Starting /dee2/code/volunteer_pipeline.sh SRR8618231 current disk space = 1544526483456 free memory = 1598280708 SRR8618231 SRAfilesize 1908d6d356491fece04a290193fe1ab6 SRR8618231.sra SRR8618231.sra file validated SRR8618231 is paired end SRR8618231 is conventional basespace SRR8618231 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618231_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97525 34.0 31.0 34.0 31.0 34.0 2 33.11925 34.0 33.0 34.0 31.0 34.0 3 33.24225 34.0 34.0 34.0 31.0 34.0 4 34.80525 37.0 37.0 37.0 35.0 37.0 5 35.5985 37.0 37.0 37.0 35.0 37.0 6 36.21625 37.0 37.0 37.0 35.0 37.0 7 36.31625 37.0 37.0 37.0 35.0 37.0 8 36.4175 37.0 37.0 37.0 35.0 37.0 9 38.3195 39.0 39.0 39.0 37.0 39.0 10-11 38.371 39.0 39.0 39.0 37.0 39.0 12-13 38.274875 39.0 39.0 39.0 37.0 39.0 14-15 39.872625 41.0 40.0 41.0 38.0 41.0 16-17 39.859 41.0 40.0 41.0 38.0 41.0 18-19 39.81725 41.0 40.0 41.0 38.0 41.0 20-21 39.701499999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.571749999999994 41.0 39.0 41.0 37.0 41.0 24-25 39.471000000000004 41.0 39.0 41.0 37.0 41.0 26-27 39.32525 40.5 39.0 41.0 36.0 41.0 28-29 39.175375 40.0 38.5 41.0 36.0 41.0 30-31 38.94325 40.0 38.0 41.0 35.0 41.0 32-33 38.772999999999996 40.0 38.0 41.0 35.0 41.0 34-35 39.076875 40.0 38.0 41.0 35.0 41.0 36-37 39.118125000000006 40.0 38.0 41.0 35.0 41.0 38-39 38.926 40.0 38.0 41.0 35.0 41.0 40-41 38.84625 40.0 38.0 41.0 35.0 41.0 42-43 38.694500000000005 40.0 37.5 41.0 35.0 41.0 44-45 38.4855 40.0 37.0 41.0 34.5 41.0 46-47 38.092375000000004 40.0 36.0 41.0 34.0 41.0 48-49 37.9675 39.5 35.0 41.0 34.0 41.0 50-51 37.71025 39.0 35.0 41.0 33.0 41.0 52-53 37.493375 39.0 35.0 41.0 33.0 41.0 54-55 37.217625 38.0 35.0 41.0 33.0 41.0 56-57 36.94725 37.5 35.0 40.5 33.0 41.0 58-59 36.7205 37.0 35.0 40.0 33.0 41.0 60-61 36.2785 36.0 35.0 40.0 32.0 41.0 62-63 36.053875 36.0 35.0 39.5 32.0 41.0 64-65 35.897125 35.0 35.0 39.0 31.5 41.0 66-67 35.540375 35.0 34.0 39.0 31.0 41.0 68-69 35.259625 35.0 34.0 37.5 31.0 40.0 70-71 34.952875 35.0 34.0 37.0 31.0 39.5 72-73 34.642125 35.0 34.0 36.5 30.5 39.0 74-75 34.230625 35.0 33.5 36.0 30.0 39.0 76-77 33.360375000000005 34.5 32.5 35.0 28.5 37.0 78-79 33.907375 35.0 33.0 35.0 30.0 37.0 80-81 33.805875 35.0 34.0 35.0 30.0 37.0 82-83 33.621624999999995 35.0 33.0 35.0 29.5 36.0 84-85 33.380375 35.0 33.0 35.0 29.0 36.0 86-87 33.198499999999996 35.0 33.0 35.0 29.0 36.0 88-89 33.032 35.0 33.0 35.0 29.0 35.0 90-91 32.692499999999995 35.0 33.0 35.0 28.0 35.0 92-93 32.433125000000004 35.0 33.0 35.0 27.0 35.0 94-95 32.160250000000005 34.5 32.0 35.0 27.0 35.0 96-97 31.77825 34.5 32.0 35.0 26.0 35.0 98-99 31.344250000000002 34.0 32.0 35.0 24.5 35.0 100 31.05725 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.09213421342134609 1101 2 -0.03325332533253089 1101 3 -0.10226022602260088 1101 4 -2.0735073507350705 1101 5 -1.1471897189719016 1101 6 -0.4130913091309125 1101 7 -0.3617361736173592 1101 8 -0.17146714671466867 1101 9 -0.0988348834883439 1101 10-11 -0.1383888388838912 1101 12-13 -0.13733873387339202 1101 14-15 -0.0512301230123029 1101 16-17 -0.11554905490548606 1101 18-19 -0.10809830983098578 1101 20-21 -0.07703270327032641 1101 22-23 0.08518351835183324 1101 24-25 -0.03947894789479278 1101 26-27 -0.21630913091309623 1101 28-29 -0.2210346034603461 1101 30-31 -0.2012451245124538 1101 32-33 -0.07868286828682614 1101 34-35 -0.07024452445244833 1101 36-37 -0.10819831983197759 1101 38-39 0.05615561556155768 1101 40-41 0.020339533953396938 1101 42-43 -0.0015126512651235657 1101 44-45 0.01868936893689721 1101 46-47 0.029515451545158555 1101 48-49 -0.0461046104610503 1101 50-51 0.006175617561751778 1101 52-53 -0.0653315331533193 1101 54-55 -0.11648664866486769 1101 56-57 -0.013276327632766538 1101 58-59 0.03889138913891088 1101 60-61 -0.04317931793179497 1101 62-63 -0.2777402740274084 1101 64-65 -0.293804380438047 1101 66-67 -0.22669766976697048 1101 68-69 -0.17224222422242264 1101 70-71 -0.34097159715970804 1101 72-73 -0.11488648864887097 1101 74-75 0.07378237823782285 1101 76-77 0.07919541954195353 1101 78-79 -0.0012001200120010935 1101 80-81 0.007550755075506288 1101 82-83 0.016301630163020775 1101 84-85 0.047404740474043194 1101 86-87 -0.24898739873987807 1101 88-89 -0.280165516551655 1101 90-91 -0.5122512251225118 1101 92-93 -0.6450395039503967 1101 94-95 -0.4394939493949366 1101 96-97 -0.6248749874987496 1101 98-99 -0.4129662966296621 1101 100 -0.5230773077307731 1104 1 0.09213421342133898 1104 2 0.033253325332538 1104 3 0.10226022602260798 1104 4 2.0735073507350776 1104 5 1.1471897189718945 1104 6 0.4130913091309125 1104 7 0.3617361736173663 1104 8 0.17146714671467578 1104 9 0.09883488348835101 1104 10-11 0.1383888388838841 1104 12-13 0.1373387338733849 1104 14-15 0.05123012301229579 1104 16-17 0.11554905490549316 1104 18-19 0.10809830983097868 1104 20-21 0.07703270327032641 1104 22-23 -0.08518351835183324 1104 24-25 0.03947894789479278 1104 26-27 0.21630913091308912 1104 28-29 0.2210346034603461 1104 30-31 0.2012451245124538 1104 32-33 0.07868286828683324 1104 34-35 0.07024452445244123 1104 36-37 0.10819831983198469 1104 38-39 -0.05615561556155768 1104 40-41 -0.020339533953396938 1104 42-43 0.0015126512651306712 1104 44-45 -0.018689368936890105 1104 46-47 -0.029515451545158555 1104 48-49 0.0461046104610503 1104 50-51 -0.006175617561751778 1104 52-53 0.0653315331533122 1104 54-55 0.11648664866486769 1104 56-57 0.013276327632766538 1104 58-59 -0.03889138913891088 1104 60-61 0.04317931793179497 1104 62-63 0.2777402740274013 1104 64-65 0.2938043804380399 1104 66-67 0.22669766976697758 1104 68-69 0.17224222422242264 1104 70-71 0.34097159715971515 1104 72-73 0.11488648864886386 1104 74-75 -0.07378237823782996 1104 76-77 -0.07919541954195353 1104 78-79 0.0012001200120010935 1104 80-81 -0.007550755075513393 1104 82-83 -0.016301630163020775 1104 84-85 -0.0474047404740503 1104 86-87 0.24898739873987097 1104 88-89 0.280165516551655 1104 90-91 0.5122512251225118 1104 92-93 0.6450395039503931 1104 94-95 0.4394939493949366 1104 96-97 0.6248749874987496 1104 98-99 0.4129662966296621 1104 100 0.5230773077307731 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 9.0 28 32.0 29 49.0 30 71.0 31 100.0 32 127.0 33 177.0 34 302.0 35 451.0 36 690.0 37 917.0 38 911.0 39 163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.025000000000002 10.15 14.575 45.25 2 25.674999999999997 18.9 29.5 25.924999999999997 3 25.7 23.275000000000002 23.525 27.500000000000004 4 30.54018445322793 27.140974967061926 16.73254281949934 25.5862977602108 5 30.599999999999998 29.025000000000002 18.275 22.1 6 21.61080540270135 33.616808404202104 20.76038019009505 24.012006003001503 7 20.775 14.424999999999999 38.75 26.05 8 23.400000000000002 20.5 23.95 32.15 9 23.974999999999998 18.025 27.925 30.075000000000003 10-11 26.674999999999997 27.9125 18.45 26.9625 12-13 24.45 23.05 25.15 27.35 14-15 24.5 24.2375 24.0 27.2625 16-17 26.4125 22.900000000000002 23.1 27.5875 18-19 26.3 24.175 22.8875 26.637499999999996 20-21 26.3125 23.7375 22.9875 26.9625 22-23 26.275 24.1125 23.674999999999997 25.937500000000004 24-25 25.724999999999998 24.462500000000002 22.5 27.3125 26-27 25.887500000000003 24.099999999999998 22.575 27.437499999999996 28-29 26.700000000000003 23.175 23.5875 26.5375 30-31 25.8625 23.549999999999997 23.75 26.8375 32-33 26.150000000000002 24.65 22.7625 26.437500000000004 34-35 26.25 23.95 22.900000000000002 26.900000000000002 36-37 26.924999999999997 23.549999999999997 22.8125 26.7125 38-39 25.937500000000004 23.525 23.925 26.6125 40-41 27.500000000000004 23.1625 22.7125 26.625 42-43 25.8 23.724999999999998 23.95 26.525 44-45 25.8625 24.5625 23.325000000000003 26.25 46-47 26.8625 23.5375 22.75 26.85 48-49 26.087500000000002 23.5125 23.75 26.650000000000002 50-51 26.2625 23.799999999999997 23.200000000000003 26.737499999999997 52-53 27.6875 23.275000000000002 22.25 26.787499999999998 54-55 25.224999999999998 24.2625 23.275000000000002 27.237499999999997 56-57 25.8125 24.4875 23.25 26.450000000000003 58-59 26.6125 24.0625 23.0625 26.2625 60-61 26.7625 24.3625 22.275 26.6 62-63 26.224999999999998 24.5625 23.25 25.9625 64-65 28.287499999999998 23.1125 22.1 26.5 66-67 25.6125 23.5625 23.6625 27.1625 68-69 26.85 23.65 23.05 26.450000000000003 70-71 26.487500000000004 23.75 23.5 26.2625 72-73 25.687500000000004 23.724999999999998 24.0 26.5875 74-75 27.425 23.849999999999998 22.45 26.275 76-77 26.8625 22.825 23.175 27.1375 78-79 26.75 23.3125 23.525 26.4125 80-81 26.5125 24.2375 22.650000000000002 26.6 82-83 27.125 23.9 22.5125 26.4625 84-85 25.5 23.4125 23.724999999999998 27.3625 86-87 26.1125 23.825 23.925 26.137500000000003 88-89 27.037499999999998 23.775 22.662499999999998 26.525 90-91 26.7125 23.549999999999997 23.0625 26.674999999999997 92-93 26.6625 23.525 23.075000000000003 26.737499999999997 94-95 26.825 24.425 22.400000000000002 26.35 96-97 27.025 23.6375 23.5 25.837500000000002 98-99 26.974999999999998 23.775 23.025000000000002 26.224999999999998 100 26.575 24.0 23.05 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.5 27 2.0 28 4.0 29 5.0 30 4.0 31 3.5 32 7.5 33 16.5 34 22.0 35 29.5 36 46.0 37 53.5 38 52.0 39 73.0 40 98.0 41 103.0 42 125.0 43 140.5 44 147.5 45 154.0 46 147.0 47 145.0 48 136.5 49 125.5 50 123.0 51 129.0 52 116.5 53 104.0 54 104.0 55 98.0 56 95.5 57 98.0 58 101.5 59 101.0 60 112.5 61 113.0 62 92.5 63 91.0 64 98.0 65 90.5 66 83.5 67 90.0 68 89.5 69 77.0 70 63.5 71 53.0 72 49.5 73 40.0 74 33.5 75 33.0 76 24.0 77 15.0 78 13.0 79 10.0 80 7.0 81 4.0 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.125 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618231 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618231_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22975 33.0 31.0 34.0 31.0 34.0 2 32.83675 34.0 31.0 34.0 31.0 34.0 3 32.9785 34.0 31.0 34.0 31.0 34.0 4 36.48125 37.0 37.0 37.0 35.0 37.0 5 36.476 37.0 37.0 37.0 35.0 37.0 6 36.51625 37.0 37.0 37.0 35.0 37.0 7 36.4815 37.0 37.0 37.0 35.0 37.0 8 36.50575 37.0 37.0 37.0 35.0 37.0 9 38.26675 39.0 39.0 39.0 37.0 39.0 10-11 38.347 39.0 39.0 39.0 37.0 39.0 12-13 38.322374999999994 39.0 39.0 39.0 37.0 39.0 14-15 39.913 41.0 40.0 41.0 38.0 41.0 16-17 39.76975 41.0 40.0 41.0 37.5 41.0 18-19 39.804874999999996 41.0 40.0 41.0 38.0 41.0 20-21 39.739374999999995 41.0 40.0 41.0 37.5 41.0 22-23 39.704875 41.0 39.5 41.0 37.0 41.0 24-25 39.583625 41.0 39.5 41.0 37.0 41.0 26-27 39.483625 41.0 39.0 41.0 36.0 41.0 28-29 39.3995 40.5 39.0 41.0 36.0 41.0 30-31 39.245374999999996 40.0 39.0 41.0 36.0 41.0 32-33 39.20975 40.0 39.0 41.0 35.0 41.0 34-35 39.122749999999996 40.0 38.0 41.0 35.0 41.0 36-37 38.932375 40.0 38.0 41.0 35.0 41.0 38-39 38.74625 40.0 38.0 41.0 35.0 41.0 40-41 38.585875 40.0 37.5 41.0 35.0 41.0 42-43 38.235125 40.0 37.0 41.0 33.5 41.0 44-45 37.936499999999995 40.0 36.0 41.0 33.0 41.0 46-47 37.786 39.0 35.5 41.0 33.0 41.0 48-49 37.709625 39.0 35.0 41.0 33.0 41.0 50-51 37.095124999999996 38.5 34.5 40.0 32.0 40.5 52-53 37.040625000000006 38.0 35.0 40.0 33.0 41.0 54-55 37.23375 38.0 35.0 41.0 33.0 41.0 56-57 37.118125 38.0 35.0 41.0 33.0 41.0 58-59 36.956625 37.0 35.0 41.0 33.0 41.0 60-61 36.614999999999995 36.5 35.0 40.0 33.0 41.0 62-63 36.39975 36.0 35.0 40.0 33.0 41.0 64-65 36.216875 35.5 35.0 39.0 33.0 41.0 66-67 35.892375 35.0 35.0 39.0 32.0 41.0 68-69 35.578875 35.0 35.0 38.5 32.0 41.0 70-71 35.229124999999996 35.0 34.0 37.0 31.0 40.0 72-73 34.999375 35.0 34.0 37.0 31.0 39.0 74-75 34.625375000000005 35.0 34.0 36.0 31.0 39.0 76-77 34.3795 35.0 34.0 36.0 31.0 38.5 78-79 34.25512500000001 35.0 34.0 35.5 31.0 37.0 80-81 33.966499999999996 35.0 34.0 35.0 30.0 37.0 82-83 33.759249999999994 35.0 33.5 35.0 30.0 36.5 84-85 33.5095 35.0 33.0 35.0 29.5 36.0 86-87 33.376875 35.0 33.0 35.0 29.0 36.0 88-89 33.11525 35.0 33.0 35.0 29.0 35.5 90-91 32.901125 35.0 33.0 35.0 29.0 35.0 92-93 32.626875 35.0 33.0 35.0 28.0 35.0 94-95 32.285 35.0 32.5 35.0 27.0 35.0 96-97 32.03475 35.0 32.0 35.0 27.0 35.0 98-99 31.667875 34.0 32.0 35.0 26.0 35.0 100 31.4135 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.23312331233123018 1101 2 -0.03442844284428048 1101 3 -0.09040904090408475 1101 4 -0.024302430243025697 1101 5 0.039803980398041006 1101 6 0.07808280828082559 1101 7 -0.07288228822882559 1101 8 -0.03475347534753581 1101 9 0.006925692569254238 1101 10-11 -0.030278027802786767 1101 12-13 0.0013501350135030066 1101 14-15 0.0036628662866320383 1101 16-17 0.037366236623661564 1101 18-19 -0.13197569756975724 1101 20-21 9.500950095002736E-4 1101 22-23 0.04454195419541662 1101 24-25 -0.01007600760076599 1101 26-27 -0.09708470847084527 1101 28-29 0.018939393939390925 1101 30-31 0.059818481848182614 1101 32-33 0.011226122612256972 1101 34-35 -0.009600960096008748 1101 36-37 0.14080158015801914 1101 38-39 -0.07093209320932203 1101 40-41 -0.2672392239223953 1101 42-43 -0.17029202920291908 1101 44-45 -0.1588658865886572 1101 46-47 -0.0468421842184199 1101 48-49 -0.1841809180918048 1101 50-51 -0.16782928292829524 1101 52-53 -0.2982173217321744 1101 54-55 -0.3542979297929776 1101 56-57 -0.2887663766376676 1101 58-59 -0.2544629462946304 1101 60-61 -0.1345884588458901 1101 62-63 -0.17594259425942482 1101 64-65 -0.2740399039903991 1101 66-67 -0.17387988798880372 1101 68-69 -0.2135838583858387 1101 70-71 -0.22472247224722253 1101 72-73 -0.29109160916091525 1101 74-75 -0.08284578457845981 1101 76-77 -0.09750975097509951 1101 78-79 -0.0653315331533122 1101 80-81 -0.4389563956395648 1101 82-83 -0.3756375637563778 1101 84-85 -0.41817931793179497 1101 86-87 -0.48308580858086003 1101 88-89 -0.4483073307330727 1101 90-91 -0.14067656765676162 1101 92-93 -0.15752825282528704 1101 94-95 -0.4806605660566028 1101 96-97 -0.6569906990699046 1101 98-99 -0.6555405540554062 1101 100 -0.9995499549954978 1104 1 0.2331233123312373 1104 2 0.03442844284428759 1104 3 0.09040904090409185 1104 4 0.02430243024301859 1104 5 -0.039803980398041006 1104 6 -0.07808280828082559 1104 7 0.07288228822882559 1104 8 0.03475347534753581 1104 9 -0.006925692569261344 1104 10-11 0.03027802780277966 1104 12-13 -0.0013501350135030066 1104 14-15 -0.003662866286624933 1104 16-17 -0.037366236623661564 1104 18-19 0.13197569756975724 1104 20-21 -9.500950095002736E-4 1104 22-23 -0.04454195419541662 1104 24-25 0.010076007600758885 1104 26-27 0.09708470847085238 1104 28-29 -0.018939393939390925 1104 30-31 -0.05981848184818972 1104 32-33 -0.011226122612256972 1104 34-35 0.009600960096008748 1104 36-37 -0.14080158015801914 1104 38-39 0.07093209320932203 1104 40-41 0.2672392239223953 1104 42-43 0.17029202920291908 1104 44-45 0.1588658865886643 1104 46-47 0.04684218421842701 1104 48-49 0.18418091809181192 1104 50-51 0.16782928292829524 1104 52-53 0.2982173217321744 1104 54-55 0.3542979297929776 1104 56-57 0.2887663766376676 1104 58-59 0.2544629462946304 1104 60-61 0.134588458845883 1104 62-63 0.17594259425942482 1104 64-65 0.274039903990392 1104 66-67 0.1738798879887966 1104 68-69 0.2135838583858387 1104 70-71 0.22472247224722253 1104 72-73 0.29109160916091525 1104 74-75 0.08284578457845271 1104 76-77 0.0975097509750924 1104 78-79 0.0653315331533122 1104 80-81 0.4389563956395648 1104 82-83 0.3756375637563778 1104 84-85 0.41817931793179497 1104 86-87 0.48308580858086003 1104 88-89 0.4483073307330727 1104 90-91 0.14067656765676873 1104 92-93 0.15752825282527994 1104 94-95 0.48066056605660634 1104 96-97 0.6569906990699081 1104 98-99 0.6555405540554027 1104 100 0.9995499549954978 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 17.0 28 16.0 29 48.0 30 58.0 31 89.0 32 133.0 33 174.0 34 262.0 35 427.0 36 744.0 37 906.0 38 938.0 39 187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.9 8.75 14.224999999999998 47.125 2 23.875 18.775 31.724999999999998 25.624999999999996 3 26.8 22.15 22.400000000000002 28.65 4 29.45 28.549999999999997 16.675 25.324999999999996 5 29.45 30.049999999999997 18.875 21.625 6 22.975 31.275 21.025 24.725 7 21.425 14.6 38.525 25.45 8 24.099999999999998 18.35 25.6 31.95 9 22.5 18.9 28.825 29.775000000000002 10-11 26.80090045022511 28.064032016008007 18.721860930465233 26.413206603301653 12-13 24.1625 21.5625 25.2375 29.037499999999998 14-15 25.95 23.275000000000002 24.25 26.525 16-17 25.825 23.025000000000002 23.0125 28.1375 18-19 25.662499999999998 24.3125 23.599999999999998 26.424999999999997 20-21 26.5875 23.0375 22.425 27.950000000000003 22-23 26.4125 23.6375 23.1 26.85 24-25 25.2625 24.224999999999998 23.7125 26.8 26-27 26.625 23.1375 23.525 26.7125 28-29 25.525 23.5125 23.5 27.462500000000002 30-31 25.5375 23.8125 24.0625 26.5875 32-33 26.474999999999998 24.0375 23.6375 25.85 34-35 26.637499999999996 23.5125 23.425 26.424999999999997 36-37 26.7625 23.9125 22.8875 26.437500000000004 38-39 26.275 23.849999999999998 23.150000000000002 26.724999999999998 40-41 26.400000000000002 24.125 23.3 26.174999999999997 42-43 26.3125 22.75 24.0375 26.900000000000002 44-45 25.8625 23.9375 23.8375 26.3625 46-47 25.937500000000004 23.2875 23.6625 27.1125 48-49 25.4625 24.1125 22.975 27.450000000000003 50-51 26.387500000000003 23.8875 23.1875 26.5375 52-53 26.174999999999997 23.775 23.0375 27.0125 54-55 25.4625 23.6875 23.5375 27.3125 56-57 26.0125 24.325 23.9875 25.674999999999997 58-59 26.387500000000003 23.599999999999998 23.775 26.237500000000004 60-61 26.437500000000004 23.1375 24.0375 26.387500000000003 62-63 25.837500000000002 23.799999999999997 23.25 27.1125 64-65 25.650000000000002 23.7375 23.474999999999998 27.1375 66-67 26.3 23.474999999999998 23.5125 26.7125 68-69 26.237500000000004 23.4125 24.15 26.200000000000003 70-71 27.200000000000003 22.75 23.65 26.400000000000002 72-73 26.650000000000002 22.8625 23.5375 26.950000000000003 74-75 25.6125 24.025 23.7 26.6625 76-77 26.400000000000002 23.6375 23.625 26.337500000000002 78-79 26.487500000000004 23.474999999999998 23.150000000000002 26.887499999999996 80-81 26.387500000000003 22.8125 24.087500000000002 26.7125 82-83 26.400000000000002 23.2625 23.95 26.387500000000003 84-85 27.250000000000004 22.95 23.5375 26.2625 86-87 26.2875 24.05 23.5125 26.150000000000002 88-89 26.650000000000002 23.35 23.474999999999998 26.525 90-91 26.75 24.425 23.2625 25.5625 92-93 26.924999999999997 23.8875 23.849999999999998 25.337500000000002 94-95 27.175 24.224999999999998 22.2625 26.337500000000002 96-97 26.9125 23.875 23.3625 25.85 98-99 26.9625 23.9875 22.8125 26.237500000000004 100 26.875 23.7 22.775000000000002 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.5 28 3.5 29 4.0 30 5.0 31 10.0 32 13.5 33 12.0 34 17.0 35 27.5 36 39.0 37 47.5 38 61.5 39 80.5 40 100.5 41 125.0 42 137.5 43 136.0 44 132.5 45 151.0 46 157.5 47 146.0 48 142.5 49 129.5 50 122.0 51 118.5 52 104.0 53 95.0 54 104.5 55 103.0 56 93.5 57 92.5 58 88.5 59 100.0 60 115.0 61 119.0 62 107.0 63 99.0 64 100.5 65 86.0 66 81.5 67 89.5 68 73.0 69 60.0 70 65.0 71 62.0 72 51.5 73 44.5 74 35.5 75 26.5 76 25.0 77 17.5 78 12.0 79 9.5 80 7.0 81 3.5 82 2.5 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.05 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.243761028485 98.425 2 0.6806150743634989 1.35 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566349 spots for SRR8618231.sra Written 566349 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra Read 566338 spots for SRR8618231.sra Written 566338 spots for SRR8618231.sra SRR ids: ['SRR8618231.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_knjg94ip SRR8618231.sra spots: 11326771 blocks: [[1, 566338], [566339, 1132676], [1132677, 1699014], [1699015, 2265352], [2265353, 2831690], [2831691, 3398028], [3398029, 3964366], [3964367, 4530704], [4530705, 5097042], [5097043, 5663380], [5663381, 6229718], [6229719, 6796056], [6796057, 7362394], [7362395, 7928732], [7928733, 8495070], [8495071, 9061408], [9061409, 9627746], [9627747, 10194084], [10194085, 10760422], [10760423, 11326771]] SRR8618231 file size 2947859 SRR8618231 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618231 SRR8618231_1.fastq SRR8618231_2.fastq Input file: SRR8618231_1.fastq Paired file: SRR8618231_2.fastq trimmed: SRR8618231-trimmed-pair1.fastq, SRR8618231-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:23:26 2024 >> started Sat Dec 7 08:23:37 2024 >> done (10.334s) 11326771 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11326771 (100.00%) read pairs available; of these: 1394560 (12.31%) trimmed read pairs available after processing 9932211 (87.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 74 1 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 3 0.00% 81 11 0.00% 82 40 0.00% 83 90 0.00% 84 6416 0.06% 85 7011 0.06% 86 7754 0.07% 87 9008 0.08% 88 10407 0.09% 89 12695 0.11% 90 19498 0.17% 91 33537 0.30% 92 46618 0.41% 93 64002 0.57% 94 85092 0.75% 95 108436 0.96% 96 143381 1.27% 97 195405 1.73% 98 274236 2.42% 99 370919 3.27% 100 9932211 87.69% 11326771 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.71 fanout-score-rank=10 prefix-density=0.55 prefix-fanout=3.4 sequence=ACCTCCTCCAGCTCCTTGAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=34 fanout-score=34.46 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=9.2 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.75 fanout-score-rank=11 prefix-density=0.56 prefix-fanout=3.4 sequence=ACCTCCTCCAGCTCCTTGAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=33 fanout-score=31.89 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=8.9 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618231 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:24:06 Started mapping on | Dec 07 08:24:06 Finished on | Dec 07 08:24:39 Mapping speed, Million of reads per hour | 1235.65 Number of input reads | 11326771 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11011422 Uniquely mapped reads % | 97.22% Average mapped length | 198.13 Number of splices: Total | 6075773 Number of splices: Annotated (sjdb) | 5769081 Number of splices: GT/AG | 5985187 Number of splices: GC/AG | 68478 Number of splices: AT/AC | 1759 Number of splices: Non-canonical | 20349 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.23 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 131223 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 10723 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.12% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 184126 184126 184126 N_multimapping 131223 131223 131223 N_noFeature 269244 5491655 5554846 N_ambiguous 274323 19846 21414 UnstrandedReadsAssigned:10467855 PositiveStrandReadsAssigned:5499921 NegativeStrandReadsAssigned:5435162 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618231 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618231-trimmed-pair1.fastq SRR8618231-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,326,771 reads, 10,711,868 reads pseudoaligned [quant] estimated average fragment length: 158.837 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52973 SRR8618231.ke.tsv 35125 SRR8618231.se.tsv 88098 total ==> SRR8618231.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 778.284 0 0 PNS24247 1044 886.163 16.3441 2.23351 PNS24249 1928 1770.16 50.0541 3.42426 PNS24246 1044 886.163 16.3441 2.23351 PNS24248 1044 886.163 16.3441 2.23351 PNS24244 1471 1313.16 68.9136 6.35517 PNS24243 293 139.934 1 0.865402 KQK14069 1603 1445.16 7268.22 609.049 KQK14071 474 317.067 557.223 212.823 ==> SRR8618231.se.tsv <== BRADI_1g14170v3 8341 BRADI_1g53295v3 174 BRADI_1g59795v3 396 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 394 BRADI_1g74790v3 25 BRADI_1g09890v3 0 BRADI_1g77505v3 164 BRADI_1g48960v3 0 SRR8618231 completed mapping pipeline successfully