60-61 -0.2230294610898369 1104 62-63 -0.16453906034892896 1104 64-65 -0.08417186052915326 1104 66-67 -0.32760756927235946 1104 68-69 -0.22218467622838034 1104 70-71 -0.22338614803133794 1104 72-73 -0.07507321468798978 1104 74-75 -0.18845585842657187 1104 76-77 -0.17824334810143228 1104 78-79 -0.20459437811318537 1104 80-81 -0.3331956646892422 1104 82-83 -0.09944682235738611 1104 84-85 0.12288178018072671 1104 86-87 -0.06437886410853366 1104 88-89 -0.22404320292358193 1104 90-91 -0.13987134239442867 1104 92-93 -0.08200670821756262 1104 94-95 -0.26037520963179617 1104 96-97 0.041619734174361156 1104 98-99 -0.2818640334409679 1104 100 -0.15669194763585637 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 16.0 28 30.0 29 60.0 30 58.0 31 94.0 32 136.0 33 173.0 34 249.0 35 465.0 36 799.0 37 893.0 38 870.0 39 155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.825 8.649999999999999 14.325 48.199999999999996 2 26.625 18.025 29.9 25.45 3 27.125 21.6 22.25 29.025000000000002 4 30.875000000000004 26.1 15.45 27.575 5 29.675 29.525000000000002 18.05 22.75 6 23.525 31.474999999999998 19.375 25.624999999999996 7 20.925 12.45 38.675 27.950000000000003 8 22.8 18.3 23.45 35.449999999999996 9 23.75 18.7 28.349999999999998 29.2 10-11 27.708281210908183 26.019514635976982 18.4013009757318 27.87090317738304 12-13 26.224999999999998 20.5625 24.349999999999998 28.8625 14-15 25.412499999999998 22.9625 23.7125 27.9125 16-17 27.400000000000002 22.925 22.4375 27.237499999999997 18-19 25.75 22.6875 23.0875 28.475 20-21 26.6625 23.525 22.6125 27.200000000000003 22-23 27.0875 22.75 22.8625 27.3 24-25 26.1 23.1125 22.3375 28.449999999999996 26-27 27.237499999999997 23.2125 22.55 27.0 28-29 27.712500000000002 22.175 22.5125 27.6 30-31 25.587500000000002 23.0 23.025000000000002 28.3875 32-33 26.974999999999998 22.425 22.900000000000002 27.700000000000003 34-35 26.2875 22.900000000000002 22.35 28.462500000000002 36-37 26.337500000000002 22.650000000000002 22.575 28.4375 38-39 26.0125 23.2625 23.0 27.725 40-41 26.674999999999997 23.474999999999998 21.1625 28.6875 42-43 26.325 23.0125 22.7125 27.950000000000003 44-45 27.224999999999998 23.9 21.85 27.025 46-47 27.237499999999997 23.0 22.55 27.212500000000002 48-49 27.1125 23.1625 22.1375 27.5875 50-51 27.250000000000004 23.4875 22.05 27.212500000000002 52-53 26.487500000000004 23.1125 22.475 27.925 54-55 25.724999999999998 23.849999999999998 22.6 27.825 56-57 27.400000000000002 22.775000000000002 22.3375 27.487499999999997 58-59 27.224999999999998 23.1125 21.525 28.1375 60-61 26.387500000000003 23.2625 22.525000000000002 27.825 62-63 25.874999999999996 23.6125 23.674999999999997 26.8375 64-65 27.6375 21.7375 23.0875 27.537499999999998 66-67 26.625 22.5625 23.3125 27.500000000000004 68-69 26.1125 23.1875 22.6875 28.012500000000003 70-71 27.6875 21.45 23.225 27.6375 72-73 27.237499999999997 21.6625 23.3125 27.787499999999998 74-75 27.375 23.1 22.900000000000002 26.625 76-77 27.487499999999997 23.0 22.0125 27.500000000000004 78-79 26.0375 23.150000000000002 23.075000000000003 27.737499999999997 80-81 26.7125 24.3 22.425 26.5625 82-83 28.537499999999998 23.275000000000002 21.6625 26.525 84-85 27.525 22.975 22.112499999999997 27.3875 86-87 26.8375 23.7 22.3 27.1625 88-89 27.575 22.8375 22.0875 27.500000000000004 90-91 28.249999999999996 22.55 22.2 27.0 92-93 26.5 23.175 22.6 27.725 94-95 28.799999999999997 21.9 21.7875 27.5125 96-97 27.775 23.0625 22.662499999999998 26.5 98-99 28.799999999999997 21.8625 22.912499999999998 26.424999999999997 100 28.125 22.6 21.625 27.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 2.5 30 4.5 31 5.5 32 7.0 33 11.5 34 16.5 35 20.5 36 23.0 37 37.5 38 49.5 39 56.5 40 77.5 41 87.0 42 107.0 43 140.5 44 142.0 45 135.5 46 131.0 47 120.0 48 120.5 49 117.5 50 120.5 51 121.5 52 111.0 53 107.0 54 99.0 55 92.5 56 92.5 57 99.0 58 104.0 59 116.5 60 131.0 61 125.0 62 123.5 63 119.0 64 110.0 65 108.0 66 93.5 67 99.0 68 102.0 69 86.5 70 76.5 71 72.5 72 62.0 73 46.5 74 43.5 75 38.0 76 27.0 77 17.0 78 14.0 79 12.0 80 8.0 81 5.0 82 3.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.075 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.86133603238866 97.675 2 1.0627530364372468 2.1 3 0.07591093117408906 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88 0.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560263 spots for SRR8618227.sra Written 560263 spots for SRR8618227.sra Read 560274 spots for SRR8618227.sra Written 560274 spots for SRR8618227.sra SRR ids: ['SRR8618227.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qdpgqll0 SRR8618227.sra spots: 11205271 blocks: [[1, 560263], [560264, 1120526], [1120527, 1680789], [1680790, 2241052], [2241053, 2801315], [2801316, 3361578], [3361579, 3921841], [3921842, 4482104], [4482105, 5042367], [5042368, 5602630], [5602631, 6162893], [6162894, 6723156], [6723157, 7283419], [7283420, 7843682], [7843683, 8403945], [8403946, 8964208], [8964209, 9524471], [9524472, 10084734], [10084735, 10644997], [10644998, 11205271]] SRR8618227 file size 2916127 SRR8618227 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618227 SRR8618227_1.fastq SRR8618227_2.fastq Input file: SRR8618227_1.fastq Paired file: SRR8618227_2.fastq trimmed: SRR8618227-trimmed-pair1.fastq, SRR8618227-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 07:58:10 2024 >> started Sat Dec 7 07:58:21 2024 >> done (10.519s) 11205271 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11205271 (100.00%) read pairs available; of these: 1482597 (13.23%) trimmed read pairs available after processing 9722674 (86.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 6 0.00% 82 33 0.00% 83 91 0.00% 84 6140 0.05% 85 6554 0.06% 86 7120 0.06% 87 8054 0.07% 88 9653 0.09% 89 12204 0.11% 90 19461 0.17% 91 35312 0.32% 92 48775 0.44% 93 68229 0.61% 94 92655 0.83% 95 116777 1.04% 96 154857 1.38% 97 209613 1.87% 98 294240 2.63% 99 392823 3.51% 100 9722674 86.77% 11205271 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=25 prefix-density=0.40 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=29 fanout-score=8.47 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=4.8 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=30 fanout-score=8.31 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.7 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618227 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 07:58:49 Started mapping on | Dec 07 07:58:49 Finished on | Dec 07 07:59:17 Mapping speed, Million of reads per hour | 1440.68 Number of input reads | 11205271 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10982673 Uniquely mapped reads % | 98.01% Average mapped length | 198.30 Number of splices: Total | 6699915 Number of splices: Annotated (sjdb) | 6383897 Number of splices: GT/AG | 6609160 Number of splices: GC/AG | 75751 Number of splices: AT/AC | 1843 Number of splices: Non-canonical | 13161 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 90713 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 6620 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 131885 131885 131885 N_multimapping 90713 90713 90713 N_noFeature 222736 5476770 5523816 N_ambiguous 245354 20314 21894 UnstrandedReadsAssigned:10514583 PositiveStrandReadsAssigned:5485589 NegativeStrandReadsAssigned:5436963 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618227 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618227-trimmed-pair1.fastq SRR8618227-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,205,271 reads, 10,722,719 reads pseudoaligned [quant] estimated average fragment length: 161.151 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52973 SRR8618227.ke.tsv 35125 SRR8618227.se.tsv 88098 total ==> SRR8618227.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 776.049 0 0 PNS24247 1044 883.849 13.8812 1.99561 PNS24249 1928 1767.85 61.9827 4.45505 PNS24246 1044 883.849 13.8812 1.99561 PNS24248 1044 883.849 13.8812 1.99561 PNS24244 1471 1310.85 8.37376 0.811699 PNS24243 293 138.679 2 1.83251 KQK14069 1603 1442.85 1905.17 167.78 KQK14071 474 315.173 152.774 61.5925 ==> SRR8618227.se.tsv <== BRADI_1g14170v3 2191 BRADI_1g53295v3 103 BRADI_1g59795v3 151 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 170 BRADI_1g74790v3 33 BRADI_1g09890v3 0 BRADI_1g77505v3 139 BRADI_1g48960v3 0 SRR8618227 completed mapping pipeline successfully