Starting /dee2/code/volunteer_pipeline.sh SRR8618233 current disk space = 1544484085760 free memory = 1597453816 SRR8618233 SRAfilesize 7f926874e1533ee52812c2a6dc59f8dc SRR8618233.sra SRR8618233.sra file validated SRR8618233 is paired end SRR8618233 is conventional basespace SRR8618233 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618233_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03825 34.0 31.0 34.0 31.0 34.0 2 33.188 34.0 33.0 34.0 31.0 34.0 3 33.244 34.0 34.0 34.0 31.0 34.0 4 34.948 37.0 37.0 37.0 35.0 37.0 5 35.68825 37.0 37.0 37.0 35.0 37.0 6 36.29925 37.0 37.0 37.0 35.0 37.0 7 36.334 37.0 37.0 37.0 35.0 37.0 8 36.45075 37.0 37.0 37.0 35.0 37.0 9 38.33625 39.0 39.0 39.0 37.0 39.0 10-11 38.353 39.0 39.0 39.0 37.0 39.0 12-13 38.374125 39.0 39.0 39.0 37.0 39.0 14-15 39.8955 41.0 40.0 41.0 38.0 41.0 16-17 39.879875 41.0 40.0 41.0 38.0 41.0 18-19 39.786125 41.0 40.0 41.0 37.5 41.0 20-21 39.685 41.0 39.5 41.0 37.5 41.0 22-23 39.6425 41.0 39.0 41.0 37.0 41.0 24-25 39.50775 41.0 39.0 41.0 37.0 41.0 26-27 39.383125 40.0 39.0 41.0 36.0 41.0 28-29 39.211375000000004 40.0 38.5 41.0 36.0 41.0 30-31 39.003125 40.0 38.0 41.0 35.0 41.0 32-33 38.840999999999994 40.0 38.0 41.0 35.0 41.0 34-35 39.056875000000005 40.0 38.0 41.0 35.0 41.0 36-37 39.12125 40.0 38.0 41.0 35.0 41.0 38-39 39.020375 40.0 38.0 41.0 35.0 41.0 40-41 38.80575 40.0 38.0 41.0 35.0 41.0 42-43 38.529375 40.0 37.0 41.0 35.0 41.0 44-45 38.335499999999996 40.0 36.5 41.0 34.5 41.0 46-47 38.073499999999996 40.0 35.5 41.0 34.0 41.0 48-49 37.867374999999996 39.5 35.0 41.0 33.5 41.0 50-51 37.538375 39.0 35.0 41.0 33.0 41.0 52-53 37.436499999999995 39.0 35.0 41.0 33.0 41.0 54-55 37.25575 38.0 35.0 41.0 33.0 41.0 56-57 36.965375 37.5 35.0 40.5 33.0 41.0 58-59 36.76975 37.0 35.0 40.0 33.0 41.0 60-61 36.4245 36.0 35.0 40.0 32.5 41.0 62-63 35.927375 35.5 35.0 39.0 31.0 41.0 64-65 35.81162500000001 35.0 35.0 39.0 31.5 41.0 66-67 35.58 35.0 34.5 39.0 31.5 41.0 68-69 35.26225 35.0 34.0 38.0 31.0 40.0 70-71 34.910125 35.0 34.0 37.0 31.0 39.5 72-73 34.664375 35.0 34.0 36.5 31.0 39.0 74-75 34.305625000000006 35.0 33.5 36.0 30.0 39.0 76-77 33.399625 34.5 32.5 35.0 28.5 37.0 78-79 33.97125 35.0 33.0 35.0 30.0 37.0 80-81 33.854625 35.0 33.5 35.0 30.0 37.0 82-83 33.600750000000005 35.0 33.0 35.0 29.5 36.0 84-85 33.47625 35.0 33.0 35.0 29.5 36.0 86-87 33.278999999999996 35.0 33.0 35.0 29.0 36.0 88-89 32.972 35.0 33.0 35.0 29.0 35.0 90-91 32.745374999999996 35.0 33.0 35.0 28.5 35.0 92-93 32.46925 35.0 33.0 35.0 27.0 35.0 94-95 32.264250000000004 35.0 32.5 35.0 27.0 35.0 96-97 31.864625 34.5 32.0 35.0 26.0 35.0 98-99 31.4825 34.0 32.0 35.0 25.0 35.0 100 31.145 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.03298553108376012 1101 2 -0.12057001876076612 1101 3 -0.03898640487265226 1101 4 -1.4970830870447926 1101 5 -0.7897509701626788 1101 6 -0.2389041659170914 1101 7 -0.22128703965459806 1101 8 -0.04289275526200953 1101 9 0.11111253887075634 1101 10-11 0.052851378787487135 1101 12-13 0.03358947341369145 1101 14-15 0.16470920819305235 1101 16-17 0.03772712086556851 1101 18-19 0.1636362468196637 1101 20-21 -0.05058338259104289 1101 22-23 0.0938359332836427 1101 24-25 -0.0925894991133589 1101 26-27 0.0022808460332512936 1101 28-29 0.04193544241988434 1101 30-31 -0.03744442445581342 1101 32-33 0.19986636169720384 1101 34-35 0.08124309321271284 1101 36-37 0.0669219500912277 1101 38-39 0.261847549536121 1101 40-41 0.3168448510703925 1101 42-43 0.19951299118500998 1101 44-45 0.35660867106987837 1101 46-47 0.40537380175271664 1101 48-49 0.21416180514507488 1101 50-51 0.6021048032690004 1101 52-53 0.40900388065071525 1101 54-55 0.19585078769499376 1101 56-57 0.22006630515792125 1101 58-59 0.17132044923029355 1101 60-61 0.28039628896713253 1101 62-63 0.5256739739405347 1101 64-65 0.36251959600112826 1101 66-67 0.33072267482202733 1101 68-69 0.176184112461776 1101 70-71 0.02880933412145481 1101 72-73 0.02642568939374712 1101 74-75 0.2627341882758145 1101 76-77 -0.0017797023977763615 1101 78-79 0.06571406543137215 1101 80-81 0.1166765182082159 1101 82-83 -0.08908149366503437 1101 84-85 0.11203130220246749 1101 86-87 0.13369612705918854 1101 88-89 -0.15527742797666377 1101 90-91 0.19376911413225173 1101 92-93 -0.07894297242425097 1101 94-95 -0.19299169900542523 1101 96-97 -0.1358677494795799 1101 98-99 0.2484837192567646 1101 100 0.346598648197169 1104 1 -0.03298553108375302 1104 2 0.12057001876075901 1104 3 0.038986404872659364 1104 4 1.4970830870447926 1104 5 0.7897509701626788 1104 6 0.2389041659170914 1104 7 0.22128703965459096 1104 8 0.04289275526200953 1104 9 -0.11111253887075634 1104 10-11 -0.05285137878749424 1104 12-13 -0.03358947341369145 1104 14-15 -0.16470920819305235 1104 16-17 -0.0377271208655614 1104 18-19 -0.1636362468196637 1104 20-21 0.05058338259104289 1104 22-23 -0.09383593328364981 1104 24-25 0.0925894991133589 1104 26-27 -0.0022808460332512936 1104 28-29 -0.041935442419877234 1104 30-31 0.03744442445581342 1104 32-33 -0.19986636169721095 1104 34-35 -0.08124309321271994 1104 36-37 -0.0669219500912348 1104 38-39 -0.261847549536121 1104 40-41 -0.3168448510703925 1104 42-43 -0.19951299118500998 1104 44-45 -0.35660867106987837 1104 46-47 -0.40537380175271664 1104 48-49 -0.21416180514507488 1104 50-51 -0.6021048032690004 1104 52-53 -0.40900388065071525 1104 54-55 -0.19585078769499376 1104 56-57 -0.22006630515792125 1104 58-59 -0.17132044923029355 1104 60-61 -0.28039628896713253 1104 62-63 -0.5256739739405347 1104 64-65 -0.36251959600112826 1104 66-67 -0.33072267482202733 1104 68-69 -0.1761841124617689 1104 70-71 -0.02880933412145481 1104 72-73 -0.02642568939374712 1104 74-75 -0.2627341882758074 1104 76-77 0.001779702397783467 1104 78-79 -0.06571406543137215 1104 80-81 -0.116676518208223 1104 82-83 0.08908149366502727 1104 84-85 -0.11203130220246038 1104 86-87 -0.13369612705918854 1104 88-89 0.15527742797667088 1104 90-91 -0.19376911413225173 1104 92-93 0.07894297242425097 1104 94-95 0.19299169900542523 1104 96-97 0.1358677494795799 1104 98-99 -0.24848371925676815 1104 100 -0.346598648197169 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 9.0 28 23.0 29 41.0 30 81.0 31 82.0 32 144.0 33 185.0 34 273.0 35 459.0 36 767.0 37 894.0 38 878.0 39 162.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.475 10.75 12.15 47.625 2 25.525 19.15 32.550000000000004 22.775000000000002 3 25.525 23.525 21.875 29.075 4 29.944838455476752 28.2374573154715 16.86367218282112 24.95403204623063 5 29.225 28.349999999999998 19.55 22.875 6 22.425 31.424999999999997 21.175 24.975 7 21.275 13.200000000000001 37.425000000000004 28.1 8 22.85 19.625 24.55 32.975 9 23.45 18.15 28.199999999999996 30.2 10-11 26.987499999999997 27.187499999999996 18.4875 27.3375 12-13 25.412499999999998 20.962500000000002 25.3 28.325 14-15 25.7625 23.1875 23.325000000000003 27.725 16-17 24.7375 23.6375 22.9375 28.6875 18-19 25.7875 23.5875 23.425 27.200000000000003 20-21 26.6625 22.9625 22.9375 27.437499999999996 22-23 26.237500000000004 23.425 22.875 27.462500000000002 24-25 26.7625 23.474999999999998 22.7125 27.05 26-27 26.400000000000002 24.9375 21.8875 26.775 28-29 26.674999999999997 23.65 22.7375 26.937499999999996 30-31 26.35 23.425 22.900000000000002 27.325 32-33 26.05 23.6875 23.5625 26.700000000000003 34-35 26.974999999999998 23.3 23.2375 26.487500000000004 36-37 27.150000000000002 23.4375 22.662499999999998 26.75 38-39 26.487500000000004 23.400000000000002 23.175 26.937499999999996 40-41 26.7125 22.287499999999998 23.35 27.650000000000002 42-43 24.8125 23.65 24.1125 27.425 44-45 27.125 23.400000000000002 23.225 26.25 46-47 27.1 23.425 22.3 27.175 48-49 27.0625 22.8875 23.1375 26.9125 50-51 26.0125 24.212500000000002 22.5625 27.212500000000002 52-53 25.9625 22.7125 23.9 27.425 54-55 26.275 24.0375 22.8375 26.85 56-57 26.224999999999998 23.7875 22.775000000000002 27.212500000000002 58-59 26.1625 23.2625 23.3625 27.212500000000002 60-61 26.775 22.912499999999998 22.8125 27.500000000000004 62-63 26.625 23.6625 23.05 26.6625 64-65 26.450000000000003 23.549999999999997 23.599999999999998 26.400000000000002 66-67 26.9625 22.9625 22.4875 27.5875 68-69 26.7125 23.2625 22.0875 27.9375 70-71 25.8125 23.5125 23.5375 27.1375 72-73 27.0625 22.162499999999998 23.0625 27.712500000000002 74-75 25.687500000000004 23.3125 23.3375 27.6625 76-77 26.687499999999996 23.0875 24.25 25.974999999999998 78-79 26.8125 23.25 23.125 26.8125 80-81 26.25 23.549999999999997 23.525 26.674999999999997 82-83 26.437500000000004 23.3375 23.1375 27.0875 84-85 26.8125 22.3 23.9125 26.974999999999998 86-87 26.8625 23.974999999999998 23.0625 26.1 88-89 27.5875 22.6875 23.2875 26.437500000000004 90-91 27.1625 23.5625 22.8125 26.4625 92-93 26.825 22.9375 23.674999999999997 26.5625 94-95 28.050000000000004 22.9375 23.1125 25.900000000000002 96-97 26.2125 23.8375 23.0875 26.8625 98-99 27.8625 23.1875 22.75 26.200000000000003 100 28.050000000000004 24.2 21.05 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 2.5 29 4.0 30 6.0 31 11.0 32 15.0 33 18.0 34 17.5 35 20.5 36 30.5 37 41.0 38 64.0 39 78.0 40 86.0 41 99.0 42 115.5 43 135.5 44 154.5 45 147.0 46 133.5 47 144.0 48 131.5 49 120.5 50 120.0 51 124.0 52 128.5 53 110.5 54 99.0 55 89.0 56 88.5 57 98.0 58 90.5 59 99.0 60 106.0 61 106.0 62 115.5 63 107.0 64 95.0 65 95.5 66 94.5 67 89.5 68 88.0 69 81.5 70 66.0 71 57.5 72 56.5 73 48.5 74 38.5 75 35.0 76 26.5 77 21.0 78 16.0 79 12.0 80 10.0 81 3.5 82 2.0 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 4.825 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618233 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618233_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.11275 33.0 31.0 34.0 31.0 34.0 2 32.81125 34.0 31.0 34.0 31.0 34.0 3 32.97 34.0 31.0 34.0 31.0 34.0 4 36.4535 37.0 37.0 37.0 35.0 37.0 5 36.468 37.0 37.0 37.0 35.0 37.0 6 36.48125 37.0 37.0 37.0 35.0 37.0 7 36.4875 37.0 37.0 37.0 35.0 37.0 8 36.50075 37.0 37.0 37.0 35.0 37.0 9 38.36575 39.0 39.0 39.0 37.0 39.0 10-11 38.350125 39.0 39.0 39.0 37.0 39.0 12-13 38.270125 39.0 39.0 39.0 37.0 39.0 14-15 39.867125 41.0 40.0 41.0 38.0 41.0 16-17 39.730625 41.0 40.0 41.0 37.5 41.0 18-19 39.773375 41.0 40.0 41.0 37.5 41.0 20-21 39.744 41.0 40.0 41.0 37.5 41.0 22-23 39.69175 41.0 40.0 41.0 37.0 41.0 24-25 39.58425 41.0 39.0 41.0 37.0 41.0 26-27 39.5035 41.0 39.0 41.0 36.0 41.0 28-29 39.37949999999999 41.0 39.0 41.0 36.0 41.0 30-31 39.240625 40.0 38.5 41.0 36.0 41.0 32-33 39.16375 40.0 38.5 41.0 35.0 41.0 34-35 39.08775 40.0 38.0 41.0 35.0 41.0 36-37 38.95075 40.0 38.0 41.0 35.0 41.0 38-39 38.677125000000004 40.0 38.0 41.0 35.0 41.0 40-41 38.489 40.0 37.0 41.0 34.5 41.0 42-43 38.227999999999994 40.0 36.5 41.0 34.0 41.0 44-45 37.92725 39.5 35.5 41.0 33.0 41.0 46-47 37.709999999999994 39.0 35.0 41.0 33.0 41.0 48-49 37.490375 39.0 35.0 41.0 33.0 41.0 50-51 37.03425 38.0 34.5 40.0 32.0 40.5 52-53 37.002750000000006 38.0 35.0 40.0 33.0 41.0 54-55 37.238625 38.0 35.0 41.0 33.0 41.0 56-57 37.088499999999996 37.5 35.0 41.0 33.0 41.0 58-59 36.91375 37.0 35.0 40.5 33.0 41.0 60-61 36.669624999999996 36.5 35.0 40.0 33.0 41.0 62-63 36.396125 36.0 35.0 40.0 33.0 41.0 64-65 36.181250000000006 35.0 35.0 39.5 33.0 41.0 66-67 35.843125 35.0 35.0 39.0 32.0 41.0 68-69 35.567625 35.0 35.0 38.5 32.0 41.0 70-71 35.251999999999995 35.0 34.0 37.5 31.0 40.0 72-73 35.027125 35.0 34.0 37.0 31.0 39.0 74-75 34.7355 35.0 34.0 36.0 31.0 39.0 76-77 34.514875 35.0 34.0 36.0 31.0 38.5 78-79 34.214 35.0 34.0 35.5 31.0 37.0 80-81 34.041 35.0 34.0 35.0 30.5 37.0 82-83 33.692750000000004 35.0 33.0 35.0 30.0 36.0 84-85 33.39825 35.0 33.0 35.0 29.0 36.0 86-87 33.332875 35.0 33.0 35.0 29.0 36.0 88-89 33.09 35.0 33.0 35.0 29.0 35.5 90-91 32.83825 35.0 33.0 35.0 29.0 35.0 92-93 32.59025 35.0 33.0 35.0 27.0 35.0 94-95 32.358125 35.0 33.0 35.0 27.0 35.0 96-97 32.0385 35.0 32.5 35.0 27.0 35.0 98-99 31.60975 35.0 32.0 35.0 25.0 35.0 100 31.18825 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.23393127907275613 1101 2 0.20041890467991408 1101 3 -0.07639227981804453 1101 4 0.044743131762224664 1101 5 0.0788722983218122 1101 6 0.025673973940534722 1101 7 0.09548713731335567 1101 8 0.0643005833825896 1101 9 0.0018760761738363385 1101 10-11 0.18135617177661345 1101 12-13 0.25885996247847487 1101 14-15 0.22821310169360487 1101 16-17 0.1465459638662594 1101 18-19 0.051302973452237666 1101 20-21 -0.03010716763897392 1101 22-23 0.1289673871141801 1101 24-25 -0.023553750867364442 1101 26-27 0.08593328364730013 1101 28-29 0.0015291305800388955 1101 30-31 0.021048032689982676 1101 32-33 0.10761095834082823 1101 34-35 0.1266094420600865 1101 36-37 0.14429724242501862 1101 38-39 0.09697771838297342 1101 40-41 0.14725912980905065 1101 42-43 0.052877078461101235 1101 44-45 0.05412351263138504 1101 46-47 0.16605844105779966 1101 48-49 0.2523129706252689 1101 50-51 0.2903484875742066 1101 52-53 0.11115751329958101 1101 54-55 0.049510421217654255 1101 56-57 0.30404641361054985 1101 58-59 0.3849232864742689 1101 60-61 0.18268612988615018 1101 62-63 0.3475752357945012 1101 64-65 0.3221839582637287 1101 66-67 0.4550127213384343 1101 68-69 0.49108863817429693 1101 70-71 0.22359358536146345 1101 72-73 0.12371822877850036 1101 74-75 0.1160276014494599 1101 76-77 0.12223407262727903 1101 78-79 0.4905553699468044 1101 80-81 0.048675181825196034 1101 82-83 -0.14337847909331458 1101 84-85 -0.09219115417234036 1101 86-87 -0.16113052864228194 1101 88-89 -0.14778597311814679 1101 90-91 0.026040194289535634 1101 92-93 -0.29961321991210355 1101 94-95 -0.2831847035542623 1101 96-97 -0.005499730153424309 1101 98-99 -0.14028809334121561 1101 100 -0.09926498933463535 1104 1 -0.23393127907275613 1104 2 -0.20041890467991408 1104 3 0.07639227981804453 1104 4 -0.044743131762224664 1104 5 -0.07887229832180509 1104 6 -0.025673973940527617 1104 7 -0.09548713731335567 1104 8 -0.0643005833825896 1104 9 -0.001876076173829233 1104 10-11 -0.18135617177662056 1104 12-13 -0.258859962478482 1104 14-15 -0.22821310169360487 1104 16-17 -0.1465459638662594 1104 18-19 -0.051302973452237666 1104 20-21 0.03010716763897392 1104 22-23 -0.1289673871141872 1104 24-25 0.023553750867364442 1104 26-27 -0.08593328364729302 1104 28-29 -0.0015291305800388955 1104 30-31 -0.021048032689982676 1104 32-33 -0.10761095834082823 1104 34-35 -0.1266094420600865 1104 36-37 -0.14429724242501862 1104 38-39 -0.09697771838298053 1104 40-41 -0.14725912980905065 1104 42-43 -0.05287707846110834 1104 44-45 -0.054123512631392146 1104 46-47 -0.16605844105779966 1104 48-49 -0.252312970625276 1104 50-51 -0.2903484875742066 1104 52-53 -0.11115751329958101 1104 54-55 -0.049510421217654255 1104 56-57 -0.30404641361054274 1104 58-59 -0.38492328647426177 1104 60-61 -0.18268612988615018 1104 62-63 -0.3475752357945012 1104 64-65 -0.3221839582637287 1104 66-67 -0.4550127213384343 1104 68-69 -0.49108863817429693 1104 70-71 -0.22359358536147056 1104 72-73 -0.12371822877849326 1104 74-75 -0.1160276014494599 1104 76-77 -0.12223407262727903 1104 78-79 -0.4905553699468044 1104 80-81 -0.04867518182518893 1104 82-83 0.14337847909331458 1104 84-85 0.09219115417234036 1104 86-87 0.16113052864228905 1104 88-89 0.14778597311813968 1104 90-91 -0.02604019428952853 1104 92-93 0.29961321991211065 1104 94-95 0.2831847035542694 1104 96-97 0.005499730153431415 1104 98-99 0.14028809334121561 1104 100 0.09926498933463535 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 14.0 28 18.0 29 63.0 30 60.0 31 78.0 32 118.0 33 177.0 34 258.0 35 441.0 36 746.0 37 931.0 38 909.0 39 183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.0 8.55 11.65 49.8 2 26.025 18.2 33.125 22.650000000000002 3 26.275 22.525000000000002 22.2 28.999999999999996 4 29.725 27.474999999999998 16.475 26.325 5 29.975 29.075 19.5 21.45 6 22.425 32.074999999999996 21.325 24.175 7 21.775 14.124999999999998 37.574999999999996 26.525 8 22.8 18.9 24.224999999999998 34.075 9 24.05 16.825000000000003 29.5 29.625 10-11 26.865858232279034 26.665833229153645 19.41492686585823 27.053381672709087 12-13 25.775 21.3 24.575 28.349999999999998 14-15 25.3 23.599999999999998 23.599999999999998 27.500000000000004 16-17 25.874999999999996 22.9625 22.425 28.7375 18-19 25.687500000000004 23.674999999999997 23.150000000000002 27.487499999999997 20-21 27.125 23.0 22.175 27.700000000000003 22-23 26.2125 23.575 22.5875 27.625 24-25 26.1125 22.625 24.25 27.0125 26-27 26.650000000000002 23.0875 23.5875 26.674999999999997 28-29 25.95 22.325 23.3875 28.3375 30-31 25.55 23.6875 23.25 27.5125 32-33 26.3 23.724999999999998 23.275000000000002 26.700000000000003 34-35 26.2125 23.6625 23.0 27.125 36-37 25.837500000000002 23.25 23.0 27.9125 38-39 26.174999999999997 23.025000000000002 23.575 27.224999999999998 40-41 26.687499999999996 23.2375 22.4375 27.6375 42-43 26.687499999999996 23.3125 23.1875 26.8125 44-45 26.637499999999996 23.275000000000002 23.35 26.737499999999997 46-47 26.6625 23.2125 23.3875 26.737499999999997 48-49 26.150000000000002 23.3375 23.3125 27.200000000000003 50-51 27.537499999999998 23.3875 22.6375 26.437500000000004 52-53 26.174999999999997 23.425 22.8625 27.537499999999998 54-55 27.025 23.1 23.4125 26.4625 56-57 26.4125 23.974999999999998 23.025000000000002 26.5875 58-59 25.8 23.6625 23.1125 27.425 60-61 26.0125 23.599999999999998 23.3875 27.0 62-63 27.1375 23.075000000000003 23.825 25.9625 64-65 26.150000000000002 23.7375 23.7625 26.35 66-67 26.224999999999998 23.5125 23.7625 26.5 68-69 26.987499999999997 22.95 22.6125 27.450000000000003 70-71 26.7625 22.75 23.724999999999998 26.7625 72-73 26.125 23.150000000000002 23.7625 26.9625 74-75 26.950000000000003 23.9 22.912499999999998 26.237500000000004 76-77 27.3875 23.2125 23.35 26.05 78-79 27.025 23.1 23.2125 26.6625 80-81 27.6875 22.3625 23.35 26.6 82-83 26.137500000000003 22.2125 23.6375 28.012500000000003 84-85 27.0125 22.662499999999998 23.7125 26.6125 86-87 27.55 23.1 23.1625 26.187500000000004 88-89 27.0125 23.200000000000003 23.25 26.5375 90-91 26.787499999999998 23.775 22.6375 26.8 92-93 26.674999999999997 22.675 24.175 26.474999999999998 94-95 27.800000000000004 22.900000000000002 22.25 27.05 96-97 27.200000000000003 23.2375 22.9875 26.575 98-99 27.6375 22.8125 23.0 26.55 100 27.55 22.650000000000002 22.7 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 0.5 28 0.0 29 0.5 30 5.0 31 12.0 32 16.0 33 18.0 34 20.0 35 22.0 36 27.5 37 40.5 38 65.0 39 90.5 40 103.5 41 112.5 42 118.0 43 135.0 44 148.0 45 146.0 46 138.5 47 127.0 48 121.0 49 126.0 50 129.5 51 116.0 52 107.5 53 97.5 54 85.5 55 87.0 56 86.5 57 96.0 58 97.5 59 101.5 60 115.5 61 112.5 62 103.5 63 97.5 64 100.5 65 99.0 66 94.5 67 91.5 68 78.0 69 73.5 70 78.0 71 66.5 72 54.5 73 43.5 74 46.5 75 43.0 76 26.5 77 22.0 78 19.0 79 12.0 80 7.0 81 4.5 82 3.0 83 4.0 84 2.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563598 spots for SRR8618233.sra Written 563598 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra Read 563593 spots for SRR8618233.sra Written 563593 spots for SRR8618233.sra SRR ids: ['SRR8618233.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7iw39qpx SRR8618233.sra spots: 11271865 blocks: [[1, 563593], [563594, 1127186], [1127187, 1690779], [1690780, 2254372], [2254373, 2817965], [2817966, 3381558], [3381559, 3945151], [3945152, 4508744], [4508745, 5072337], [5072338, 5635930], [5635931, 6199523], [6199524, 6763116], [6763117, 7326709], [7326710, 7890302], [7890303, 8453895], [8453896, 9017488], [9017489, 9581081], [9581082, 10144674], [10144675, 10708267], [10708268, 11271865]] SRR8618233 file size 2933525 SRR8618233 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618233 SRR8618233_1.fastq SRR8618233_2.fastq Input file: SRR8618233_1.fastq Paired file: SRR8618233_2.fastq trimmed: SRR8618233-trimmed-pair1.fastq, SRR8618233-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:35:33 2024 >> started Sat Dec 7 08:35:43 2024 >> done (10.009s) 11271865 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11271865 (100.00%) read pairs available; of these: 1391119 (12.34%) trimmed read pairs available after processing 9880746 (87.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 12 0.00% 82 31 0.00% 83 89 0.00% 84 5041 0.04% 85 5397 0.05% 86 6266 0.06% 87 7170 0.06% 88 8591 0.08% 89 10984 0.10% 90 17329 0.15% 91 31703 0.28% 92 44500 0.39% 93 62162 0.55% 94 84036 0.75% 95 107970 0.96% 96 144385 1.28% 97 199184 1.77% 98 279766 2.48% 99 376502 3.34% 100 9880746 87.66% 11271865 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=29 prefix-density=0.37 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=33 fanout-score=42.22 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=9.5 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=24 prefix-density=0.36 prefix-fanout=3.0 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=35 fanout-score=43.16 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=9.6 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618233 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:36:18 Started mapping on | Dec 07 08:36:18 Finished on | Dec 07 08:36:51 Mapping speed, Million of reads per hour | 1229.66 Number of input reads | 11271865 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11000065 Uniquely mapped reads % | 97.59% Average mapped length | 198.20 Number of splices: Total | 6855851 Number of splices: Annotated (sjdb) | 6520671 Number of splices: GT/AG | 6756576 Number of splices: GC/AG | 79466 Number of splices: AT/AC | 2243 Number of splices: Non-canonical | 17566 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 109726 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 6220 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.17% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 162074 162074 162074 N_multimapping 109726 109726 109726 N_noFeature 286527 5506556 5575900 N_ambiguous 243156 19627 20825 UnstrandedReadsAssigned:10470382 PositiveStrandReadsAssigned:5473882 NegativeStrandReadsAssigned:5403340 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618233 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618233-trimmed-pair1.fastq SRR8618233-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,271,865 reads, 10,681,862 reads pseudoaligned [quant] estimated average fragment length: 163.35 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52973 SRR8618233.ke.tsv 35125 SRR8618233.se.tsv 88098 total ==> SRR8618233.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.789 3.85602e-08 6.56497e-09 PNS24247 1044 881.65 18.4298 2.75385 PNS24249 1928 1765.65 45.2827 3.37865 PNS24246 1044 881.65 18.4298 2.75385 PNS24248 1044 881.65 18.4298 2.75385 PNS24244 1471 1308.65 25.428 2.55979 PNS24243 293 136.908 6 5.7735 KQK14069 1603 1440.65 4811.34 439.971 KQK14071 474 312.866 469.159 197.55 ==> SRR8618233.se.tsv <== BRADI_1g14170v3 5746 BRADI_1g53295v3 202 BRADI_1g59795v3 273 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 415 BRADI_1g74790v3 18 BRADI_1g09890v3 1 BRADI_1g77505v3 146 BRADI_1g48960v3 0 SRR8618233 completed mapping pipeline successfully