Starting /dee2/code/volunteer_pipeline.sh SRR8618229 current disk space = 1544527286272 free memory = 1598347340 SRR8618229 SRAfilesize 508c5e836a577497fd61663337efc594 SRR8618229.sra SRR8618229.sra file validated SRR8618229 is paired end SRR8618229 is conventional basespace SRR8618229 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618229_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98725 34.0 31.0 34.0 31.0 34.0 2 33.1225 34.0 33.0 34.0 31.0 34.0 3 33.22725 34.0 34.0 34.0 31.0 34.0 4 34.7415 37.0 37.0 37.0 35.0 37.0 5 35.57725 37.0 37.0 37.0 35.0 37.0 6 36.208 37.0 37.0 37.0 35.0 37.0 7 36.284 37.0 37.0 37.0 35.0 37.0 8 36.3885 37.0 37.0 37.0 35.0 37.0 9 38.31275 39.0 39.0 39.0 37.0 39.0 10-11 38.294875 39.0 39.0 39.0 37.0 39.0 12-13 38.294250000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.85925 41.0 40.0 41.0 38.0 41.0 16-17 39.804625 41.0 40.0 41.0 38.0 41.0 18-19 39.77925 41.0 40.0 41.0 38.0 41.0 20-21 39.704499999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.6425 41.0 39.5 41.0 37.0 41.0 24-25 39.434875000000005 40.5 39.0 41.0 36.0 41.0 26-27 39.3425 40.0 39.0 41.0 36.0 41.0 28-29 39.179874999999996 40.0 39.0 41.0 36.0 41.0 30-31 38.959125 40.0 38.0 41.0 35.0 41.0 32-33 38.893625 40.0 38.0 41.0 35.0 41.0 34-35 39.160250000000005 40.0 38.5 41.0 35.0 41.0 36-37 39.10275 40.0 38.0 41.0 35.0 41.0 38-39 39.049499999999995 40.0 38.0 41.0 35.0 41.0 40-41 38.931124999999994 40.0 38.0 41.0 35.0 41.0 42-43 38.6845 40.0 37.5 41.0 35.0 41.0 44-45 38.540375 40.0 37.0 41.0 35.0 41.0 46-47 38.26475 40.0 36.0 41.0 34.0 41.0 48-49 38.052875 40.0 35.5 41.0 33.5 41.0 50-51 37.83575 39.0 35.0 41.0 33.0 41.0 52-53 37.64775 39.0 35.0 41.0 33.0 41.0 54-55 37.346000000000004 38.5 35.0 41.0 33.0 41.0 56-57 37.14475 38.0 35.0 41.0 33.0 41.0 58-59 36.8425 37.0 35.0 40.5 33.0 41.0 60-61 36.593125 37.0 35.0 40.0 32.5 41.0 62-63 36.2625 36.0 35.0 40.0 32.0 41.0 64-65 36.02075 35.5 35.0 39.0 31.5 41.0 66-67 35.711749999999995 35.0 34.5 39.0 32.0 41.0 68-69 35.2945 35.0 34.0 38.5 31.0 40.0 70-71 34.702375 35.0 34.0 37.0 30.0 39.5 72-73 34.608999999999995 35.0 34.0 37.0 30.5 39.0 74-75 34.2685 35.0 34.0 36.0 30.0 39.0 76-77 33.327375 34.5 32.5 35.0 28.0 37.0 78-79 33.86 35.0 33.0 35.0 30.0 37.0 80-81 33.781125 35.0 33.0 35.0 30.0 37.0 82-83 33.465375 35.0 33.0 35.0 29.0 36.0 84-85 33.398625 35.0 33.0 35.0 29.5 36.0 86-87 33.2345 35.0 33.0 35.0 29.0 36.0 88-89 33.027625 35.0 33.0 35.0 29.0 35.0 90-91 32.841375 35.0 33.0 35.0 29.0 35.0 92-93 32.523 35.0 33.0 35.0 27.0 35.0 94-95 32.427 35.0 33.0 35.0 27.0 35.0 96-97 32.084125 35.0 33.0 35.0 27.0 35.0 98-99 31.622124999999997 35.0 32.0 35.0 25.0 35.0 100 31.28475 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.011955386926743472 1101 2 0.11547961600162893 1101 3 0.07775457716890344 1101 4 -1.2428509587227197 1101 5 -0.5946118000560219 1101 6 -0.13670392910799478 1101 7 -0.15238980418120462 1101 8 -0.12804614091823652 1101 9 0.09067759924626273 1101 10-11 -0.001050393420086948 1101 12-13 0.012916656056631837 1101 14-15 0.09282931425224206 1101 16-17 0.1273076825138162 1101 18-19 0.05745970308879578 1101 20-21 0.004532606758168356 1101 22-23 0.029385551679354194 1101 24-25 -0.0480889205775199 1101 26-27 -0.05432762089073151 1101 28-29 0.10947645845535448 1101 30-31 -0.12272414758982109 1101 32-33 -0.033568027297498304 1101 34-35 0.05201675536655159 1101 36-37 0.19901453999134588 1101 38-39 0.17268467826131229 1101 40-41 0.16787833261185625 1101 42-43 0.1132706068091025 1101 44-45 0.1444704743958667 1101 46-47 0.14664128746402838 1101 48-49 0.040405133559112016 1101 50-51 0.1971556619388366 1101 52-53 0.2468169896361161 1101 54-55 0.022631203687204504 1101 56-57 -0.04651651345777452 1101 58-59 -0.07908507550100552 1101 60-61 -0.01596597998523208 1101 62-63 -0.14296172748338876 1101 64-65 -0.2026113417025286 1101 66-67 -0.025330396475766292 1101 68-69 0.011344248936879353 1101 70-71 0.4206093555040624 1101 72-73 0.07503628631814507 1101 74-75 0.17137964401212002 1101 76-77 0.0035649716075454307 1101 78-79 0.06789997708232676 1101 80-81 -0.06181406126658828 1101 82-83 0.24985358152326143 1101 84-85 0.1628746403198349 1101 86-87 0.07075195436836168 1101 88-89 0.2409920806702175 1101 90-91 0.19795141452980403 1101 92-93 0.09864785719742031 1101 94-95 0.0920526597234641 1101 96-97 -0.021988235593696004 1101 98-99 -0.07622673219423959 1101 100 0.15515265717705162 1103 1 0.011955386926736367 1103 2 -0.11547961600162893 1103 3 -0.07775457716890344 1103 4 1.2428509587227197 1103 5 0.5946118000560219 1103 6 0.13670392910799478 1103 7 0.15238980418120462 1103 8 0.1280461409182294 1103 9 -0.09067759924626273 1103 10-11 0.0010503934200798426 1103 12-13 -0.012916656056631837 1103 14-15 -0.09282931425224916 1103 16-17 -0.1273076825138162 1103 18-19 -0.05745970308878867 1103 20-21 -0.004532606758168356 1103 22-23 -0.0293855516793613 1103 24-25 0.048088920577527006 1103 26-27 0.05432762089073151 1103 28-29 -0.10947645845534737 1103 30-31 0.12272414758982109 1103 32-33 0.033568027297498304 1103 34-35 -0.05201675536655159 1103 36-37 -0.19901453999133878 1103 38-39 -0.17268467826131229 1103 40-41 -0.16787833261184915 1103 42-43 -0.1132706068090954 1103 44-45 -0.14447047439585958 1103 46-47 -0.14664128746403549 1103 48-49 -0.040405133559112016 1103 50-51 -0.1971556619388366 1103 52-53 -0.2468169896361232 1103 54-55 -0.0226312036871974 1103 56-57 0.04651651345776742 1103 58-59 0.07908507550100552 1103 60-61 0.01596597998523208 1103 62-63 0.14296172748338876 1103 64-65 0.2026113417025286 1103 66-67 0.025330396475773398 1103 68-69 -0.011344248936872248 1103 70-71 -0.4206093555040624 1103 72-73 -0.07503628631814507 1103 74-75 -0.17137964401212002 1103 76-77 -0.0035649716075454307 1103 78-79 -0.06789997708232676 1103 80-81 0.06181406126658118 1103 82-83 -0.24985358152326143 1103 84-85 -0.1628746403198278 1103 86-87 -0.07075195436836168 1103 88-89 -0.24099208067021038 1103 90-91 -0.19795141452980403 1103 92-93 -0.09864785719742031 1103 94-95 -0.0920526597234641 1103 96-97 0.02198823559369245 1103 98-99 0.07622673219423959 1103 100 -0.15515265717705162 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 12.0 28 31.0 29 45.0 30 71.0 31 95.0 32 149.0 33 153.0 34 259.0 35 453.0 36 664.0 37 965.0 38 957.0 39 143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.45 11.1 14.674999999999999 44.775 2 25.124999999999996 18.275 30.5 26.1 3 26.525 23.849999999999998 21.975 27.650000000000002 4 28.3148441627047 27.971473851030108 17.27416798732171 26.439513998943475 5 29.575000000000003 30.7 18.625 21.099999999999998 6 22.26113056528264 34.06703351675838 20.01000500250125 23.66183091545773 7 20.125 14.774999999999999 38.05 27.05 8 22.075 20.125 25.4 32.4 9 23.575 20.025000000000002 27.750000000000004 28.65 10-11 27.625 26.9625 18.637500000000003 26.775 12-13 24.275 21.45 26.025 28.249999999999996 14-15 25.374999999999996 23.8625 24.587500000000002 26.174999999999997 16-17 26.637499999999996 23.4625 22.675 27.224999999999998 18-19 26.400000000000002 23.9375 22.8375 26.825 20-21 25.45 24.0125 24.3125 26.224999999999998 22-23 26.7125 23.0625 23.7375 26.487500000000004 24-25 26.237500000000004 23.849999999999998 23.375 26.5375 26-27 26.625 23.425 22.9625 26.987499999999997 28-29 26.2625 23.7125 22.9625 27.0625 30-31 26.0375 23.25 24.087500000000002 26.625 32-33 25.7375 24.2875 24.762500000000003 25.2125 34-35 26.75 23.1625 23.4625 26.625 36-37 25.7 23.3125 23.325000000000003 27.6625 38-39 26.0375 23.7375 23.1125 27.1125 40-41 26.8 24.6625 22.4625 26.075 42-43 25.2125 24.5375 23.5375 26.7125 44-45 26.2625 23.799999999999997 23.549999999999997 26.387500000000003 46-47 26.125 23.5375 23.4875 26.85 48-49 26.137500000000003 23.474999999999998 23.474999999999998 26.9125 50-51 26.224999999999998 23.525 23.3375 26.9125 52-53 26.0625 23.3875 24.1875 26.3625 54-55 25.4375 24.087500000000002 23.425 27.05 56-57 26.7625 23.7625 23.7375 25.7375 58-59 25.424999999999997 23.3875 23.525 27.6625 60-61 26.224999999999998 24.375 23.8375 25.5625 62-63 25.662499999999998 23.3625 24.325 26.650000000000002 64-65 26.075 24.087500000000002 23.5625 26.275 66-67 25.424999999999997 23.4625 24.275 26.8375 68-69 26.224999999999998 23.45 23.8625 26.4625 70-71 27.2625 22.5625 23.724999999999998 26.450000000000003 72-73 26.1 23.2375 23.4875 27.175 74-75 26.375 23.75 23.9375 25.937500000000004 76-77 26.674999999999997 23.7875 22.900000000000002 26.637499999999996 78-79 27.025 23.2125 22.9625 26.8 80-81 26.3 24.3875 22.912499999999998 26.400000000000002 82-83 26.9125 22.875 23.775 26.437500000000004 84-85 26.025 23.2375 24.0375 26.700000000000003 86-87 26.650000000000002 23.599999999999998 24.3 25.45 88-89 26.6625 23.1875 24.0 26.150000000000002 90-91 26.3 23.7375 23.599999999999998 26.3625 92-93 26.337500000000002 23.674999999999997 23.9875 26.0 94-95 26.650000000000002 23.175 23.525 26.650000000000002 96-97 26.0125 23.35 24.1125 26.525 98-99 27.025 24.325 23.799999999999997 24.85 100 27.6 23.05 23.400000000000002 25.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 1.5 27 0.0 28 0.5 29 3.5 30 5.5 31 8.0 32 9.0 33 10.5 34 17.5 35 25.5 36 30.5 37 43.5 38 55.5 39 75.0 40 95.0 41 103.0 42 127.5 43 139.0 44 140.0 45 159.0 46 163.5 47 155.5 48 155.0 49 157.5 50 141.0 51 121.5 52 123.0 53 116.5 54 106.0 55 96.5 56 88.0 57 100.5 58 111.5 59 106.5 60 101.5 61 102.5 62 111.0 63 102.5 64 102.5 65 95.5 66 74.0 67 71.5 68 71.0 69 61.5 70 53.0 71 54.0 72 48.0 73 42.0 74 33.5 75 22.5 76 19.5 77 13.5 78 9.0 79 7.5 80 3.0 81 1.0 82 2.5 83 2.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.35 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618229 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618229_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.01975 33.0 31.0 34.0 31.0 34.0 2 32.80075 34.0 31.0 34.0 31.0 34.0 3 32.9765 34.0 31.0 34.0 31.0 34.0 4 36.431 37.0 37.0 37.0 35.0 37.0 5 36.42475 37.0 37.0 37.0 35.0 37.0 6 36.4665 37.0 37.0 37.0 35.0 37.0 7 36.4735 37.0 37.0 37.0 35.0 37.0 8 36.504 37.0 37.0 37.0 35.0 37.0 9 38.33925 39.0 39.0 39.0 37.0 39.0 10-11 38.245000000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.208375000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.78875 41.0 40.0 41.0 37.5 41.0 16-17 39.752125 41.0 40.0 41.0 38.0 41.0 18-19 39.75 41.0 40.0 41.0 37.0 41.0 20-21 39.720625 41.0 40.0 41.0 37.5 41.0 22-23 39.651624999999996 41.0 39.5 41.0 37.0 41.0 24-25 39.6065 41.0 39.0 41.0 37.0 41.0 26-27 39.452124999999995 41.0 39.0 41.0 36.0 41.0 28-29 39.332499999999996 41.0 39.0 41.0 36.0 41.0 30-31 39.211375000000004 40.0 38.5 41.0 35.5 41.0 32-33 39.163 40.0 38.5 41.0 35.0 41.0 34-35 38.9945 40.0 38.0 41.0 35.0 41.0 36-37 38.84625 40.0 38.0 41.0 35.0 41.0 38-39 38.74325 40.0 38.0 41.0 35.0 41.0 40-41 38.429125 40.0 37.0 41.0 34.0 41.0 42-43 38.278375 40.0 37.0 41.0 34.0 41.0 44-45 37.9715 40.0 36.0 41.0 33.0 41.0 46-47 37.7525 39.0 35.5 41.0 33.0 41.0 48-49 37.653875 39.0 35.0 41.0 33.0 41.0 50-51 37.074625 38.5 35.0 40.0 32.0 40.5 52-53 37.085 38.5 35.0 40.0 33.0 41.0 54-55 37.2485 38.5 35.0 41.0 33.0 41.0 56-57 37.162000000000006 38.0 35.0 41.0 33.0 41.0 58-59 37.033125 37.0 35.0 40.5 33.0 41.0 60-61 36.736875 37.0 35.0 40.0 33.0 41.0 62-63 36.448375 36.0 35.0 40.0 33.0 41.0 64-65 36.267125 36.0 35.0 39.5 32.5 41.0 66-67 35.99425 35.0 35.0 39.0 32.5 41.0 68-69 35.63525 35.0 35.0 39.0 32.0 41.0 70-71 35.2195 35.0 34.5 37.0 31.0 40.0 72-73 34.91475 35.0 34.0 37.0 31.0 39.0 74-75 34.67775 35.0 34.0 36.5 30.5 39.0 76-77 34.427375 35.0 34.0 36.0 30.5 38.5 78-79 34.201750000000004 35.0 34.0 35.5 30.5 37.0 80-81 33.87675 35.0 34.0 35.0 30.0 37.0 82-83 33.694500000000005 35.0 33.0 35.0 30.0 36.5 84-85 33.43075 35.0 33.0 35.0 29.0 36.0 86-87 33.22425 35.0 33.0 35.0 29.0 36.0 88-89 33.028 35.0 33.0 35.0 29.0 35.0 90-91 32.805375 35.0 33.0 35.0 28.0 35.0 92-93 32.48725 35.0 33.0 35.0 27.0 35.0 94-95 32.290499999999994 35.0 32.5 35.0 27.0 35.0 96-97 31.994 35.0 32.0 35.0 27.0 35.0 98-99 31.5825 34.0 32.0 35.0 25.0 35.0 100 31.23825 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.3336431463420837 1101 2 0.0819306867663201 1101 3 0.054951490922057644 1101 4 0.015787731404849126 1101 5 -0.0417356318912212 1101 6 0.008772376562852457 1101 7 0.15205877110335564 1101 8 0.06629573985892989 1101 9 0.11200376868427497 1101 10-11 0.11993583051106782 1101 12-13 0.07086017672073552 1101 14-15 0.14800361589977484 1101 16-17 0.030537801431080425 1101 18-19 0.1084578951389048 1101 20-21 0.20035140434416832 1101 22-23 0.10214280257696373 1101 24-25 0.07510631254615419 1101 26-27 0.26659621603727857 1101 28-29 0.35153803060782707 1101 30-31 0.2543097960327003 1101 32-33 0.2379363907208898 1101 34-35 0.1935588602276468 1101 36-37 0.1436110615976176 1101 38-39 0.04849634590410545 1101 40-41 0.17455628835527648 1101 42-43 -0.08431157851850202 1101 44-45 -0.2945494130528843 1101 46-47 -0.14251610603243847 1101 48-49 -0.009466272822187705 1101 50-51 -0.05358279646559083 1101 52-53 -0.08489088640472886 1101 54-55 -0.01509383514552809 1101 56-57 0.025966998548547338 1101 58-59 -0.04630643477375429 1101 60-61 -0.1776247103460591 1101 62-63 -0.07744264215324392 1101 64-65 0.18160347330091042 1101 66-67 0.03994041404599358 1101 68-69 0.016112398461970656 1101 70-71 -0.17431437956762608 1101 72-73 0.007683787018414989 1101 74-75 -0.02009752743754234 1101 76-77 0.21828448473428352 1101 78-79 0.1386010032848688 1101 80-81 -0.12728221843090637 1101 82-83 -0.16277915000890886 1101 84-85 -0.3688408749458887 1101 86-87 -0.2680794988668467 1101 88-89 -0.23948333375773956 1101 90-91 0.32185327595426827 1101 92-93 0.33993277482111495 1101 94-95 0.5733238267423815 1101 96-97 0.716782103842533 1101 98-99 0.5016297013063067 1101 100 -0.07770364900308024 1103 1 -0.33364314634208725 1103 2 -0.08193068676631299 1103 3 -0.05495149092205054 1103 4 -0.01578773140485623 1103 5 0.0417356318912141 1103 6 -0.008772376562859563 1103 7 -0.15205877110336274 1103 8 -0.06629573985892989 1103 9 -0.11200376868426787 1103 10-11 -0.11993583051106071 1103 12-13 -0.07086017672073552 1103 14-15 -0.14800361589977484 1103 16-17 -0.030537801431080425 1103 18-19 -0.10845789513891191 1103 20-21 -0.20035140434416832 1103 22-23 -0.10214280257696373 1103 24-25 -0.07510631254615419 1103 26-27 -0.26659621603727857 1103 28-29 -0.35153803060782707 1103 30-31 -0.2543097960326932 1103 32-33 -0.23793639072088268 1103 34-35 -0.1935588602276468 1103 36-37 -0.1436110615976176 1103 38-39 -0.04849634590409835 1103 40-41 -0.17455628835527648 1103 42-43 0.08431157851850202 1103 44-45 0.2945494130528914 1103 46-47 0.14251610603243847 1103 48-49 0.009466272822187705 1103 50-51 0.053582796465583726 1103 52-53 0.08489088640472886 1103 54-55 0.01509383514552809 1103 56-57 -0.025966998548547338 1103 58-59 0.046306434773747185 1103 60-61 0.1776247103460591 1103 62-63 0.07744264215324392 1103 64-65 -0.18160347330091042 1103 66-67 -0.03994041404598647 1103 68-69 -0.016112398461970656 1103 70-71 0.17431437956761897 1103 72-73 -0.007683787018407884 1103 74-75 0.020097527437549445 1103 76-77 -0.21828448473428352 1103 78-79 -0.1386010032848617 1103 80-81 0.12728221843089926 1103 82-83 0.16277915000890886 1103 84-85 0.3688408749458887 1103 86-87 0.2680794988668467 1103 88-89 0.23948333375773245 1103 90-91 -0.32185327595426827 1103 92-93 -0.33993277482111495 1103 94-95 -0.5733238267423779 1103 96-97 -0.716782103842533 1103 98-99 -0.5016297013063067 1103 100 0.07770364900308024 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 16.0 28 29.0 29 50.0 30 72.0 31 87.0 32 146.0 33 186.0 34 238.0 35 380.0 36 720.0 37 925.0 38 972.0 39 176.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.65 8.649999999999999 14.475 48.225 2 24.349999999999998 17.95 32.925 24.775 3 27.675 21.85 23.200000000000003 27.275 4 30.099999999999998 27.775 17.325 24.8 5 28.549999999999997 30.775000000000002 20.25 20.424999999999997 6 23.575 31.374999999999996 20.175 24.875 7 19.575 13.525 39.050000000000004 27.85 8 22.925 20.375 23.974999999999998 32.725 9 22.7 18.45 28.025 30.825000000000003 10-11 25.835105717502817 28.800200175153257 18.9415738771425 26.423120230201423 12-13 24.55 21.725 25.887500000000003 27.8375 14-15 25.1 24.0375 23.4375 27.425 16-17 26.237500000000004 24.0125 22.6375 27.1125 18-19 26.637499999999996 23.9875 23.1375 26.237500000000004 20-21 25.637500000000003 24.025 23.674999999999997 26.6625 22-23 26.375 24.0625 23.425 26.137500000000003 24-25 26.0 24.1125 23.325000000000003 26.5625 26-27 25.624999999999996 23.974999999999998 23.4875 26.9125 28-29 26.5125 23.875 23.6125 26.0 30-31 26.150000000000002 24.275 23.5125 26.0625 32-33 25.9875 24.0125 23.799999999999997 26.200000000000003 34-35 26.25 24.4375 22.9375 26.375 36-37 26.3 23.175 23.3125 27.212500000000002 38-39 27.250000000000004 24.2875 22.6875 25.775 40-41 25.974999999999998 23.8625 23.825 26.337500000000002 42-43 26.7125 22.9375 23.549999999999997 26.8 44-45 25.95 23.9125 23.8875 26.25 46-47 26.987499999999997 24.575 22.662499999999998 25.775 48-49 25.874999999999996 23.1375 23.525 27.462500000000002 50-51 25.424999999999997 24.474999999999998 23.35 26.75 52-53 26.787499999999998 23.7875 23.45 25.974999999999998 54-55 25.9875 23.5625 23.3125 27.1375 56-57 26.3 23.65 23.5125 26.5375 58-59 26.325 23.025000000000002 23.95 26.700000000000003 60-61 26.5125 23.6625 24.025 25.8 62-63 25.387500000000003 24.525 24.025 26.0625 64-65 25.137500000000003 24.9125 23.35 26.6 66-67 25.912499999999998 24.325 23.599999999999998 26.1625 68-69 25.374999999999996 24.1625 24.087500000000002 26.375 70-71 26.724999999999998 24.1875 23.525 25.5625 72-73 25.9875 23.150000000000002 24.325 26.5375 74-75 25.224999999999998 23.7625 23.9375 27.075 76-77 26.337500000000002 24.2875 23.7 25.674999999999997 78-79 27.075 23.0625 24.175 25.687500000000004 80-81 26.650000000000002 23.825 23.4875 26.0375 82-83 27.025 23.9125 23.35 25.7125 84-85 26.3 23.724999999999998 23.5 26.474999999999998 86-87 25.9625 24.587500000000002 23.4875 25.9625 88-89 25.95 24.4375 23.525 26.087500000000002 90-91 26.3 24.05 23.674999999999997 25.974999999999998 92-93 26.387500000000003 23.2375 23.8125 26.5625 94-95 27.0125 24.2625 23.2375 25.4875 96-97 26.1 23.6875 23.200000000000003 27.0125 98-99 26.937499999999996 23.0375 24.1625 25.8625 100 26.900000000000002 23.974999999999998 23.974999999999998 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.5 29 3.5 30 3.0 31 5.0 32 9.0 33 13.5 34 19.0 35 29.5 36 46.5 37 50.0 38 58.0 39 82.5 40 98.0 41 110.0 42 127.5 43 145.5 44 149.0 45 144.5 46 158.5 47 161.5 48 154.0 49 140.0 50 135.5 51 125.5 52 112.5 53 116.5 54 110.0 55 99.0 56 90.5 57 100.0 58 110.5 59 110.0 60 100.0 61 91.5 62 89.5 63 94.5 64 95.5 65 84.0 66 82.0 67 83.0 68 75.5 69 66.5 70 56.5 71 52.0 72 44.5 73 32.0 74 29.5 75 26.5 76 20.5 77 18.5 78 12.0 79 7.5 80 6.5 81 5.0 82 3.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.08750000000000001 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.45294413688978363 0.8999999999999999 3 0.10065425264217413 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568809 spots for SRR8618229.sra Written 568809 spots for SRR8618229.sra Read 568814 spots for SRR8618229.sra Written 568814 spots for SRR8618229.sra SRR ids: ['SRR8618229.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_egnggkg_ SRR8618229.sra spots: 11376185 blocks: [[1, 568809], [568810, 1137618], [1137619, 1706427], [1706428, 2275236], [2275237, 2844045], [2844046, 3412854], [3412855, 3981663], [3981664, 4550472], [4550473, 5119281], [5119282, 5688090], [5688091, 6256899], [6256900, 6825708], [6825709, 7394517], [7394518, 7963326], [7963327, 8532135], [8532136, 9100944], [9100945, 9669753], [9669754, 10238562], [10238563, 10807371], [10807372, 11376185]] SRR8618229 file size 2960771 SRR8618229 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618229 SRR8618229_1.fastq SRR8618229_2.fastq Input file: SRR8618229_1.fastq Paired file: SRR8618229_2.fastq trimmed: SRR8618229-trimmed-pair1.fastq, SRR8618229-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:10:55 2024 >> started Sat Dec 7 08:11:05 2024 >> done (10.436s) 11376185 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11376185 (100.00%) read pairs available; of these: 1382846 (12.16%) trimmed read pairs available after processing 9993339 (87.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 78 1 0.00% 79 0 0.00% 80 1 0.00% 81 8 0.00% 82 35 0.00% 83 84 0.00% 84 6176 0.05% 85 6434 0.06% 86 7022 0.06% 87 8110 0.07% 88 9361 0.08% 89 11910 0.10% 90 18188 0.16% 91 31900 0.28% 92 45916 0.40% 93 63074 0.55% 94 84209 0.74% 95 108169 0.95% 96 142310 1.25% 97 194090 1.71% 98 274744 2.42% 99 371104 3.26% 100 9993339 87.84% 11376185 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=16 prefix-density=0.38 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=34 fanout-score=27.57 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=8.3 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=15 prefix-density=0.35 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=33 fanout-score=30.34 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=8.7 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618229 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:11:36 Started mapping on | Dec 07 08:11:36 Finished on | Dec 07 08:12:10 Mapping speed, Million of reads per hour | 1204.54 Number of input reads | 11376185 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11081784 Uniquely mapped reads % | 97.41% Average mapped length | 198.23 Number of splices: Total | 6712674 Number of splices: Annotated (sjdb) | 6392208 Number of splices: GT/AG | 6615828 Number of splices: GC/AG | 76241 Number of splices: AT/AC | 2417 Number of splices: Non-canonical | 18188 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.34 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 131111 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 7859 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 163290 163290 163290 N_multimapping 131111 131111 131111 N_noFeature 263615 5525507 5606763 N_ambiguous 246348 16592 17722 UnstrandedReadsAssigned:10571821 PositiveStrandReadsAssigned:5539685 NegativeStrandReadsAssigned:5457299 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618229 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618229-trimmed-pair1.fastq SRR8618229-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,376,185 reads, 10,808,749 reads pseudoaligned [quant] estimated average fragment length: 158.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52973 SRR8618229.ke.tsv 35125 SRR8618229.se.tsv 88098 total ==> SRR8618229.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 778.785 0 0 PNS24247 1044 886.726 16.5429 2.36729 PNS24249 1928 1770.73 81.1228 5.81326 PNS24246 1044 886.726 16.5429 2.36729 PNS24248 1044 886.726 16.5429 2.36729 PNS24244 1471 1313.73 59.2484 5.72269 PNS24243 293 139.87 1 0.9072 KQK14069 1603 1445.73 4568.9 401.009 KQK14071 474 317.686 317.483 126.809 ==> SRR8618229.se.tsv <== BRADI_1g14170v3 5139 BRADI_1g53295v3 134 BRADI_1g59795v3 217 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 1499 BRADI_1g74790v3 44 BRADI_1g09890v3 4 BRADI_1g77505v3 139 BRADI_1g48960v3 0 SRR8618229 completed mapping pipeline successfully