Starting /dee2/code/volunteer_pipeline.sh SRR8618230 current disk space = 1544509198336 free memory = 1601632980 SRR8618230 SRAfilesize 5665db3b66b3171da37dca34ed3c10be SRR8618230.sra SRR8618230.sra file validated SRR8618230 is paired end SRR8618230 is conventional basespace SRR8618230 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618230_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.47975 33.0 31.0 34.0 2.0 34.0 2 30.195 34.0 31.0 34.0 16.0 34.0 3 32.14825 34.0 31.0 34.0 28.0 34.0 4 36.23275 37.0 35.0 37.0 35.0 37.0 5 36.17475 37.0 35.0 37.0 35.0 37.0 6 36.368 37.0 37.0 37.0 35.0 37.0 7 36.38625 37.0 37.0 37.0 35.0 37.0 8 36.3595 37.0 37.0 37.0 35.0 37.0 9 38.13475 39.0 38.0 39.0 37.0 39.0 10-11 38.1965 39.0 38.5 39.0 37.0 39.0 12-13 38.166125 39.0 38.0 39.0 37.0 39.0 14-15 39.57925 41.0 39.0 41.0 37.0 41.0 16-17 39.501374999999996 40.5 39.0 41.0 37.0 41.0 18-19 39.478875 40.0 39.0 41.0 37.0 41.0 20-21 39.36 40.0 39.0 41.0 36.5 41.0 22-23 39.327124999999995 40.0 39.0 41.0 36.0 41.0 24-25 39.26325 40.0 39.0 41.0 36.0 41.0 26-27 39.1685 40.0 38.0 41.0 36.0 41.0 28-29 38.99075 40.0 38.0 41.0 35.5 41.0 30-31 38.680875 40.0 38.0 41.0 34.5 41.0 32-33 38.488875 40.0 38.0 41.0 34.5 41.0 34-35 38.26349999999999 40.0 37.5 41.0 33.5 41.0 36-37 38.0085 40.0 37.0 41.0 33.0 41.0 38-39 37.815749999999994 39.5 36.5 41.0 33.0 41.0 40-41 38.185125 40.0 37.0 41.0 33.0 41.0 42-43 38.1425 40.0 37.0 41.0 33.0 41.0 44-45 37.91525 40.0 36.0 41.0 33.0 41.0 46-47 37.936625 40.0 35.5 41.0 33.5 41.0 48-49 37.653375 39.0 35.0 41.0 33.0 41.0 50-51 37.34875 39.0 35.0 41.0 33.0 41.0 52-53 37.128375000000005 38.5 35.0 41.0 33.0 41.0 54-55 36.83725 38.0 35.0 40.5 32.0 41.0 56-57 36.672250000000005 37.0 35.0 40.0 32.0 41.0 58-59 36.328125 37.0 35.0 40.0 31.0 41.0 60-61 36.131625 36.0 34.5 40.0 31.0 41.0 62-63 35.93325 36.0 34.0 39.5 31.0 41.0 64-65 35.561375 35.0 34.0 39.0 30.5 41.0 66-67 35.32675 35.0 34.0 39.0 30.5 41.0 68-69 34.824875 35.0 33.5 38.0 29.5 40.0 70-71 34.53275 35.0 33.0 37.0 29.5 39.5 72-73 34.2645 35.0 33.0 37.0 29.0 39.0 74-75 34.104749999999996 35.0 33.0 36.0 29.0 39.0 76-77 32.892625 34.0 31.5 35.0 28.0 37.0 78-79 33.681125 35.0 33.0 35.0 29.0 37.0 80-81 33.515625 35.0 33.0 35.0 29.0 37.0 82-83 33.48925 35.0 33.0 35.0 29.0 36.0 84-85 33.410624999999996 35.0 33.0 35.0 29.0 36.0 86-87 33.104124999999996 35.0 33.0 35.0 29.0 36.0 88-89 32.936125000000004 35.0 33.0 35.0 29.0 35.5 90-91 32.784125 35.0 33.0 35.0 29.0 35.0 92-93 32.54675 35.0 33.0 35.0 27.0 35.0 94-95 32.356875 35.0 33.0 35.0 27.0 35.0 96-97 32.16475 35.0 32.0 35.0 27.0 35.0 98-99 31.752 34.0 32.0 35.0 26.0 35.0 100 31.5255 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 -6.7479250959643124 1101 2 -3.5203599958501925 1101 3 -0.9916744475568002 1101 4 -0.36017740429505807 1101 5 -0.23417885672787264 1101 6 0.02173461977383795 1101 7 -0.07544869799772158 1101 8 -0.010322647577545752 1101 9 0.0645813881108026 1101 10-11 0.15607168793442838 1101 12-13 0.13427222740948253 1101 14-15 0.08997302624753445 1101 16-17 0.09224245253656704 1101 18-19 0.07076719576719626 1101 20-21 0.08367050523913377 1101 22-23 0.09407096171801754 1101 24-25 0.0233426704014974 1101 26-27 0.1345704948646116 1101 28-29 0.02971003216101309 1101 30-31 0.039591762630976746 1101 32-33 -0.03823010685755435 1101 34-35 -0.11046270359995702 1101 36-37 0.08875402012657219 1101 38-39 0.016962340491751604 1101 40-41 0.1304466230936825 1101 42-43 0.040927482103946033 1101 44-45 0.09317615935263035 1101 46-47 0.1460732441124577 1101 48-49 0.37435159248884275 1101 50-51 0.2578197945844991 1101 52-53 0.021267766365802743 1101 54-55 0.13297541238717514 1101 56-57 0.13864249403464868 1101 58-59 0.22031590413943292 1101 60-61 0.1776377217553673 1101 62-63 0.2596742400663956 1101 64-65 0.14716256873119704 1101 66-67 0.31297333748314315 1101 68-69 0.72412854030501 1101 70-71 0.2796322232596751 1101 72-73 0.4976916692602984 1101 74-75 0.29192602967113146 1101 76-77 0.22790227201991797 1101 78-79 0.11616868969810668 1101 80-81 0.14456893868658938 1101 82-83 0.25840336134453423 1101 84-85 0.1661479406577442 1101 86-87 -0.012929245772383524 1101 88-89 0.26538022616454526 1101 90-91 0.26947816163502836 1101 92-93 0.07524120759414643 1101 94-95 0.23235034754642214 1101 96-97 0.106714908185495 1101 98-99 -0.03072154787841086 1101 100 0.05329909741674399 1103 1 6.7479250959643124 1103 2 3.5203599958501925 1103 3 0.9916744475567967 1103 4 0.36017740429505096 1103 5 0.23417885672787975 1103 6 -0.02173461977383795 1103 7 0.07544869799771448 1103 8 0.010322647577552857 1103 9 -0.0645813881108026 1103 10-11 -0.1560716879344355 1103 12-13 -0.13427222740948253 1103 14-15 -0.08997302624754155 1103 16-17 -0.09224245253657415 1103 18-19 -0.07076719576719626 1103 20-21 -0.08367050523913377 1103 22-23 -0.09407096171801754 1103 24-25 -0.023342670401490295 1103 26-27 -0.1345704948646116 1103 28-29 -0.02971003216101309 1103 30-31 -0.039591762630976746 1103 32-33 0.03823010685756145 1103 34-35 0.11046270359995702 1103 36-37 -0.08875402012657219 1103 38-39 -0.0169623404917445 1103 40-41 -0.1304466230936825 1103 42-43 -0.04092748210395314 1103 44-45 -0.09317615935263035 1103 46-47 -0.1460732441124577 1103 48-49 -0.37435159248884986 1103 50-51 -0.2578197945844991 1103 52-53 -0.021267766365809848 1103 54-55 -0.13297541238718225 1103 56-57 -0.13864249403465578 1103 58-59 -0.22031590413943292 1103 60-61 -0.1776377217553673 1103 62-63 -0.2596742400663956 1103 64-65 -0.14716256873119704 1103 66-67 -0.31297333748314315 1103 68-69 -0.72412854030501 1103 70-71 -0.2796322232596751 1103 72-73 -0.4976916692602913 1103 74-75 -0.29192602967113146 1103 76-77 -0.22790227201991797 1103 78-79 -0.11616868969809957 1103 80-81 -0.14456893868658938 1103 82-83 -0.25840336134454134 1103 84-85 -0.1661479406577442 1103 86-87 0.012929245772383524 1103 88-89 -0.26538022616453816 1103 90-91 -0.26947816163502125 1103 92-93 -0.07524120759415354 1103 94-95 -0.23235034754642925 1103 96-97 -0.106714908185495 1103 98-99 0.03072154787841086 1103 100 -0.05329909741674754 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 5.0 27 23.0 28 40.0 29 68.0 30 88.0 31 121.0 32 148.0 33 213.0 34 323.0 35 507.0 36 684.0 37 893.0 38 762.0 39 125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.839927514346122 10.299003322259136 12.050739957716702 47.810329205678045 2 26.150000000000002 17.925 32.824999999999996 23.1 3 25.174999999999997 23.0 22.6 29.225 4 27.675 29.125 16.0 27.200000000000003 5 29.75 30.925000000000004 18.15 21.175 6 22.45 32.550000000000004 20.525 24.474999999999998 7 20.25 15.25 37.225 27.275 8 21.775 19.45 26.224999999999998 32.550000000000004 9 24.0 18.3 27.725 29.975 10-11 27.212500000000002 27.450000000000003 18.725 26.6125 12-13 25.4375 21.4125 25.75 27.400000000000002 14-15 25.887500000000003 23.375 24.212500000000002 26.525 16-17 26.3 22.6125 23.125 27.962500000000002 18-19 25.900000000000002 24.275 22.6375 27.187499999999996 20-21 26.3625 23.1875 23.8375 26.6125 22-23 26.6 23.925 22.75 26.724999999999998 24-25 26.237500000000004 23.724999999999998 23.2375 26.8 26-27 26.2625 23.525 23.7875 26.424999999999997 28-29 25.662499999999998 23.9 22.9625 27.474999999999998 30-31 25.5 23.8375 23.35 27.3125 32-33 26.05 24.525 23.3875 26.0375 34-35 26.1 23.575 23.175 27.150000000000002 36-37 26.4625 23.5375 23.2875 26.7125 38-39 26.125 24.075 23.5375 26.2625 40-41 26.4125 23.95 23.1 26.5375 42-43 26.325 23.200000000000003 23.825 26.650000000000002 44-45 26.2875 23.674999999999997 23.599999999999998 26.437500000000004 46-47 26.325 23.35 23.1875 27.1375 48-49 26.1 23.125 24.087500000000002 26.687499999999996 50-51 26.0 23.5125 23.599999999999998 26.887499999999996 52-53 26.575 22.95 22.675 27.800000000000004 54-55 26.525 22.9875 24.0375 26.450000000000003 56-57 26.8375 23.3625 23.25 26.55 58-59 26.55 23.025000000000002 23.025000000000002 27.400000000000002 60-61 25.724999999999998 23.2375 23.8625 27.175 62-63 25.137500000000003 24.0375 23.8875 26.937499999999996 64-65 27.187499999999996 23.925 22.475 26.4125 66-67 26.4125 23.75 22.4875 27.35 68-69 26.674999999999997 23.35 23.7375 26.237500000000004 70-71 26.625 23.9 23.375 26.1 72-73 26.487500000000004 23.474999999999998 22.8125 27.224999999999998 74-75 25.937500000000004 23.525 24.1875 26.35 76-77 26.55 23.7375 24.0 25.7125 78-79 26.187500000000004 23.3 24.7 25.8125 80-81 26.137500000000003 23.4125 23.8875 26.5625 82-83 25.662499999999998 24.224999999999998 23.325000000000003 26.787499999999998 84-85 26.75 23.4125 22.7375 27.1 86-87 26.775 23.4625 23.5 26.2625 88-89 26.900000000000002 22.900000000000002 23.799999999999997 26.400000000000002 90-91 26.9125 23.3875 23.575 26.125 92-93 26.700000000000003 23.7875 23.4125 26.1 94-95 27.675 23.6375 23.325000000000003 25.362499999999997 96-97 27.224999999999998 24.525 22.412499999999998 25.837500000000002 98-99 26.8375 23.7875 23.875 25.5 100 27.3 23.025000000000002 22.225 27.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 1.5 27 2.5 28 2.0 29 1.0 30 4.0 31 7.0 32 9.5 33 14.0 34 18.5 35 29.5 36 37.0 37 44.5 38 61.0 39 67.0 40 89.0 41 116.5 42 131.0 43 143.5 44 152.5 45 168.0 46 164.5 47 154.0 48 143.5 49 137.5 50 128.0 51 115.5 52 101.5 53 90.5 54 98.0 55 95.0 56 96.5 57 103.0 58 100.0 59 112.0 60 112.5 61 95.0 62 99.0 63 108.0 64 97.5 65 81.0 66 83.0 67 89.0 68 84.0 69 66.5 70 64.0 71 59.0 72 44.0 73 41.0 74 36.5 75 26.0 76 19.0 77 16.0 78 12.0 79 12.5 80 8.5 81 2.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 17.224999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618230 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618230_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90975 34.0 31.0 34.0 31.0 34.0 2 33.06675 34.0 33.0 34.0 31.0 34.0 3 33.17575 34.0 34.0 34.0 31.0 34.0 4 36.51 37.0 37.0 37.0 35.0 37.0 5 36.5215 37.0 37.0 37.0 35.0 37.0 6 36.46475 37.0 37.0 37.0 35.0 37.0 7 36.50525 37.0 37.0 37.0 35.0 37.0 8 36.4195 37.0 37.0 37.0 35.0 37.0 9 38.3385 39.0 39.0 39.0 37.0 39.0 10-11 38.390874999999994 39.0 39.0 39.0 37.0 39.0 12-13 38.346375 39.0 39.0 39.0 37.0 39.0 14-15 39.957 41.0 40.0 41.0 38.0 41.0 16-17 39.968625 41.0 40.0 41.0 38.0 41.0 18-19 39.781499999999994 41.0 40.0 41.0 37.5 41.0 20-21 39.6935 41.0 40.0 41.0 38.0 41.0 22-23 39.740125 41.0 40.0 41.0 38.0 41.0 24-25 39.748999999999995 41.0 40.0 41.0 37.5 41.0 26-27 39.61625 41.0 39.0 41.0 37.0 41.0 28-29 39.459 41.0 39.0 41.0 37.0 41.0 30-31 39.324375 40.0 39.0 41.0 36.0 41.0 32-33 39.162125 40.0 38.0 41.0 35.5 41.0 34-35 39.101124999999996 40.0 38.0 41.0 35.0 41.0 36-37 38.7685 40.0 38.0 41.0 35.0 41.0 38-39 38.553625 40.0 38.0 41.0 34.5 41.0 40-41 38.326375 40.0 37.0 41.0 34.0 41.0 42-43 37.96325 40.0 36.5 41.0 33.0 41.0 44-45 38.086875 40.0 36.5 41.0 33.0 41.0 46-47 37.85825 39.5 35.5 41.0 33.0 41.0 48-49 37.674375 39.0 35.0 41.0 33.0 41.0 50-51 36.5435 38.0 34.0 40.0 31.5 40.5 52-53 36.570375 38.0 34.5 39.5 31.5 40.5 54-55 36.802625 38.0 35.0 40.0 32.0 41.0 56-57 36.675125 37.5 35.0 40.0 31.5 41.0 58-59 36.406875 37.0 35.0 40.0 31.5 41.0 60-61 36.590625 37.0 35.0 40.0 32.5 41.0 62-63 36.673625 36.5 35.0 40.0 33.0 41.0 64-65 36.32875 36.0 35.0 39.5 33.0 41.0 66-67 36.093 35.5 35.0 39.0 32.5 41.0 68-69 35.79025 35.0 35.0 39.0 32.0 41.0 70-71 35.533125 35.0 35.0 38.0 32.0 40.5 72-73 35.309875 35.0 35.0 37.0 32.0 39.5 74-75 34.898875000000004 35.0 34.0 37.0 31.0 39.0 76-77 34.601375 35.0 34.0 36.0 31.0 39.0 78-79 34.330124999999995 35.0 34.0 36.0 31.0 37.0 80-81 34.04 35.0 34.0 35.5 30.0 37.0 82-83 33.715999999999994 35.0 33.5 35.0 29.5 36.5 84-85 33.4585 35.0 33.0 35.0 29.5 36.0 86-87 33.27075 35.0 33.0 35.0 29.0 36.0 88-89 33.074 35.0 33.0 35.0 29.0 36.0 90-91 32.902249999999995 35.0 33.0 35.0 29.0 35.0 92-93 32.585499999999996 35.0 33.0 35.0 27.0 35.0 94-95 32.333625 35.0 33.0 35.0 27.0 35.0 96-97 32.073375 35.0 33.0 35.0 27.0 35.0 98-99 31.5925 35.0 32.0 35.0 25.0 35.0 100 31.1815 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.2170090258325601 1101 2 0.08473389355742 1101 3 0.047126257910576896 1101 4 0.10250025936300489 1101 5 0.09516028633675688 1101 6 0.1886606494449623 1101 7 0.15878203133105018 1101 8 -0.18977591036414765 1101 9 0.013512812532425755 1101 10-11 0.12366428052703071 1101 12-13 0.04935677974894048 1101 14-15 0.10702614379084707 1101 16-17 0.1533872808382597 1101 18-19 0.1373845834630174 1101 20-21 0.14943199502022964 1101 22-23 0.06267507002800699 1101 24-25 0.16635543106131223 1101 26-27 0.15765380226164183 1101 28-29 0.10615727772589878 1101 30-31 0.056528166822282344 1101 32-33 -0.07221962859217257 1101 34-35 0.07088390911920328 1101 36-37 0.05839558045440896 1101 38-39 -0.07722533457827296 1101 40-41 0.03890445066915049 1101 42-43 0.019633779437697285 1101 44-45 -0.07116920842410934 1101 46-47 -0.06449061105924159 1101 48-49 -0.23275236020334233 1101 50-51 0.07009285195560011 1101 52-53 0.07027440605871504 1101 54-55 0.013629525884425675 1101 56-57 0.09029723000311662 1101 58-59 0.05418093163191173 1101 60-61 0.0677585849154454 1101 62-63 -0.09640522875816515 1101 64-65 -0.06747328561053934 1101 66-67 -0.0544921672372638 1101 68-69 -0.11623353044922169 1101 70-71 -0.17001244942421323 1101 72-73 -0.2961795829442835 1101 74-75 -0.13226216412491 1101 76-77 -0.16450098557941573 1101 78-79 -0.0696259985475649 1101 80-81 -0.05102967112770784 1101 82-83 -0.32674551302002186 1101 84-85 -0.5030345471521969 1101 86-87 -0.29275599128539653 1101 88-89 -0.3741830065359508 1101 90-91 -0.08964882249195938 1101 92-93 -0.286557215478787 1101 94-95 -0.29703548085900877 1101 96-97 -0.12701006328457254 1101 98-99 -0.24245253657018395 1101 100 -0.6385517169830912 1103 1 -0.217009025832553 1103 2 -0.08473389355742711 1103 3 -0.04712625791056979 1103 4 -0.10250025936300489 1103 5 -0.09516028633675688 1103 6 -0.1886606494449623 1103 7 -0.15878203133105018 1103 8 0.18977591036414765 1103 9 -0.01351281253241865 1103 10-11 -0.1236642805270236 1103 12-13 -0.04935677974893338 1103 14-15 -0.10702614379085418 1103 16-17 -0.1533872808382597 1103 18-19 -0.1373845834630103 1103 20-21 -0.14943199502022964 1103 22-23 -0.06267507002800699 1103 24-25 -0.16635543106131223 1103 26-27 -0.15765380226164183 1103 28-29 -0.10615727772590589 1103 30-31 -0.056528166822282344 1103 32-33 0.07221962859217967 1103 34-35 -0.07088390911920328 1103 36-37 -0.05839558045440185 1103 38-39 0.07722533457828007 1103 40-41 -0.03890445066915049 1103 42-43 -0.019633779437697285 1103 44-45 0.07116920842410934 1103 46-47 0.06449061105923448 1103 48-49 0.23275236020334233 1103 50-51 -0.07009285195560011 1103 52-53 -0.07027440605872215 1103 54-55 -0.013629525884425675 1103 56-57 -0.09029723000311662 1103 58-59 -0.05418093163191173 1103 60-61 -0.0677585849154454 1103 62-63 0.09640522875817226 1103 64-65 0.06747328561053934 1103 66-67 0.0544921672372638 1103 68-69 0.11623353044921458 1103 70-71 0.17001244942421323 1103 72-73 0.2961795829442906 1103 74-75 0.13226216412491 1103 76-77 0.16450098557941573 1103 78-79 0.06962599854757201 1103 80-81 0.05102967112770784 1103 82-83 0.32674551302002186 1103 84-85 0.5030345471521969 1103 86-87 0.29275599128540364 1103 88-89 0.3741830065359437 1103 90-91 0.08964882249195938 1103 92-93 0.2865572154787799 1103 94-95 0.29703548085900877 1103 96-97 0.12701006328457254 1103 98-99 0.24245253657018395 1103 100 0.6385517169830877 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 11.0 28 27.0 29 42.0 30 60.0 31 89.0 32 118.0 33 176.0 34 277.0 35 478.0 36 683.0 37 944.0 38 936.0 39 159.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.693253072485582 10.9104589917231 11.863556558816153 48.53273137697517 2 25.35 19.45 32.95 22.25 3 25.95 22.175 23.375 28.499999999999996 4 28.532133033258315 28.232058014503625 16.429107276819206 26.806701675418854 5 28.775000000000002 30.175 18.6 22.45 6 22.025 32.525 19.775000000000002 25.674999999999997 7 20.75 13.375 39.675 26.200000000000003 8 23.799999999999997 18.375 25.15 32.675 9 21.975 18.95 28.499999999999996 30.575000000000003 10-11 26.187500000000004 27.200000000000003 19.287499999999998 27.325 12-13 24.337500000000002 22.112499999999997 25.637500000000003 27.9125 14-15 24.9125 23.7625 24.0375 27.287499999999998 16-17 25.7625 23.849999999999998 23.0875 27.3 18-19 25.087500000000002 24.0625 22.975 27.875 20-21 25.924999999999997 23.3375 24.2625 26.474999999999998 22-23 26.025 23.7125 23.175 27.0875 24-25 25.887500000000003 23.400000000000002 23.5125 27.200000000000003 26-27 26.200000000000003 24.65 22.8375 26.3125 28-29 26.1 23.9875 23.9 26.0125 30-31 26.5 23.0625 23.35 27.0875 32-33 25.2375 24.3875 23.825 26.55 34-35 25.5 23.9125 23.6875 26.900000000000002 36-37 25.637500000000003 23.4375 23.6375 27.287499999999998 38-39 25.937500000000004 24.05 23.4125 26.6 40-41 25.362499999999997 24.0375 23.3625 27.237499999999997 42-43 26.974999999999998 22.75 23.45 26.825 44-45 25.624999999999996 24.45 23.2125 26.7125 46-47 26.4125 23.5375 23.400000000000002 26.650000000000002 48-49 25.45 23.4375 23.4875 27.625 50-51 25.912499999999998 24.587500000000002 24.3 25.2 52-53 26.674999999999997 23.25 22.7 27.375 54-55 25.674999999999997 23.375 23.35 27.6 56-57 26.575 22.775000000000002 24.3875 26.2625 58-59 26.724999999999998 24.087500000000002 23.4625 25.724999999999998 60-61 25.5375 23.225 24.2875 26.950000000000003 62-63 25.624999999999996 23.5875 23.724999999999998 27.0625 64-65 25.9625 23.7625 23.875 26.400000000000002 66-67 26.375 23.150000000000002 23.45 27.025 68-69 26.8125 23.2625 24.0125 25.912499999999998 70-71 26.787499999999998 23.0125 23.7375 26.4625 72-73 26.187500000000004 23.724999999999998 23.5 26.5875 74-75 25.662499999999998 24.15 23.9375 26.25 76-77 26.5875 23.375 23.0875 26.950000000000003 78-79 26.2125 23.225 23.625 26.937499999999996 80-81 26.237500000000004 23.6875 23.575 26.5 82-83 26.9625 23.2625 23.1 26.674999999999997 84-85 26.7125 22.912499999999998 23.75 26.625 86-87 27.037499999999998 23.400000000000002 23.6625 25.900000000000002 88-89 26.437500000000004 23.7375 23.95 25.874999999999996 90-91 26.950000000000003 23.5375 24.337500000000002 25.174999999999997 92-93 26.5125 22.85 24.55 26.087500000000002 94-95 26.974999999999998 23.7125 23.0625 26.25 96-97 26.224999999999998 23.849999999999998 23.25 26.674999999999997 98-99 26.35 24.175 23.05 26.424999999999997 100 29.349999999999998 21.65 23.35 25.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.5 26 1.5 27 0.5 28 3.5 29 7.5 30 8.0 31 4.5 32 3.0 33 9.0 34 17.0 35 28.5 36 37.0 37 44.0 38 63.5 39 73.0 40 84.0 41 122.5 42 142.5 43 138.5 44 150.5 45 168.5 46 165.5 47 149.0 48 141.0 49 141.5 50 138.0 51 121.0 52 111.0 53 100.5 54 88.5 55 98.0 56 94.0 57 85.5 58 90.0 59 103.5 60 111.0 61 101.0 62 97.0 63 99.5 64 101.5 65 90.0 66 85.5 67 92.0 68 84.0 69 71.0 70 57.0 71 51.5 72 47.5 73 40.5 74 32.0 75 23.5 76 18.5 77 15.5 78 15.0 79 13.0 80 8.5 81 2.0 82 1.5 83 2.5 84 2.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34574735782587 98.7 2 0.6542526421741319 1.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566693 spots for SRR8618230.sra Written 566693 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra Read 566691 spots for SRR8618230.sra Written 566691 spots for SRR8618230.sra SRR ids: ['SRR8618230.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ipa3hgjh SRR8618230.sra spots: 11333822 blocks: [[1, 566691], [566692, 1133382], [1133383, 1700073], [1700074, 2266764], [2266765, 2833455], [2833456, 3400146], [3400147, 3966837], [3966838, 4533528], [4533529, 5100219], [5100220, 5666910], [5666911, 6233601], [6233602, 6800292], [6800293, 7366983], [7366984, 7933674], [7933675, 8500365], [8500366, 9067056], [9067057, 9633747], [9633748, 10200438], [10200439, 10767129], [10767130, 11333822]] SRR8618230 file size 2949641 SRR8618230 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618230 SRR8618230_1.fastq SRR8618230_2.fastq Input file: SRR8618230_1.fastq Paired file: SRR8618230_2.fastq trimmed: SRR8618230-trimmed-pair1.fastq, SRR8618230-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:21:24 2024 >> started Sat Dec 7 08:21:39 2024 >> done (15.580s) 11333822 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11333822 (100.00%) read pairs available; of these: 1241460 (10.95%) trimmed read pairs available after processing 10092362 (89.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 9 0.00% 82 31 0.00% 83 75 0.00% 84 4691 0.04% 85 5258 0.05% 86 5619 0.05% 87 6552 0.06% 88 7966 0.07% 89 9562 0.08% 90 15278 0.13% 91 27721 0.24% 92 39396 0.35% 93 53547 0.47% 94 71725 0.63% 95 93517 0.83% 96 126907 1.12% 97 176902 1.56% 98 255165 2.25% 99 341539 3.01% 100 10092362 89.05% 11333822 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=24 prefix-density=0.37 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=34 fanout-score=37.38 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=9.4 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=32 fanout-score=35.50 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=8.9 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618230 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:22:07 Started mapping on | Dec 07 08:22:07 Finished on | Dec 07 08:23:07 Mapping speed, Million of reads per hour | 680.03 Number of input reads | 11333822 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11016343 Uniquely mapped reads % | 97.20% Average mapped length | 198.29 Number of splices: Total | 6826756 Number of splices: Annotated (sjdb) | 6487452 Number of splices: GT/AG | 6724468 Number of splices: GC/AG | 80972 Number of splices: AT/AC | 2569 Number of splices: Non-canonical | 18747 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 130203 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 6444 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.37% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 187276 187276 187276 N_multimapping 130203 130203 130203 N_noFeature 302543 5542160 5575907 N_ambiguous 238334 18796 19927 UnstrandedReadsAssigned:10475466 PositiveStrandReadsAssigned:5455387 NegativeStrandReadsAssigned:5420509 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618230 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618230-trimmed-pair1.fastq SRR8618230-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,333,822 reads, 10,685,181 reads pseudoaligned [quant] estimated average fragment length: 164.573 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,149 rounds 52973 SRR8618230.ke.tsv 35125 SRR8618230.se.tsv 88098 total ==> SRR8618230.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 772.588 0.00025656 4.41275e-05 PNS24247 1044 880.427 27.1065 4.09118 PNS24249 1928 1764.43 112.333 8.46004 PNS24246 1044 880.427 27.1065 4.09118 PNS24248 1044 880.427 27.1065 4.09118 PNS24244 1471 1307.43 9.34741 0.950042 PNS24243 293 135.858 3 2.9343 KQK14069 1603 1439.43 3109.43 287.052 KQK14071 474 311.819 290.426 123.766 ==> SRR8618230.se.tsv <== BRADI_1g14170v3 3678 BRADI_1g53295v3 218 BRADI_1g59795v3 329 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 378 BRADI_1g74790v3 47 BRADI_1g09890v3 2 BRADI_1g77505v3 131 BRADI_1g48960v3 0 SRR8618230 completed mapping pipeline successfully