Starting /dee2/code/volunteer_pipeline.sh SRR8618228 current disk space = 1544490045440 free memory = 1600744216 SRR8618228 SRAfilesize 944c4a58701e8bc368a752ed95bb0d28 SRR8618228.sra SRR8618228.sra file validated SRR8618228 is paired end SRR8618228 is conventional basespace SRR8618228 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618228_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.022 34.0 31.0 34.0 31.0 34.0 2 33.199 34.0 33.0 34.0 31.0 34.0 3 33.276 34.0 34.0 34.0 31.0 34.0 4 34.54625 37.0 37.0 37.0 35.0 37.0 5 35.465 37.0 37.0 37.0 35.0 37.0 6 36.1775 37.0 37.0 37.0 35.0 37.0 7 36.23125 37.0 37.0 37.0 35.0 37.0 8 36.4385 37.0 37.0 37.0 35.0 37.0 9 38.36825 39.0 39.0 39.0 37.0 39.0 10-11 38.390125 39.0 39.0 39.0 37.0 39.0 12-13 38.35775 39.0 39.0 39.0 37.0 39.0 14-15 39.953375 41.0 40.0 41.0 38.0 41.0 16-17 39.875875 41.0 40.0 41.0 38.0 41.0 18-19 39.82325 41.0 40.0 41.0 38.0 41.0 20-21 39.706375 41.0 40.0 41.0 37.5 41.0 22-23 39.616125 41.0 39.0 41.0 37.0 41.0 24-25 39.490625 41.0 39.0 41.0 36.5 41.0 26-27 39.325125 40.0 39.0 41.0 36.0 41.0 28-29 39.20325 40.0 38.5 41.0 35.5 41.0 30-31 38.920875 40.0 38.0 41.0 35.0 41.0 32-33 38.891625000000005 40.0 38.0 41.0 35.0 41.0 34-35 39.04175 40.0 38.0 41.0 35.0 41.0 36-37 39.075374999999994 40.0 38.0 41.0 35.0 41.0 38-39 38.999875 40.0 38.0 41.0 35.0 41.0 40-41 38.775999999999996 40.0 38.0 41.0 35.0 41.0 42-43 38.568124999999995 40.0 37.0 41.0 34.5 41.0 44-45 38.35925 40.0 36.5 41.0 34.5 41.0 46-47 38.12225 40.0 35.5 41.0 34.0 41.0 48-49 37.8595 39.0 35.0 41.0 34.0 41.0 50-51 37.637125 39.0 35.0 41.0 33.0 41.0 52-53 37.40175 38.5 35.0 41.0 33.0 41.0 54-55 37.11225 37.5 35.0 41.0 33.0 41.0 56-57 36.8445 37.0 35.0 40.0 33.0 41.0 58-59 36.625875 36.5 35.0 40.0 33.0 41.0 60-61 36.357124999999996 36.0 35.0 40.0 33.0 41.0 62-63 36.06625 35.0 35.0 39.5 32.5 41.0 64-65 35.726875 35.0 34.5 39.0 31.5 41.0 66-67 35.454125000000005 35.0 34.5 38.5 31.5 41.0 68-69 35.13549999999999 35.0 34.0 37.5 31.0 40.0 70-71 34.717124999999996 35.0 34.0 37.0 31.0 39.5 72-73 34.500375000000005 35.0 34.0 36.5 30.5 39.0 74-75 34.211625 35.0 33.0 36.0 30.0 38.5 76-77 33.209999999999994 34.5 32.5 35.0 28.0 37.0 78-79 33.834500000000006 35.0 33.0 35.0 30.0 37.0 80-81 33.752875 35.0 33.0 35.0 30.0 36.5 82-83 33.500125 35.0 33.0 35.0 29.0 36.0 84-85 33.317499999999995 35.0 33.0 35.0 29.0 36.0 86-87 33.170874999999995 35.0 33.0 35.0 29.0 35.0 88-89 32.838750000000005 35.0 33.0 35.0 29.0 35.0 90-91 32.611875 35.0 33.0 35.0 28.0 35.0 92-93 32.384 35.0 33.0 35.0 27.0 35.0 94-95 31.992125 35.0 32.5 35.0 26.0 35.0 96-97 31.71575 34.0 32.0 35.0 25.0 35.0 98-99 31.417125 34.0 32.0 35.0 25.0 35.0 100 31.04675 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.048029556650249106 1101 2 -0.08713054187192171 1101 3 -0.07327586206896086 1101 4 -2.265086206896548 1101 5 -1.1895525451559905 1101 6 -0.45340722495894425 1101 7 -0.3065476190476204 1101 8 -0.0926724137931032 1101 9 -0.08795155993431791 1101 10-11 0.10170361247947568 1101 12-13 0.1120176518883369 1101 14-15 0.11560960591132385 1101 16-17 0.18431855500821115 1101 18-19 0.21228448275861922 1101 20-21 0.1975061576354662 1101 22-23 0.14619252873563937 1101 24-25 0.19884031198686358 1101 26-27 0.40891830870278767 1101 28-29 0.06675903119868565 1101 30-31 0.001539408866996439 1101 32-33 0.17420977011494188 1101 34-35 0.23937807881772954 1101 36-37 0.07743226600985764 1101 38-39 0.4199507389162562 1101 40-41 0.20848727422003321 1101 42-43 0.10139573070608066 1101 44-45 0.28981937602627994 1101 46-47 0.1900656814449917 1101 48-49 -0.06460385878489916 1101 50-51 0.09133825944170582 1101 52-53 0.2747331691297177 1101 54-55 0.2609811165845599 1101 56-57 0.29048645320197153 1101 58-59 0.14455049261083985 1101 60-61 0.3488813628899834 1101 62-63 0.38536535303776276 1101 64-65 0.32363505747127164 1101 66-67 0.5299671592775042 1101 68-69 0.3155788177339929 1101 70-71 0.20992405582923368 1101 72-73 0.20458743842364413 1101 74-75 0.1628694581280783 1101 76-77 0.277760673234809 1101 78-79 0.2673440065681447 1101 80-81 0.01719006568144721 1101 82-83 0.15886699507389324 1101 84-85 0.22501026272577462 1101 86-87 0.03119868637109846 1101 88-89 -0.03745894909688019 1101 90-91 -0.07958743842365124 1101 92-93 -0.15060550082102253 1101 94-95 -0.1490660919540261 1101 96-97 0.30716338259441756 1101 98-99 0.45012315270935943 1101 100 0.4076354679802954 1103 1 0.048029556650242 1103 2 0.08713054187192171 1103 3 0.07327586206896797 1103 4 2.265086206896555 1103 5 1.1895525451559905 1103 6 0.45340722495895136 1103 7 0.3065476190476204 1103 8 0.0926724137931032 1103 9 0.08795155993431791 1103 10-11 -0.10170361247947568 1103 12-13 -0.112017651888344 1103 14-15 -0.11560960591133096 1103 16-17 -0.18431855500820404 1103 18-19 -0.21228448275861922 1103 20-21 -0.1975061576354662 1103 22-23 -0.14619252873563227 1103 24-25 -0.19884031198686358 1103 26-27 -0.4089183087027948 1103 28-29 -0.06675903119868565 1103 30-31 -0.001539408866996439 1103 32-33 -0.17420977011494188 1103 34-35 -0.23937807881773665 1103 36-37 -0.07743226600985054 1103 38-39 -0.4199507389162562 1103 40-41 -0.20848727422003321 1103 42-43 -0.10139573070608066 1103 44-45 -0.28981937602627283 1103 46-47 -0.1900656814449917 1103 48-49 0.06460385878489205 1103 50-51 -0.09133825944170582 1103 52-53 -0.2747331691297248 1103 54-55 -0.260981116584567 1103 56-57 -0.29048645320197153 1103 58-59 -0.14455049261083275 1103 60-61 -0.3488813628899834 1103 62-63 -0.38536535303776986 1103 64-65 -0.32363505747126453 1103 66-67 -0.5299671592775042 1103 68-69 -0.3155788177339929 1103 70-71 -0.20992405582922657 1103 72-73 -0.20458743842364413 1103 74-75 -0.1628694581280783 1103 76-77 -0.277760673234809 1103 78-79 -0.2673440065681447 1103 80-81 -0.017190065681440103 1103 82-83 -0.15886699507388613 1103 84-85 -0.22501026272578173 1103 86-87 -0.03119868637109846 1103 88-89 0.03745894909688019 1103 90-91 0.07958743842364413 1103 92-93 0.15060550082101543 1103 94-95 0.14906609195402254 1103 96-97 -0.30716338259441756 1103 98-99 -0.45012315270935943 1103 100 -0.4076354679802954 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 11.0 28 22.0 29 52.0 30 67.0 31 107.0 32 137.0 33 167.0 34 277.0 35 498.0 36 770.0 37 927.0 38 830.0 39 133.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.9 10.100000000000001 14.924999999999999 45.074999999999996 2 26.25 16.875 30.275000000000002 26.6 3 29.125 21.7 21.075 28.1 4 29.861849096705633 26.461211477151963 16.17959617428268 27.497343251859725 5 30.925000000000004 28.749999999999996 18.55 21.775 6 22.76707530647986 31.94896172129097 19.46459844883663 25.819364523392547 7 21.625 14.6 36.325 27.450000000000003 8 22.650000000000002 20.175 24.05 33.125 9 24.25 18.099999999999998 27.85 29.799999999999997 10-11 27.950000000000003 26.025 18.5 27.525 12-13 25.75 20.1875 24.637500000000003 29.425 14-15 26.0 22.675 23.2375 28.0875 16-17 26.887499999999996 22.2125 22.787499999999998 28.1125 18-19 26.625 22.875 23.025000000000002 27.474999999999998 20-21 26.674999999999997 23.0 23.1375 27.187499999999996 22-23 27.187499999999996 22.5125 23.275000000000002 27.025 24-25 26.474999999999998 23.0625 22.4875 27.975 26-27 26.787499999999998 23.175 22.3125 27.725 28-29 27.237499999999997 22.4375 22.4625 27.8625 30-31 26.375 23.025000000000002 22.1875 28.4125 32-33 26.9125 22.875 22.75 27.462500000000002 34-35 26.724999999999998 22.7 22.912499999999998 27.6625 36-37 26.237500000000004 22.912499999999998 22.5125 28.3375 38-39 27.8625 23.425 22.6125 26.1 40-41 27.150000000000002 23.1875 22.662499999999998 27.0 42-43 26.150000000000002 23.1625 22.8375 27.85 44-45 27.237499999999997 22.15 22.9375 27.675 46-47 26.737499999999997 22.3 23.5875 27.375 48-49 27.0625 23.025000000000002 22.7 27.212500000000002 50-51 26.474999999999998 23.075000000000003 23.0125 27.437499999999996 52-53 25.85 22.45 23.1125 28.5875 54-55 26.474999999999998 23.849999999999998 22.175 27.500000000000004 56-57 27.3375 22.900000000000002 22.8875 26.875 58-59 26.575 23.425 21.825 28.175 60-61 27.1625 22.875 22.475 27.487499999999997 62-63 27.3375 22.425 22.8875 27.35 64-65 27.125 22.625 23.3375 26.9125 66-67 27.3 22.7625 22.55 27.3875 68-69 28.4 22.2625 22.8 26.5375 70-71 27.1375 23.0625 23.05 26.75 72-73 26.687499999999996 22.75 22.900000000000002 27.6625 74-75 27.3 22.8875 23.3 26.5125 76-77 27.762500000000003 22.2 22.3375 27.700000000000003 78-79 26.900000000000002 22.475 22.5 28.125 80-81 28.0625 22.5875 22.525000000000002 26.825 82-83 27.375 22.912499999999998 22.4375 27.275 84-85 26.437500000000004 23.125 22.9625 27.474999999999998 86-87 28.425 22.225 22.3875 26.9625 88-89 27.6875 22.7375 22.425 27.150000000000002 90-91 27.2625 23.0 22.4875 27.250000000000004 92-93 27.825 22.650000000000002 23.225 26.3 94-95 27.875 23.3125 21.0625 27.750000000000004 96-97 27.762500000000003 22.8 22.225 27.212500000000002 98-99 28.65 23.0 22.875 25.474999999999998 100 27.575 21.975 22.725 27.725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 0.0 26 0.5 27 1.0 28 0.5 29 2.0 30 2.5 31 4.0 32 6.5 33 10.5 34 14.0 35 17.0 36 24.5 37 35.0 38 42.5 39 57.5 40 71.5 41 96.0 42 117.0 43 119.5 44 130.0 45 136.5 46 136.5 47 141.0 48 139.5 49 128.5 50 130.0 51 128.5 52 108.0 53 98.5 54 105.0 55 102.0 56 93.5 57 83.0 58 90.5 59 122.0 60 129.5 61 125.5 62 119.5 63 111.0 64 109.5 65 97.0 66 90.5 67 101.0 68 106.0 69 95.5 70 74.5 71 63.0 72 65.5 73 54.5 74 44.5 75 36.0 76 23.5 77 17.5 78 11.5 79 7.5 80 7.5 81 6.5 82 3.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.8999999999999995 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618228 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618228_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.465 34.0 31.0 34.0 31.0 34.0 2 32.96575 34.0 31.0 34.0 31.0 34.0 3 33.01175 34.0 31.0 34.0 31.0 34.0 4 36.4595 37.0 37.0 37.0 35.0 37.0 5 36.51 37.0 37.0 37.0 35.0 37.0 6 36.5325 37.0 37.0 37.0 35.0 37.0 7 36.49225 37.0 37.0 37.0 35.0 37.0 8 36.549 37.0 37.0 37.0 35.0 37.0 9 38.39675 39.0 39.0 39.0 37.0 39.0 10-11 38.351875 39.0 39.0 39.0 37.0 39.0 12-13 38.33925 39.0 39.0 39.0 37.0 39.0 14-15 39.949 41.0 40.0 41.0 38.0 41.0 16-17 39.828125 41.0 40.0 41.0 38.0 41.0 18-19 39.867625000000004 41.0 40.0 41.0 38.0 41.0 20-21 39.875375 41.0 40.0 41.0 38.0 41.0 22-23 39.785375 41.0 40.0 41.0 37.5 41.0 24-25 39.701125 41.0 40.0 41.0 37.0 41.0 26-27 39.602125 41.0 39.5 41.0 37.0 41.0 28-29 39.500375000000005 41.0 39.0 41.0 36.5 41.0 30-31 39.325375 40.5 39.0 41.0 36.0 41.0 32-33 39.229375000000005 40.0 39.0 41.0 35.0 41.0 34-35 39.102000000000004 40.0 38.0 41.0 35.0 41.0 36-37 38.96125 40.0 38.0 41.0 35.0 41.0 38-39 38.777125 40.0 38.0 41.0 35.0 41.0 40-41 38.43075 40.0 37.0 41.0 34.5 41.0 42-43 38.159125 40.0 36.5 41.0 34.0 41.0 44-45 37.8565 39.5 35.5 41.0 33.0 41.0 46-47 37.6515 39.0 35.0 41.0 33.0 41.0 48-49 37.432500000000005 39.0 35.0 41.0 33.0 41.0 50-51 36.955375000000004 38.0 35.0 40.0 32.5 40.5 52-53 36.848 38.0 35.0 40.0 33.0 41.0 54-55 37.025875 37.5 35.0 41.0 33.0 41.0 56-57 36.895375 37.0 35.0 41.0 33.0 41.0 58-59 36.777 37.0 35.0 40.0 33.0 41.0 60-61 36.518375000000006 36.0 35.0 40.0 33.0 41.0 62-63 36.256125 35.5 35.0 39.5 33.0 41.0 64-65 36.001000000000005 35.0 35.0 39.0 32.5 41.0 66-67 35.711625 35.0 35.0 39.0 32.0 41.0 68-69 35.346999999999994 35.0 35.0 37.5 31.5 40.5 70-71 35.028125 35.0 34.0 37.0 31.0 39.5 72-73 34.696749999999994 35.0 34.0 36.5 31.0 39.0 74-75 34.494875 35.0 34.0 36.0 31.0 39.0 76-77 34.333124999999995 35.0 34.0 35.5 31.0 37.0 78-79 34.070875 35.0 34.0 35.0 31.0 37.0 80-81 33.821124999999995 35.0 33.5 35.0 30.0 36.5 82-83 33.593999999999994 35.0 33.0 35.0 29.5 36.0 84-85 33.276125 35.0 33.0 35.0 29.0 36.0 86-87 33.132 35.0 33.0 35.0 29.0 35.5 88-89 32.916624999999996 35.0 33.0 35.0 29.0 35.0 90-91 32.70875 35.0 33.0 35.0 28.0 35.0 92-93 32.452749999999995 35.0 33.0 35.0 28.0 35.0 94-95 32.047125 35.0 32.5 35.0 27.0 35.0 96-97 31.764499999999998 34.5 32.0 35.0 26.0 35.0 98-99 31.327624999999998 34.0 32.0 35.0 24.0 35.0 100 31.164 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.1722085385878529 1101 2 -0.08774630541871886 1101 3 0.021962233169126932 1101 4 0.10745073891625623 1101 5 0.04905582922824436 1101 6 0.1164819376026287 1101 7 0.026990968801314352 1101 8 0.057266009852220634 1101 9 -0.009236453201971528 1101 10-11 0.015188834154351127 1101 12-13 0.061832922824301306 1101 14-15 0.0748152709359573 1101 16-17 -0.046592775041055745 1101 18-19 -0.012058702791463816 1101 20-21 0.058343596059110325 1101 22-23 0.18955254515599052 1101 24-25 0.07004310344827758 1101 26-27 -0.044540229885058125 1101 28-29 0.012777093596064049 1101 30-31 0.15224753694580784 1101 32-33 0.023142446633826808 1101 34-35 -0.108630952380949 1101 36-37 0.022218801313627523 1101 38-39 0.06475779967158957 1101 40-41 0.30690681444991696 1101 42-43 0.37074096880131435 1101 44-45 0.19878899835796204 1101 46-47 0.3826970443349751 1101 48-49 0.4923029556650249 1101 50-51 0.27642651888341874 1101 52-53 0.22716543513956822 1101 54-55 0.27185960591132385 1101 56-57 0.35314039408866904 1101 58-59 0.44663382594416845 1101 60-61 0.3663793103448256 1101 62-63 0.28525246305419216 1101 64-65 0.163536535303777 1101 66-67 0.16050903119868565 1101 68-69 0.15850779967159667 1101 70-71 0.03432881773399288 1101 72-73 0.06855500821018268 1101 74-75 0.056598932676514835 1101 76-77 0.16271551724138078 1101 78-79 0.1460899014778363 1101 80-81 0.14372947454844365 1101 82-83 0.07230090311986714 1101 84-85 -0.004464285714284699 1101 86-87 0.20910303776683037 1101 88-89 0.13372331691297035 1101 90-91 -0.10652709359605694 1101 92-93 0.4295463875205243 1101 94-95 0.1394191297208529 1101 96-97 0.038998357963873076 1101 98-99 0.051518883415436534 1101 100 -0.17549261083743772 1103 1 -0.1722085385878458 1103 2 0.08774630541871886 1103 3 -0.021962233169134038 1103 4 -0.10745073891625623 1103 5 -0.04905582922823726 1103 6 -0.1164819376026287 1103 7 -0.026990968801314352 1103 8 -0.05726600985221353 1103 9 0.009236453201971528 1103 10-11 -0.015188834154351127 1103 12-13 -0.061832922824301306 1103 14-15 -0.0748152709359644 1103 16-17 0.04659277504104864 1103 18-19 0.01205870279145671 1103 20-21 -0.058343596059110325 1103 22-23 -0.18955254515599052 1103 24-25 -0.07004310344827758 1103 26-27 0.044540229885058125 1103 28-29 -0.012777093596056943 1103 30-31 -0.15224753694580784 1103 32-33 -0.023142446633826808 1103 34-35 0.108630952380949 1103 36-37 -0.022218801313627523 1103 38-39 -0.06475779967159667 1103 40-41 -0.30690681444992407 1103 42-43 -0.37074096880131435 1103 44-45 -0.19878899835796204 1103 46-47 -0.3826970443349751 1103 48-49 -0.4923029556650249 1103 50-51 -0.27642651888341163 1103 52-53 -0.22716543513957532 1103 54-55 -0.27185960591133096 1103 56-57 -0.35314039408866904 1103 58-59 -0.44663382594417556 1103 60-61 -0.3663793103448256 1103 62-63 -0.28525246305419216 1103 64-65 -0.163536535303777 1103 66-67 -0.16050903119868565 1103 68-69 -0.15850779967159667 1103 70-71 -0.03432881773399288 1103 72-73 -0.06855500821018268 1103 74-75 -0.056598932676514835 1103 76-77 -0.16271551724138078 1103 78-79 -0.1460899014778292 1103 80-81 -0.14372947454843654 1103 82-83 -0.07230090311986714 1103 84-85 0.004464285714284699 1103 86-87 -0.20910303776682326 1103 88-89 -0.13372331691297035 1103 90-91 0.10652709359605694 1103 92-93 -0.4295463875205243 1103 94-95 -0.1394191297208529 1103 96-97 -0.03899835796387663 1103 98-99 -0.05151888341543298 1103 100 0.17549261083743772 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 10.0 28 25.0 29 45.0 30 57.0 31 113.0 32 133.0 33 169.0 34 255.0 35 476.0 36 763.0 37 946.0 38 866.0 39 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.150000000000002 9.55 16.425 46.875 2 28.65 16.55 29.099999999999998 25.7 3 28.425 21.75 22.45 27.375 4 29.725 27.224999999999998 15.049999999999999 28.000000000000004 5 30.125 28.775000000000002 19.85 21.25 6 23.200000000000003 33.925 18.224999999999998 24.65 7 21.05 13.65 38.95 26.35 8 22.825 19.625 24.525 33.025 9 23.925 18.55 27.375 30.15 10-11 27.164664664664667 25.913413413413412 19.006506506506508 27.915415415415417 12-13 25.162499999999998 20.575 25.25 29.012500000000003 14-15 26.487500000000004 22.3 23.3625 27.85 16-17 27.1125 21.95 22.900000000000002 28.037499999999998 18-19 26.2125 23.400000000000002 22.85 27.537499999999998 20-21 26.8125 22.125 22.3 28.762500000000003 22-23 26.1625 23.0625 22.875 27.900000000000002 24-25 26.3 22.85 23.3875 27.462500000000002 26-27 26.775 22.175 23.6375 27.4125 28-29 26.8125 21.762500000000003 23.425 28.000000000000004 30-31 26.325 22.7375 22.4625 28.475 32-33 26.35 23.2125 22.975 27.462500000000002 34-35 27.175 22.6875 23.175 26.9625 36-37 26.025 22.900000000000002 22.9375 28.1375 38-39 26.5625 22.9875 22.75 27.700000000000003 40-41 26.787499999999998 22.55 22.1375 28.525 42-43 26.6125 22.925 22.900000000000002 27.5625 44-45 26.5 23.075000000000003 23.275000000000002 27.150000000000002 46-47 27.237499999999997 22.5625 22.15 28.050000000000004 48-49 26.700000000000003 22.1875 23.962500000000002 27.150000000000002 50-51 26.7125 23.2625 22.112499999999997 27.9125 52-53 27.5625 22.9625 22.400000000000002 27.075 54-55 26.7125 22.525000000000002 23.5625 27.200000000000003 56-57 27.0875 23.5 22.1375 27.275 58-59 26.5875 22.912499999999998 22.787499999999998 27.712500000000002 60-61 26.6 23.7625 22.7625 26.875 62-63 26.974999999999998 23.0375 22.975 27.0125 64-65 26.974999999999998 22.7375 22.537499999999998 27.750000000000004 66-67 26.3125 22.675 22.45 28.5625 68-69 27.3875 22.8625 22.825 26.924999999999997 70-71 27.575 22.7 22.3875 27.3375 72-73 27.037499999999998 23.1875 22.9375 26.8375 74-75 27.525 22.8125 22.725 26.937499999999996 76-77 27.325 23.200000000000003 22.05 27.425 78-79 26.775 23.05 23.65 26.525 80-81 27.0625 22.4625 22.2125 28.262500000000003 82-83 27.6375 22.7375 22.4625 27.1625 84-85 27.224999999999998 21.975 23.45 27.35 86-87 28.287499999999998 22.650000000000002 22.125 26.937499999999996 88-89 27.5125 23.05 22.037499999999998 27.400000000000002 90-91 26.8625 22.7625 22.3125 28.0625 92-93 26.950000000000003 23.35 22.15 27.55 94-95 28.299999999999997 22.25 22.825 26.625 96-97 27.437499999999996 22.6875 23.35 26.525 98-99 27.85 23.7875 22.225 26.137500000000003 100 27.725 22.6 22.925 26.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 2.0 28 2.0 29 3.5 30 3.0 31 4.0 32 5.5 33 7.0 34 12.5 35 19.5 36 29.0 37 41.5 38 45.5 39 58.0 40 67.0 41 80.0 42 113.5 43 131.5 44 134.5 45 141.5 46 141.0 47 127.0 48 138.0 49 145.0 50 135.0 51 122.0 52 111.5 53 109.5 54 101.0 55 97.5 56 93.5 57 94.5 58 98.5 59 106.5 60 106.0 61 110.5 62 120.0 63 107.5 64 110.0 65 117.5 66 103.0 67 95.0 68 93.5 69 85.0 70 78.0 71 64.0 72 52.0 73 54.5 74 52.0 75 41.5 76 32.5 77 20.0 78 13.0 79 8.5 80 3.0 81 3.0 82 2.0 83 0.5 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.1 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559347 spots for SRR8618228.sra Written 559347 spots for SRR8618228.sra Read 559353 spots for SRR8618228.sra Written 559353 spots for SRR8618228.sra SRR ids: ['SRR8618228.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3i8bj_ks SRR8618228.sra spots: 11186946 blocks: [[1, 559347], [559348, 1118694], [1118695, 1678041], [1678042, 2237388], [2237389, 2796735], [2796736, 3356082], [3356083, 3915429], [3915430, 4474776], [4474777, 5034123], [5034124, 5593470], [5593471, 6152817], [6152818, 6712164], [6712165, 7271511], [7271512, 7830858], [7830859, 8390205], [8390206, 8949552], [8949553, 9508899], [9508900, 10068246], [10068247, 10627593], [10627594, 11186946]] SRR8618228 file size 2911349 SRR8618228 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618228 SRR8618228_1.fastq SRR8618228_2.fastq Input file: SRR8618228_1.fastq Paired file: SRR8618228_2.fastq trimmed: SRR8618228-trimmed-pair1.fastq, SRR8618228-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:08:17 2024 >> started Sat Dec 7 08:08:30 2024 >> done (12.162s) 11186946 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11186946 (100.00%) read pairs available; of these: 1487912 (13.30%) trimmed read pairs available after processing 9699034 (86.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 7 0.00% 82 31 0.00% 83 84 0.00% 84 6507 0.06% 85 6904 0.06% 86 7389 0.07% 87 8203 0.07% 88 9795 0.09% 89 12232 0.11% 90 20084 0.18% 91 36212 0.32% 92 51150 0.46% 93 69966 0.63% 94 93335 0.83% 95 118201 1.06% 96 154449 1.38% 97 209422 1.87% 98 292715 2.62% 99 391225 3.50% 100 9699034 86.70% 11186946 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=33 prefix-density=0.35 prefix-fanout=2.2 sequence=CGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=32 fanout-score=10.36 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=5.4 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=36 prefix-density=0.33 prefix-fanout=2.2 sequence=CGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=27 fanout-score=11.23 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.7 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618228 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:08:58 Started mapping on | Dec 07 08:08:58 Finished on | Dec 07 08:09:41 Mapping speed, Million of reads per hour | 936.58 Number of input reads | 11186946 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10950608 Uniquely mapped reads % | 97.89% Average mapped length | 198.30 Number of splices: Total | 6590259 Number of splices: Annotated (sjdb) | 6284998 Number of splices: GT/AG | 6499597 Number of splices: GC/AG | 76641 Number of splices: AT/AC | 1942 Number of splices: Non-canonical | 12079 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 98592 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 8641 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.83% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 137746 137746 137746 N_multimapping 98592 98592 98592 N_noFeature 218549 5446267 5518591 N_ambiguous 242416 18750 20536 UnstrandedReadsAssigned:10489643 PositiveStrandReadsAssigned:5485591 NegativeStrandReadsAssigned:5411481 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618228 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618228-trimmed-pair1.fastq SRR8618228-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,186,946 reads, 10,707,488 reads pseudoaligned [quant] estimated average fragment length: 159.769 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR8618228.ke.tsv 35125 SRR8618228.se.tsv 88098 total ==> SRR8618228.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 777.378 3.03961 0.497464 PNS24247 1044 885.231 13.8357 1.98849 PNS24249 1928 1769.23 56.4257 4.0576 PNS24246 1044 885.231 13.8357 1.98849 PNS24248 1044 885.231 13.8357 1.98849 PNS24244 1471 1312.23 13.0275 1.26307 PNS24243 293 139.318 7 6.39245 KQK14069 1603 1444.23 2072.9 182.607 KQK14071 474 316.36 202.331 81.3689 ==> SRR8618228.se.tsv <== BRADI_1g14170v3 2427 BRADI_1g53295v3 113 BRADI_1g59795v3 129 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 224 BRADI_1g74790v3 48 BRADI_1g09890v3 0 BRADI_1g77505v3 108 BRADI_1g48960v3 0 SRR8618228 completed mapping pipeline successfully