Starting /dee2/code/volunteer_pipeline.sh SRR8618232 current disk space = 1544467087360 free memory = 1599446576 SRR8618232 SRAfilesize 82dc809e9825721e7ca41b02067803f7 SRR8618232.sra SRR8618232.sra file validated SRR8618232 is paired end SRR8618232 is conventional basespace SRR8618232 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618232_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04675 34.0 31.0 34.0 31.0 34.0 2 33.18675 34.0 33.0 34.0 31.0 34.0 3 33.2735 34.0 34.0 34.0 31.0 34.0 4 34.584 37.0 37.0 37.0 35.0 37.0 5 35.515 37.0 37.0 37.0 35.0 37.0 6 36.23925 37.0 37.0 37.0 35.0 37.0 7 36.25525 37.0 37.0 37.0 35.0 37.0 8 36.36775 37.0 37.0 37.0 35.0 37.0 9 38.3265 39.0 39.0 39.0 37.0 39.0 10-11 38.37975 39.0 39.0 39.0 37.0 39.0 12-13 38.351125 39.0 39.0 39.0 37.0 39.0 14-15 39.926375 41.0 40.0 41.0 38.0 41.0 16-17 39.868750000000006 41.0 40.0 41.0 38.0 41.0 18-19 39.810375 41.0 40.0 41.0 38.0 41.0 20-21 39.67425 41.0 40.0 41.0 37.0 41.0 22-23 39.6375 41.0 39.5 41.0 37.0 41.0 24-25 39.463375 41.0 39.0 41.0 37.0 41.0 26-27 39.367375 40.5 39.0 41.0 36.0 41.0 28-29 39.22175 40.0 39.0 41.0 36.0 41.0 30-31 38.959875 40.0 38.0 41.0 35.0 41.0 32-33 38.909499999999994 40.0 38.0 41.0 35.0 41.0 34-35 39.164 40.0 38.5 41.0 35.0 41.0 36-37 39.1545 40.0 38.0 41.0 35.0 41.0 38-39 39.07875 40.0 38.0 41.0 35.0 41.0 40-41 38.9345 40.0 38.0 41.0 35.0 41.0 42-43 38.7265 40.0 37.5 41.0 35.0 41.0 44-45 38.503 40.0 37.0 41.0 35.0 41.0 46-47 38.274249999999995 40.0 36.0 41.0 34.0 41.0 48-49 38.022125 39.5 35.5 41.0 34.0 41.0 50-51 37.857124999999996 39.0 35.0 41.0 33.5 41.0 52-53 37.60575 39.0 35.0 41.0 33.0 41.0 54-55 37.37775 39.0 35.0 41.0 33.0 41.0 56-57 37.036874999999995 38.0 35.0 41.0 33.0 41.0 58-59 36.868875 37.0 35.0 40.5 33.0 41.0 60-61 36.586625 37.0 35.0 40.0 33.0 41.0 62-63 36.347 36.0 35.0 40.0 32.0 41.0 64-65 36.04675 36.0 35.0 39.0 32.0 41.0 66-67 35.785375 35.0 35.0 39.0 32.0 41.0 68-69 35.4435 35.0 34.0 38.5 31.0 40.5 70-71 35.056875 35.0 34.0 37.0 31.0 40.0 72-73 34.670375 35.0 34.0 37.0 31.0 39.0 74-75 34.44075 35.0 34.0 36.0 30.0 39.0 76-77 33.409875 34.5 32.5 35.0 28.5 37.0 78-79 33.926249999999996 35.0 33.0 35.0 30.0 37.0 80-81 33.85425 35.0 33.0 35.0 30.0 37.0 82-83 33.582499999999996 35.0 33.0 35.0 29.5 36.0 84-85 33.356624999999994 35.0 33.0 35.0 29.0 36.0 86-87 33.235749999999996 35.0 33.0 35.0 29.0 36.0 88-89 32.8735 35.0 33.0 35.0 29.0 35.5 90-91 32.497749999999996 35.0 33.0 35.0 27.0 35.0 92-93 32.246750000000006 35.0 32.5 35.0 27.0 35.0 94-95 32.070125 35.0 32.0 35.0 27.0 35.0 96-97 31.74075 34.5 32.0 35.0 25.5 35.0 98-99 31.427125 34.0 32.0 35.0 24.5 35.0 100 30.98525 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0044537122850414335 1101 2 -0.03725157038410032 1101 3 0.03529502625887915 1101 4 -1.50713108845639 1101 5 -0.7738132015240424 1101 6 -0.1347955926269151 1101 7 -0.05661105962310842 1101 8 0.021573473380705366 1101 9 0.022654721449903548 1101 10-11 -0.06793842034805664 1101 12-13 -0.02006744928431914 1101 14-15 0.02046648130985318 1101 16-17 0.1283853362166596 1101 18-19 0.28475440222428716 1101 20-21 0.035616826279479596 1101 22-23 0.23877561528163938 1101 24-25 0.03813973844093965 1101 26-27 0.06528678817835498 1101 28-29 0.05820718772525879 1101 30-31 -0.01971990526207179 1101 32-33 -0.18470033982082157 1101 34-35 -0.12996859231798652 1101 36-37 0.021521985377404462 1101 38-39 -7.465760477813888E-4 1101 40-41 0.025628153640198548 1101 42-43 0.10136700648748587 1101 44-45 0.0578982597054889 1101 46-47 0.08129955720317383 1101 48-49 0.07609926887035812 1101 50-51 0.11511430336732076 1101 52-53 0.2108948614972732 1101 54-55 -0.03955565853156173 1101 56-57 0.20108639686953467 1101 58-59 0.24752857584182664 1101 60-61 0.04066265060241392 1101 62-63 -0.002381320152402111 1101 64-65 0.08983369374935535 1101 66-67 0.04546390690968849 1101 68-69 -0.09270414993306275 1101 70-71 -0.043906394810008464 1101 72-73 -0.06755226032333894 1101 74-75 -0.01843270517969131 1101 76-77 -0.045309442899807095 1101 78-79 -0.2943569148388434 1101 80-81 -0.09493100607558347 1101 82-83 -0.024212233549583573 1101 84-85 -0.19019668417259084 1101 86-87 -0.49796622386983813 1101 88-89 -0.5299660179178289 1101 90-91 -0.32460611677479534 1101 92-93 -0.45534702914221015 1101 94-95 -0.5240706415405256 1101 96-97 -0.5708346205334145 1101 98-99 -0.5801539491298549 1101 100 -0.5083668005354731 1104 1 -0.004453712285034328 1104 2 0.03725157038410032 1104 3 -0.03529502625887915 1104 4 1.50713108845639 1104 5 0.7738132015240424 1104 6 0.1347955926269222 1104 7 0.05661105962310842 1104 8 -0.02157347338069826 1104 9 -0.022654721449903548 1104 10-11 0.06793842034805664 1104 12-13 0.020067449284312033 1104 14-15 -0.02046648130985318 1104 16-17 -0.1283853362166596 1104 18-19 -0.28475440222428006 1104 20-21 -0.03561682627947249 1104 22-23 -0.23877561528163938 1104 24-25 -0.03813973844094676 1104 26-27 -0.06528678817835498 1104 28-29 -0.05820718772525879 1104 30-31 0.01971990526207179 1104 32-33 0.18470033982082157 1104 34-35 0.12996859231798652 1104 36-37 -0.021521985377411568 1104 38-39 7.465760477813888E-4 1104 40-41 -0.025628153640198548 1104 42-43 -0.10136700648748587 1104 44-45 -0.0578982597054889 1104 46-47 -0.08129955720317383 1104 48-49 -0.07609926887035101 1104 50-51 -0.11511430336732076 1104 52-53 -0.2108948614972732 1104 54-55 0.03955565853156884 1104 56-57 -0.20108639686952756 1104 58-59 -0.24752857584182664 1104 60-61 -0.040662650602406814 1104 62-63 0.0023813201524092165 1104 64-65 -0.08983369374935535 1104 66-67 -0.045463906909695595 1104 68-69 0.09270414993306275 1104 70-71 0.043906394810008464 1104 72-73 0.06755226032334605 1104 74-75 0.018432705179698416 1104 76-77 0.045309442899807095 1104 78-79 0.2943569148388434 1104 80-81 0.09493100607559057 1104 82-83 0.024212233549583573 1104 84-85 0.19019668417259084 1104 86-87 0.49796622386983813 1104 88-89 0.5299660179178289 1104 90-91 0.32460611677479534 1104 92-93 0.45534702914221015 1104 94-95 0.5240706415405185 1104 96-97 0.570834620533418 1104 98-99 0.5801539491298549 1104 100 0.5083668005354731 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 9.0 28 34.0 29 45.0 30 82.0 31 101.0 32 123.0 33 191.0 34 239.0 35 439.0 36 699.0 37 904.0 38 940.0 39 193.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.999999999999996 11.025 11.65 48.325 2 24.425 19.3 32.375 23.9 3 26.150000000000002 24.224999999999998 22.125 27.500000000000004 4 30.6079108043536 29.200955667640034 16.45872046721529 23.73241306079108 5 29.075 30.575000000000003 19.7 20.65 6 22.71135567783892 32.51625812906453 19.959979989995 24.81240620310155 7 20.849999999999998 14.649999999999999 37.775 26.724999999999998 8 21.75 19.25 25.45 33.550000000000004 9 22.650000000000002 18.475 28.9 29.975 10-11 27.9125 26.9125 19.3375 25.837500000000002 12-13 25.2 21.0 26.2875 27.5125 14-15 25.662499999999998 22.875 24.6 26.8625 16-17 25.874999999999996 23.2375 22.7625 28.125 18-19 26.075 24.65 23.05 26.224999999999998 20-21 25.412499999999998 23.9125 23.2375 27.437499999999996 22-23 26.275 24.1375 23.150000000000002 26.437500000000004 24-25 25.887500000000003 24.6625 22.7125 26.737499999999997 26-27 26.487500000000004 24.375 22.7625 26.375 28-29 25.687500000000004 24.175 23.3375 26.8 30-31 25.775 23.6875 23.8375 26.700000000000003 32-33 26.087500000000002 24.025 23.7625 26.125 34-35 25.95 24.075 23.225 26.75 36-37 26.5875 23.849999999999998 23.0125 26.55 38-39 24.625 24.1625 24.3 26.9125 40-41 25.874999999999996 23.6125 23.5125 27.0 42-43 25.7 23.95 22.912499999999998 27.437499999999996 44-45 26.1625 23.849999999999998 23.4625 26.525 46-47 26.674999999999997 23.3375 22.7375 27.250000000000004 48-49 25.6 23.674999999999997 23.3875 27.3375 50-51 26.724999999999998 23.1375 24.224999999999998 25.912499999999998 52-53 26.224999999999998 23.8375 23.2625 26.674999999999997 54-55 25.825 23.225 23.3875 27.5625 56-57 26.5875 23.275000000000002 23.6875 26.450000000000003 58-59 25.8625 24.087500000000002 23.5 26.55 60-61 25.8 23.625 23.7375 26.8375 62-63 26.200000000000003 23.825 23.7 26.275 64-65 26.450000000000003 23.65 22.787499999999998 27.1125 66-67 26.400000000000002 23.1625 23.200000000000003 27.237499999999997 68-69 26.275 23.875 23.2375 26.6125 70-71 26.5 23.9 22.95 26.650000000000002 72-73 26.5375 23.0875 23.974999999999998 26.400000000000002 74-75 26.1 24.4125 22.9875 26.5 76-77 26.787499999999998 24.275 22.3125 26.625 78-79 26.0125 23.5875 23.3875 27.0125 80-81 27.075 22.85 22.95 27.125 82-83 27.487499999999997 23.8375 22.8125 25.8625 84-85 26.85 22.650000000000002 23.8625 26.637499999999996 86-87 26.700000000000003 24.0375 23.45 25.8125 88-89 26.85 23.575 22.875 26.700000000000003 90-91 26.85 23.45 22.8125 26.887499999999996 92-93 25.575 24.275 23.7375 26.4125 94-95 26.787499999999998 22.3375 24.2875 26.5875 96-97 26.875 23.575 23.1375 26.4125 98-99 27.1 23.8625 23.1625 25.874999999999996 100 28.625 23.0 22.400000000000002 25.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.0 27 0.5 28 2.0 29 4.0 30 4.0 31 7.5 32 10.0 33 11.0 34 17.5 35 28.0 36 35.5 37 46.5 38 55.0 39 67.0 40 96.0 41 134.0 42 142.5 43 135.0 44 149.5 45 155.5 46 156.0 47 159.5 48 153.5 49 139.0 50 133.5 51 126.5 52 111.0 53 102.5 54 93.0 55 85.0 56 86.0 57 88.5 58 97.5 59 105.5 60 89.5 61 79.0 62 93.0 63 98.5 64 93.5 65 92.0 66 95.0 67 92.5 68 82.5 69 85.5 70 74.5 71 58.5 72 50.5 73 41.0 74 37.0 75 25.0 76 16.0 77 12.5 78 10.0 79 9.5 80 9.0 81 5.5 82 3.0 83 2.0 84 1.0 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.825 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618232 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618232_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.56175 34.0 31.0 34.0 31.0 34.0 2 32.94825 34.0 31.0 34.0 31.0 34.0 3 33.05825 34.0 33.0 34.0 31.0 34.0 4 36.455 37.0 37.0 37.0 35.0 37.0 5 36.4835 37.0 37.0 37.0 35.0 37.0 6 36.5485 37.0 37.0 37.0 35.0 37.0 7 36.4905 37.0 37.0 37.0 35.0 37.0 8 36.57025 37.0 37.0 37.0 35.0 37.0 9 38.4025 39.0 39.0 39.0 37.0 39.0 10-11 38.38575 39.0 39.0 39.0 37.0 39.0 12-13 38.31375 39.0 39.0 39.0 37.0 39.0 14-15 39.9605 41.0 40.0 41.0 38.0 41.0 16-17 39.793625000000006 41.0 40.0 41.0 38.0 41.0 18-19 39.769375 41.0 40.0 41.0 37.5 41.0 20-21 39.7555 41.0 40.0 41.0 37.5 41.0 22-23 39.741625 41.0 40.0 41.0 37.5 41.0 24-25 39.62412500000001 41.0 39.5 41.0 37.0 41.0 26-27 39.546875 41.0 39.0 41.0 37.0 41.0 28-29 39.478125000000006 41.0 39.0 41.0 37.0 41.0 30-31 39.29725 40.0 39.0 41.0 36.0 41.0 32-33 39.2365 40.5 39.0 41.0 36.0 41.0 34-35 39.197 40.0 38.5 41.0 35.0 41.0 36-37 39.004125 40.0 38.0 41.0 35.0 41.0 38-39 38.801249999999996 40.0 38.0 41.0 35.0 41.0 40-41 38.6635 40.0 38.0 41.0 35.0 41.0 42-43 38.319125 40.0 37.0 41.0 33.5 41.0 44-45 38.054500000000004 40.0 36.5 41.0 33.0 41.0 46-47 37.761875 39.0 35.0 41.0 33.0 41.0 48-49 37.730875 39.0 35.0 41.0 33.0 41.0 50-51 37.137625 38.5 35.0 40.0 32.0 40.5 52-53 37.1175 38.5 35.0 40.0 33.0 41.0 54-55 37.361374999999995 38.5 35.0 41.0 33.0 41.0 56-57 37.3515 38.0 35.0 41.0 33.0 41.0 58-59 37.151875000000004 38.0 35.0 41.0 33.0 41.0 60-61 36.926625 37.0 35.0 40.5 33.0 41.0 62-63 36.57625 36.5 35.0 40.0 33.0 41.0 64-65 36.316500000000005 36.0 35.0 39.5 32.5 41.0 66-67 36.013875 35.0 35.0 39.0 32.0 41.0 68-69 35.612375 35.0 35.0 39.0 31.5 41.0 70-71 35.336375000000004 35.0 34.5 37.5 31.0 40.5 72-73 35.088125 35.0 34.0 37.0 31.0 39.5 74-75 34.7555 35.0 34.0 36.5 31.0 39.0 76-77 34.5445 35.0 34.0 36.0 31.0 39.0 78-79 34.217625 35.0 34.0 36.0 30.5 37.0 80-81 33.975375 35.0 34.0 35.0 30.0 37.0 82-83 33.72075 35.0 33.0 35.0 30.0 36.5 84-85 33.43075 35.0 33.0 35.0 29.0 36.0 86-87 33.381 35.0 33.0 35.0 29.0 36.0 88-89 33.22 35.0 33.0 35.0 29.0 35.5 90-91 32.89825 35.0 33.0 35.0 29.0 35.0 92-93 32.68175 35.0 33.0 35.0 27.5 35.0 94-95 32.35625 35.0 33.0 35.0 27.0 35.0 96-97 32.042500000000004 35.0 32.0 35.0 27.0 35.0 98-99 31.6785 35.0 32.0 35.0 25.5 35.0 100 31.407 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.09435176603851403 1101 2 0.0062300483987201005 1101 3 0.09051590979301949 1101 4 0.061399443929566644 1101 5 0.061399443929566644 1101 6 0.13948100092678573 1101 7 -0.024379569560295522 1101 8 -0.017789105138504624 1101 9 0.05694573164452521 1101 10-11 0.12245134383688594 1101 12-13 0.0774637009576793 1101 14-15 0.10056894243641779 1101 16-17 0.003578416229018444 1101 18-19 -0.03389197816908762 1101 20-21 0.031163113994438163 1101 22-23 0.07853207702605403 1101 24-25 0.05952013180928617 1101 26-27 -0.019822881268666492 1101 28-29 0.05322572340644882 1101 30-31 0.051578107300997544 1101 32-33 0.04993049119555337 1101 34-35 0.06873648439913893 1101 36-37 0.06533827618164878 1101 38-39 -0.17063124292040044 1101 40-41 -0.3648439913500141 1101 42-43 -0.19154824425908856 1101 44-45 -0.20893831737205915 1101 46-47 -0.2112552775203369 1101 48-49 -0.07606065286788066 1101 50-51 -0.13377870456184127 1101 52-53 -0.14568530532385893 1101 54-55 -0.1155133353928548 1101 56-57 0.03403357017814557 1101 58-59 0.127999176191949 1101 60-61 0.08796725362989832 1101 62-63 0.14488724127278374 1101 64-65 0.0547188755020116 1101 66-67 0.2508752960560159 1101 68-69 0.11465091133765526 1101 70-71 -0.15566110596230942 1101 72-73 -0.003089280197713151 1101 74-75 -0.147075481412827 1101 76-77 -0.010001544640097393 1101 78-79 -0.05601894758521553 1101 80-81 -0.18095458758109118 1101 82-83 -0.1414632890536538 1101 84-85 -0.24254711152301667 1101 86-87 -0.4494902687673772 1101 88-89 -0.2631036968386411 1101 90-91 -0.31380650808362276 1101 92-93 -0.15587992997631517 1101 94-95 -0.17100453094428758 1101 96-97 -0.40631757800432666 1101 98-99 -0.7614818247348367 1101 100 -1.1512717536813923 1104 1 0.09435176603851403 1104 2 -0.0062300483987201005 1104 3 -0.09051590979301949 1104 4 -0.061399443929566644 1104 5 -0.061399443929566644 1104 6 -0.13948100092678573 1104 7 0.024379569560295522 1104 8 0.01778910513849752 1104 9 -0.05694573164452521 1104 10-11 -0.12245134383688594 1104 12-13 -0.0774637009576793 1104 14-15 -0.10056894243641068 1104 16-17 -0.003578416229018444 1104 18-19 0.03389197816908762 1104 20-21 -0.031163113994438163 1104 22-23 -0.07853207702605403 1104 24-25 -0.059520131809293275 1104 26-27 0.019822881268659387 1104 28-29 -0.05322572340644882 1104 30-31 -0.051578107300997544 1104 32-33 -0.04993049119554627 1104 34-35 -0.06873648439913183 1104 36-37 -0.06533827618165589 1104 38-39 0.17063124292040044 1104 40-41 0.3648439913500141 1104 42-43 0.19154824425908856 1104 44-45 0.20893831737205204 1104 46-47 0.2112552775203369 1104 48-49 0.07606065286788066 1104 50-51 0.13377870456183416 1104 52-53 0.14568530532385893 1104 54-55 0.1155133353928548 1104 56-57 -0.03403357017814557 1104 58-59 -0.127999176191949 1104 60-61 -0.08796725362990543 1104 62-63 -0.14488724127278374 1104 64-65 -0.054718875502004494 1104 66-67 -0.250875296056023 1104 68-69 -0.11465091133766236 1104 70-71 0.15566110596230942 1104 72-73 0.003089280197713151 1104 74-75 0.147075481412827 1104 76-77 0.010001544640097393 1104 78-79 0.05601894758520842 1104 80-81 0.18095458758109118 1104 82-83 0.1414632890536538 1104 84-85 0.24254711152301667 1104 86-87 0.4494902687673772 1104 88-89 0.263103696838634 1104 90-91 0.31380650808361565 1104 92-93 0.15587992997631517 1104 94-95 0.17100453094428758 1104 96-97 0.40631757800432666 1104 98-99 0.7614818247348367 1104 100 1.1512717536813923 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 24.0 28 25.0 29 45.0 30 52.0 31 71.0 32 140.0 33 150.0 34 247.0 35 435.0 36 708.0 37 906.0 38 975.0 39 221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.425 10.4 12.35 49.825 2 24.875 19.275000000000002 32.15 23.7 3 25.35 23.325000000000003 23.05 28.275 4 29.525000000000002 27.400000000000002 17.05 26.025 5 28.65 30.825000000000003 18.675 21.85 6 21.224999999999998 32.324999999999996 21.3 25.15 7 19.875 14.649999999999999 39.725 25.75 8 22.775000000000002 19.925 24.675 32.625 9 22.775000000000002 18.525 28.475 30.225 10-11 26.356589147286826 26.694173543385848 20.142535633908476 26.806701675418854 12-13 23.95 21.099999999999998 26.400000000000002 28.549999999999997 14-15 25.424999999999997 23.75 23.5125 27.3125 16-17 25.8125 23.375 23.325000000000003 27.487499999999997 18-19 26.0625 23.4875 23.3875 27.0625 20-21 25.75 24.875 23.549999999999997 25.825 22-23 26.025 24.0625 23.0 26.9125 24-25 25.5125 23.799999999999997 23.1625 27.525 26-27 26.3125 23.925 23.6875 26.075 28-29 26.7625 24.224999999999998 23.05 25.9625 30-31 25.137500000000003 23.875 23.825 27.1625 32-33 25.9875 24.175 23.474999999999998 26.3625 34-35 26.1625 22.9875 23.549999999999997 27.3 36-37 25.8625 23.925 23.150000000000002 27.0625 38-39 26.0625 23.775 22.975 27.187499999999996 40-41 26.525 23.849999999999998 22.7125 26.9125 42-43 26.3625 23.075000000000003 23.175 27.3875 44-45 25.8 24.099999999999998 23.974999999999998 26.125 46-47 26.437500000000004 23.674999999999997 23.0375 26.85 48-49 25.9875 22.625 24.2875 27.1 50-51 26.137500000000003 24.1375 24.1125 25.6125 52-53 25.974999999999998 23.875 23.65 26.5 54-55 26.137500000000003 23.7625 23.6625 26.437500000000004 56-57 26.437500000000004 23.8125 23.325000000000003 26.424999999999997 58-59 26.3 22.925 23.599999999999998 27.175 60-61 25.674999999999997 23.1625 23.3625 27.800000000000004 62-63 26.950000000000003 23.6125 23.724999999999998 25.7125 64-65 26.4625 24.474999999999998 23.0125 26.05 66-67 26.0625 23.1625 23.7 27.075 68-69 26.8 24.4 23.5625 25.2375 70-71 25.275 23.275000000000002 23.4625 27.987499999999997 72-73 26.137500000000003 23.275000000000002 23.7625 26.825 74-75 25.95 24.099999999999998 23.4375 26.5125 76-77 27.075 24.3125 22.7 25.912499999999998 78-79 26.375 23.474999999999998 23.05 27.1 80-81 26.1125 24.1375 23.425 26.325 82-83 27.500000000000004 23.5 22.975 26.025 84-85 25.4625 23.6375 24.2375 26.6625 86-87 26.237500000000004 24.15 23.400000000000002 26.2125 88-89 26.4125 23.175 24.45 25.9625 90-91 25.95 23.400000000000002 23.0875 27.5625 92-93 25.825 23.400000000000002 24.375 26.400000000000002 94-95 26.7625 23.1125 22.85 27.275 96-97 26.737499999999997 23.025000000000002 23.2875 26.950000000000003 98-99 26.6 24.0125 23.6625 25.724999999999998 100 27.55 23.3 22.875 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 1.5 29 3.0 30 5.0 31 6.0 32 9.0 33 12.0 34 19.5 35 28.5 36 37.5 37 55.0 38 64.0 39 82.0 40 115.5 41 123.5 42 138.5 43 144.5 44 138.5 45 149.5 46 150.5 47 145.5 48 151.5 49 144.5 50 124.5 51 112.5 52 110.0 53 111.0 54 96.0 55 88.0 56 87.5 57 87.0 58 87.5 59 99.5 60 100.0 61 89.5 62 86.0 63 89.5 64 100.0 65 98.0 66 89.0 67 86.0 68 86.5 69 82.5 70 74.0 71 58.0 72 43.0 73 38.5 74 35.0 75 29.5 76 26.0 77 18.0 78 14.0 79 11.5 80 7.0 81 4.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 567018 spots for SRR8618232.sra Written 567018 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra Read 566999 spots for SRR8618232.sra Written 566999 spots for SRR8618232.sra SRR ids: ['SRR8618232.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3s1xgzcs SRR8618232.sra spots: 11339999 blocks: [[1, 566999], [567000, 1133998], [1133999, 1700997], [1700998, 2267996], [2267997, 2834995], [2834996, 3401994], [3401995, 3968993], [3968994, 4535992], [4535993, 5102991], [5102992, 5669990], [5669991, 6236989], [6236990, 6803988], [6803989, 7370987], [7370988, 7937986], [7937987, 8504985], [8504986, 9071984], [9071985, 9638983], [9638984, 10205982], [10205983, 10772981], [10772982, 11339999]] SRR8618232 file size 2951319 SRR8618232 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618232 SRR8618232_1.fastq SRR8618232_2.fastq Input file: SRR8618232_1.fastq Paired file: SRR8618232_2.fastq trimmed: SRR8618232-trimmed-pair1.fastq, SRR8618232-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:34:44 2024 >> started Sat Dec 7 08:35:02 2024 >> done (18.036s) 11339999 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11339999 (100.00%) read pairs available; of these: 1354392 (11.94%) trimmed read pairs available after processing 9985607 (88.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 8 0.00% 82 37 0.00% 83 98 0.00% 84 4556 0.04% 85 5155 0.05% 86 5835 0.05% 87 6783 0.06% 88 8198 0.07% 89 10231 0.09% 90 16261 0.14% 91 30136 0.27% 92 42874 0.38% 93 59403 0.52% 94 80705 0.71% 95 104378 0.92% 96 139982 1.23% 97 193832 1.71% 98 274829 2.42% 99 371091 3.27% 100 9985607 88.06% 11339999 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=13 prefix-density=0.33 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=40.71 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=9.6 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=15 prefix-density=0.34 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=32 fanout-score=41.70 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=9.8 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618232 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:35:34 Started mapping on | Dec 07 08:35:34 Finished on | Dec 07 08:36:23 Mapping speed, Million of reads per hour | 833.14 Number of input reads | 11339999 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11023487 Uniquely mapped reads % | 97.21% Average mapped length | 198.19 Number of splices: Total | 6891117 Number of splices: Annotated (sjdb) | 6545147 Number of splices: GT/AG | 6788329 Number of splices: GC/AG | 81579 Number of splices: AT/AC | 2508 Number of splices: Non-canonical | 18701 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 123536 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 9035 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.29% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 192976 192976 192976 N_multimapping 123536 123536 123536 N_noFeature 321224 5535459 5591505 N_ambiguous 255453 18996 19942 UnstrandedReadsAssigned:10446810 PositiveStrandReadsAssigned:5469032 NegativeStrandReadsAssigned:5412040 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618232 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618232-trimmed-pair1.fastq SRR8618232-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,339,999 reads, 10,691,249 reads pseudoaligned [quant] estimated average fragment length: 163.911 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR8618232.ke.tsv 35125 SRR8618232.se.tsv 88098 total ==> SRR8618232.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.251 0 0 PNS24247 1044 881.089 19.0149 2.86783 PNS24249 1928 1765.09 82.755 6.23026 PNS24246 1044 881.089 19.0149 2.86783 PNS24248 1044 881.089 19.0149 2.86783 PNS24244 1471 1308.09 23.2002 2.35685 PNS24243 293 136.425 2 1.94812 KQK14069 1603 1440.09 3953.17 364.783 KQK14071 474 312.582 398.119 169.249 ==> SRR8618232.se.tsv <== BRADI_1g14170v3 4654 BRADI_1g53295v3 246 BRADI_1g59795v3 282 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 1134 BRADI_1g74790v3 32 BRADI_1g09890v3 9 BRADI_1g77505v3 138 BRADI_1g48960v3 0 SRR8618232 completed mapping pipeline successfully