Starting /dee2/code/volunteer_pipeline.sh SRR8618234 current disk space = 1544380772352 free memory = 1602262668 SRR8618234 SRAfilesize d0a164826d497450a15c44eceb64f9c9 SRR8618234.sra SRR8618234.sra file validated SRR8618234 is paired end SRR8618234 is conventional basespace SRR8618234 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618234_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.021 34.0 31.0 34.0 31.0 34.0 2 33.14875 34.0 33.0 34.0 31.0 34.0 3 33.23525 34.0 34.0 34.0 31.0 34.0 4 34.872 37.0 37.0 37.0 35.0 37.0 5 35.654 37.0 37.0 37.0 35.0 37.0 6 36.23325 37.0 37.0 37.0 35.0 37.0 7 36.28425 37.0 37.0 37.0 35.0 37.0 8 36.38925 37.0 37.0 37.0 35.0 37.0 9 38.34825 39.0 39.0 39.0 37.0 39.0 10-11 38.401875000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.361125 39.0 39.0 39.0 37.0 39.0 14-15 39.905249999999995 41.0 40.0 41.0 38.0 41.0 16-17 39.866 41.0 40.0 41.0 38.0 41.0 18-19 39.76075 41.0 40.0 41.0 38.0 41.0 20-21 39.71925 41.0 39.5 41.0 37.0 41.0 22-23 39.62025 41.0 39.0 41.0 37.0 41.0 24-25 39.495374999999996 41.0 39.0 41.0 37.0 41.0 26-27 39.36025 40.0 39.0 41.0 36.0 41.0 28-29 39.256375 40.0 38.5 41.0 36.0 41.0 30-31 38.982124999999996 40.0 38.0 41.0 35.5 41.0 32-33 38.821 40.0 38.0 41.0 35.0 41.0 34-35 39.0565 40.0 38.0 41.0 35.0 41.0 36-37 39.083375000000004 40.0 38.0 41.0 35.0 41.0 38-39 38.961875 40.0 38.0 41.0 35.0 41.0 40-41 38.81 40.0 38.0 41.0 35.0 41.0 42-43 38.576 40.0 37.0 41.0 35.0 41.0 44-45 38.279624999999996 40.0 36.5 41.0 34.5 41.0 46-47 38.0735 40.0 35.5 41.0 34.0 41.0 48-49 37.920500000000004 39.5 35.0 41.0 33.5 41.0 50-51 37.67400000000001 39.0 35.0 41.0 33.0 41.0 52-53 37.516625000000005 39.0 35.0 41.0 33.0 41.0 54-55 37.2395 38.0 35.0 41.0 33.0 41.0 56-57 36.909000000000006 37.0 35.0 40.5 33.0 41.0 58-59 36.713875 37.0 35.0 40.0 33.0 41.0 60-61 36.466125 36.0 35.0 40.0 32.0 41.0 62-63 35.961124999999996 35.5 35.0 39.5 31.0 41.0 64-65 35.797124999999994 35.0 34.5 39.0 31.0 41.0 66-67 35.522499999999994 35.0 34.0 39.0 31.0 41.0 68-69 35.241749999999996 35.0 34.0 38.0 31.0 40.5 70-71 34.963750000000005 35.0 34.0 37.0 31.0 39.5 72-73 34.641000000000005 35.0 34.0 36.5 30.5 39.0 74-75 34.306250000000006 35.0 34.0 36.0 30.0 39.0 76-77 33.364875 34.5 32.5 35.0 28.5 37.0 78-79 33.852875 35.0 33.0 35.0 30.0 37.0 80-81 33.823750000000004 35.0 33.0 35.0 30.0 37.0 82-83 33.52475 35.0 33.0 35.0 29.5 36.0 84-85 33.362375 35.0 33.0 35.0 29.0 36.0 86-87 33.272875 35.0 33.0 35.0 29.0 36.0 88-89 33.059625 35.0 33.0 35.0 29.0 35.0 90-91 32.716 35.0 33.0 35.0 29.0 35.0 92-93 32.43125 35.0 33.0 35.0 27.0 35.0 94-95 32.112125 34.5 32.5 35.0 27.0 35.0 96-97 31.8455 34.0 32.0 35.0 25.0 35.0 98-99 31.561374999999998 34.0 32.0 35.0 26.0 35.0 100 31.21575 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.0023966295819803918 1101 2 0.018832462978380704 1101 3 -0.015187063245797106 1101 4 -1.6271979616034713 1101 5 -0.859721486414891 1101 6 -0.27372032594162476 1101 7 -0.25029642523777085 1101 8 -0.10400111001791146 1101 9 -0.0010595625520366525 1101 10-11 0.03740003531875402 1101 12-13 -0.005796059436413259 1101 14-15 0.02594036176492409 1101 16-17 0.07133757158354115 1101 18-19 0.0746739322384471 1101 20-21 0.07177274906027264 1101 22-23 0.17083554075531993 1101 24-25 0.16584046015287868 1101 26-27 0.06440626655566462 1101 28-29 0.04268523423900206 1101 30-31 0.05109235853578298 1101 32-33 0.03865511238932129 1101 34-35 -0.1708796891949831 1101 36-37 -0.03928580438456919 1101 38-39 0.023613108302427577 1101 40-41 -0.03947501198314285 1101 42-43 -0.12210197028179692 1101 44-45 -0.03736850071899056 1101 46-47 -0.04937056938872786 1101 48-49 -0.1662062615101263 1101 50-51 -0.3064217058957084 1101 52-53 0.0029768662176152816 1101 54-55 -0.11624914856580659 1101 56-57 0.07068165190847964 1101 58-59 0.11945306390170884 1101 60-61 0.04018138701783869 1101 62-63 0.08694089154620599 1101 64-65 -0.12133883296753112 1101 66-67 0.09052322207926977 1101 68-69 0.12996669946264916 1101 70-71 0.010929892277808051 1101 72-73 0.09833118898054494 1101 74-75 0.08765357350084457 1101 76-77 -0.04324024319483044 1101 78-79 -0.25901889553217927 1101 80-81 -0.09498221448573219 1101 82-83 0.004452685486512564 1101 84-85 0.1476513030096669 1101 86-87 0.05715330861021073 1101 88-89 -0.11600948560760571 1101 90-91 -0.08194581094377185 1101 92-93 -0.008426045056637577 1101 94-95 -0.3427747925023361 1101 96-97 -0.09871591109765632 1101 98-99 -0.038756023108554416 1101 100 -0.0025227679810271297 1104 1 0.0023966295819732863 1104 2 -0.018832462978380704 1104 3 0.01518706324579 1104 4 1.6271979616034713 1104 5 0.8597214864148981 1104 6 0.27372032594161766 1104 7 0.25029642523777085 1104 8 0.10400111001791146 1104 9 0.001059562552029547 1104 10-11 -0.03740003531875402 1104 12-13 0.005796059436413259 1104 14-15 -0.025940361764931197 1104 16-17 -0.07133757158354115 1104 18-19 -0.0746739322384471 1104 20-21 -0.07177274906027264 1104 22-23 -0.17083554075531993 1104 24-25 -0.16584046015287868 1104 26-27 -0.06440626655566462 1104 28-29 -0.04268523423900206 1104 30-31 -0.05109235853578298 1104 32-33 -0.038655112389314183 1104 34-35 0.1708796891949831 1104 36-37 0.03928580438456919 1104 38-39 -0.023613108302427577 1104 40-41 0.039475011983149955 1104 42-43 0.12210197028178982 1104 44-45 0.03736850071899056 1104 46-47 0.04937056938872786 1104 48-49 0.1662062615101334 1104 50-51 0.3064217058957084 1104 52-53 -0.0029768662176152816 1104 54-55 0.11624914856580659 1104 56-57 -0.07068165190847964 1104 58-59 -0.11945306390171595 1104 60-61 -0.04018138701783869 1104 62-63 -0.08694089154619888 1104 64-65 0.12133883296753822 1104 66-67 -0.09052322207926267 1104 68-69 -0.12996669946265627 1104 70-71 -0.010929892277808051 1104 72-73 -0.09833118898054494 1104 74-75 -0.08765357350084457 1104 76-77 0.04324024319483044 1104 78-79 0.25901889553217927 1104 80-81 0.09498221448573219 1104 82-83 -0.004452685486512564 1104 84-85 -0.14765130300965978 1104 86-87 -0.057153308610203624 1104 88-89 0.11600948560760571 1104 90-91 0.08194581094377185 1104 92-93 0.008426045056630471 1104 94-95 0.3427747925023361 1104 96-97 0.09871591109765632 1104 98-99 0.038756023108554416 1104 100 0.0025227679810306824 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 13.0 28 25.0 29 51.0 30 69.0 31 93.0 32 133.0 33 191.0 34 297.0 35 436.0 36 730.0 37 899.0 38 915.0 39 147.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.875 10.9 12.65 47.575 2 26.174999999999997 19.400000000000002 31.2 23.225 3 26.375 23.724999999999998 22.375 27.525 4 30.155385830919144 27.679747168817485 15.933631814590466 26.2312351856729 5 29.849999999999998 29.575000000000003 19.725 20.849999999999998 6 22.416812609457093 31.37353014761071 20.165123842882164 26.044533400050035 7 22.225 14.625 36.775000000000006 26.375 8 24.425 18.55 24.175 32.85 9 23.075000000000003 18.775 27.975 30.175 10-11 26.825 26.937499999999996 18.2 28.037499999999998 12-13 24.95 21.349999999999998 24.95 28.749999999999996 14-15 25.362499999999997 22.975 24.3125 27.35 16-17 27.3125 21.762500000000003 22.6875 28.237499999999997 18-19 26.1 24.212500000000002 22.275 27.4125 20-21 26.5625 23.45 23.400000000000002 26.5875 22-23 26.25 23.3625 22.7 27.6875 24-25 26.387500000000003 23.825 23.45 26.337500000000002 26-27 27.3125 23.35 22.7 26.637499999999996 28-29 27.6 23.3125 22.4875 26.6 30-31 26.1625 23.25 23.9 26.687499999999996 32-33 26.5125 22.8 23.45 27.237499999999997 34-35 27.237499999999997 22.7375 23.474999999999998 26.55 36-37 26.687499999999996 22.912499999999998 23.2125 27.187499999999996 38-39 26.950000000000003 23.6875 22.825 26.5375 40-41 26.8375 22.3625 23.625 27.175 42-43 27.325 22.7 23.1875 26.787499999999998 44-45 26.700000000000003 23.8125 22.6875 26.8 46-47 26.950000000000003 23.775 22.25 27.025 48-49 26.200000000000003 22.95 23.5375 27.3125 50-51 25.5125 23.0875 23.4375 27.962500000000002 52-53 26.825 22.9375 22.825 27.4125 54-55 25.974999999999998 22.8625 24.0 27.1625 56-57 26.337500000000002 22.95 23.5 27.212500000000002 58-59 27.55 22.8 23.0625 26.5875 60-61 26.950000000000003 23.4875 22.45 27.1125 62-63 26.637499999999996 23.95 22.9625 26.450000000000003 64-65 26.937499999999996 23.7375 22.650000000000002 26.674999999999997 66-67 26.337500000000002 23.0 23.9375 26.724999999999998 68-69 26.6625 23.1875 23.75 26.400000000000002 70-71 27.0625 23.5125 22.5 26.924999999999997 72-73 26.787499999999998 23.8125 22.3375 27.0625 74-75 27.725 23.0625 22.1875 27.025 76-77 26.8625 23.125 23.3375 26.674999999999997 78-79 27.0 22.412499999999998 22.9625 27.625 80-81 26.875 21.925 24.4875 26.7125 82-83 27.125 22.825 23.3125 26.737499999999997 84-85 27.3125 23.2875 23.400000000000002 26.0 86-87 26.875 22.662499999999998 24.0375 26.424999999999997 88-89 27.35 23.2625 21.9625 27.425 90-91 27.825 22.8875 22.5625 26.724999999999998 92-93 27.6875 23.575 22.05 26.687499999999996 94-95 27.537499999999998 23.4625 22.4625 26.5375 96-97 26.85 22.825 23.525 26.8 98-99 27.925 23.325000000000003 22.525000000000002 26.224999999999998 100 26.325 23.3 23.275000000000002 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 0.5 28 1.5 29 4.0 30 4.0 31 5.0 32 9.5 33 15.5 34 20.0 35 27.0 36 36.0 37 37.0 38 45.5 39 63.5 40 85.0 41 101.0 42 116.0 43 127.0 44 134.0 45 142.0 46 148.0 47 148.0 48 141.0 49 132.5 50 128.5 51 129.5 52 119.5 53 106.0 54 100.0 55 97.5 56 95.0 57 100.5 58 105.0 59 105.0 60 114.0 61 112.5 62 106.5 63 104.0 64 95.5 65 92.0 66 93.5 67 98.5 68 91.5 69 72.0 70 59.5 71 56.5 72 50.0 73 45.5 74 41.0 75 35.5 76 30.0 77 24.0 78 17.0 79 10.5 80 7.0 81 3.5 82 3.5 83 2.5 84 1.0 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.075 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618234 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618234_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4765 34.0 31.0 34.0 31.0 34.0 2 32.92725 34.0 31.0 34.0 31.0 34.0 3 33.0515 34.0 33.0 34.0 31.0 34.0 4 36.48175 37.0 37.0 37.0 35.0 37.0 5 36.5 37.0 37.0 37.0 35.0 37.0 6 36.47625 37.0 37.0 37.0 35.0 37.0 7 36.50825 37.0 37.0 37.0 35.0 37.0 8 36.51525 37.0 37.0 37.0 35.0 37.0 9 38.29925 39.0 39.0 39.0 37.0 39.0 10-11 38.3545 39.0 39.0 39.0 37.0 39.0 12-13 38.275 39.0 39.0 39.0 37.0 39.0 14-15 39.878 41.0 40.0 41.0 38.0 41.0 16-17 39.739875 41.0 40.0 41.0 37.5 41.0 18-19 39.794124999999994 41.0 40.0 41.0 38.0 41.0 20-21 39.685249999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.699 41.0 40.0 41.0 37.0 41.0 24-25 39.630250000000004 41.0 39.0 41.0 37.0 41.0 26-27 39.494375 41.0 39.0 41.0 36.0 41.0 28-29 39.39325 40.5 39.0 41.0 36.0 41.0 30-31 39.180499999999995 40.0 38.5 41.0 35.0 41.0 32-33 39.1075 40.0 38.0 41.0 35.0 41.0 34-35 38.9745 40.0 38.0 41.0 35.0 41.0 36-37 38.859125000000006 40.0 38.0 41.0 35.0 41.0 38-39 38.574 40.0 37.5 41.0 34.5 41.0 40-41 38.41025 40.0 37.0 41.0 34.5 41.0 42-43 38.198375 40.0 36.5 41.0 34.0 41.0 44-45 37.81625 39.5 35.5 41.0 33.0 41.0 46-47 37.644625000000005 39.0 35.0 41.0 33.0 41.0 48-49 37.447375 39.0 35.0 41.0 33.0 41.0 50-51 36.97225 38.0 34.5 40.0 32.0 40.5 52-53 36.859875 38.0 35.0 40.0 33.0 41.0 54-55 37.096500000000006 38.0 35.0 41.0 33.0 41.0 56-57 37.00875 37.0 35.0 41.0 33.0 41.0 58-59 36.79625 37.0 35.0 40.5 33.0 41.0 60-61 36.528625 36.0 35.0 40.0 33.0 41.0 62-63 36.310249999999996 36.0 35.0 40.0 32.5 41.0 64-65 36.040125 35.0 35.0 39.0 32.0 41.0 66-67 35.7265 35.0 35.0 39.0 31.5 41.0 68-69 35.4255 35.0 35.0 38.0 31.5 40.5 70-71 35.11975 35.0 34.0 37.0 31.0 39.5 72-73 34.793 35.0 34.0 37.0 31.0 39.0 74-75 34.570125000000004 35.0 34.0 36.0 31.0 39.0 76-77 34.34125 35.0 34.0 36.0 30.5 37.5 78-79 34.079125000000005 35.0 34.0 35.0 30.5 37.0 80-81 33.759375 35.0 33.0 35.0 29.5 37.0 82-83 33.4895 35.0 33.0 35.0 29.0 36.0 84-85 33.27775 35.0 33.0 35.0 29.0 36.0 86-87 33.14725 35.0 33.0 35.0 29.0 36.0 88-89 32.982625 35.0 33.0 35.0 29.0 35.0 90-91 32.761875 35.0 33.0 35.0 28.0 35.0 92-93 32.45725 35.0 33.0 35.0 27.0 35.0 94-95 32.203125 35.0 32.5 35.0 27.0 35.0 96-97 31.90475 35.0 32.0 35.0 26.0 35.0 98-99 31.475749999999998 34.0 32.0 35.0 25.0 35.0 100 31.081 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.16276899013598012 1101 2 -0.013446353338878225 1101 3 0.0016902545472916586 1101 4 -0.03578546381089609 1101 5 -0.07062488962890257 1101 6 -0.05521077726481849 1101 7 -0.04638108933121288 1101 8 0.03181210424077108 1101 9 0.09903125709528382 1101 10-11 0.04808395771841134 1101 12-13 -0.09700042887055815 1101 14-15 -0.08627235803123767 1101 16-17 0.026495370720752476 1101 18-19 -0.05183026817023517 1101 20-21 0.07234667877595768 1101 22-23 0.01794318726506816 1101 24-25 0.004837407603623944 1101 26-27 -0.012714750624390092 1101 28-29 0.007561997023131539 1101 30-31 0.1188412926663105 1101 32-33 0.11488054693609229 1101 34-35 0.02023890612780832 1101 36-37 -0.10673831327732586 1101 38-39 -0.09498852140568914 1101 40-41 -0.21927268599106498 1101 42-43 -0.2714372209187914 1101 44-45 -0.5045283685259463 1101 46-47 -0.20976185070258424 1101 48-49 -0.3604026337697661 1101 50-51 -0.2650293902469798 1101 52-53 -0.18878503494033794 1101 54-55 -0.18614243548021392 1101 56-57 -0.1561656449456308 1101 58-59 -0.0936514543757383 1101 60-61 -0.2716201215974152 1101 62-63 -0.15016776407073706 1101 64-65 -0.21108630389262828 1101 66-67 -0.06945810943767583 1101 68-69 -0.06529554226897716 1101 70-71 -0.14432755619466064 1101 72-73 -0.2431317641716504 1101 74-75 -0.29709377128585857 1101 76-77 -0.4057304674689064 1101 78-79 -0.07189888745931938 1101 80-81 -0.2067282222054061 1101 82-83 -0.4757435858624106 1101 84-85 -0.4775725926486558 1101 86-87 -0.2672115845505658 1101 88-89 -0.0655667398269344 1101 90-91 -0.40532682459194547 1101 92-93 -0.4401725573299018 1101 94-95 -0.10284063674664168 1101 96-97 -0.3092093645147429 1101 98-99 -0.24552839375362723 1101 100 -0.3886828628371042 1104 1 -0.162768990135973 1104 2 0.01344635333888533 1104 3 -0.0016902545472916586 1104 4 0.03578546381089609 1104 5 0.07062488962889546 1104 6 0.055210777264811384 1104 7 0.04638108933121288 1104 8 -0.03181210424077108 1104 9 -0.09903125709528382 1104 10-11 -0.04808395771841134 1104 12-13 0.09700042887055815 1104 14-15 0.08627235803123057 1104 16-17 -0.02649537072075958 1104 18-19 0.05183026817023517 1104 20-21 -0.07234667877595058 1104 22-23 -0.017943187265061056 1104 24-25 -0.004837407603623944 1104 26-27 0.012714750624382987 1104 28-29 -0.007561997023131539 1104 30-31 -0.1188412926663176 1104 32-33 -0.11488054693609939 1104 34-35 -0.02023890612780832 1104 36-37 0.10673831327732586 1104 38-39 0.09498852140568914 1104 40-41 0.21927268599107208 1104 42-43 0.2714372209187914 1104 44-45 0.5045283685259463 1104 46-47 0.20976185070259135 1104 48-49 0.3604026337697732 1104 50-51 0.2650293902469798 1104 52-53 0.18878503494033794 1104 54-55 0.1861424354802068 1104 56-57 0.1561656449456308 1104 58-59 0.0936514543757454 1104 60-61 0.2716201215974223 1104 62-63 0.15016776407073706 1104 64-65 0.21108630389263539 1104 66-67 0.06945810943767583 1104 68-69 0.06529554226897716 1104 70-71 0.14432755619466064 1104 72-73 0.2431317641716504 1104 74-75 0.29709377128585857 1104 76-77 0.4057304674689064 1104 78-79 0.07189888745932649 1104 80-81 0.206728222205399 1104 82-83 0.4757435858624106 1104 84-85 0.4775725926486558 1104 86-87 0.2672115845505658 1104 88-89 0.0655667398269344 1104 90-91 0.40532682459194547 1104 92-93 0.4401725573299018 1104 94-95 0.10284063674664168 1104 96-97 0.3092093645147429 1104 98-99 0.24552839375362723 1104 100 0.38868286283710773 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 12.0 28 36.0 29 35.0 30 67.0 31 112.0 32 138.0 33 180.0 34 271.0 35 453.0 36 736.0 37 882.0 38 916.0 39 161.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.599999999999998 9.950000000000001 13.3 47.15 2 27.450000000000003 19.2 31.075000000000003 22.275 3 25.825 23.075000000000003 21.75 29.349999999999998 4 29.349999999999998 27.025 16.775000000000002 26.85 5 29.549999999999997 28.449999999999996 19.275000000000002 22.725 6 21.95 33.35 19.125 25.575 7 20.3 13.900000000000002 39.25 26.55 8 23.25 19.575 22.900000000000002 34.275 9 22.325 18.8 28.375 30.5 10-11 27.410278854570464 25.834688008003 19.082155808428162 27.672877328998375 12-13 25.1875 20.849999999999998 25.3 28.6625 14-15 25.362499999999997 22.7 23.375 28.5625 16-17 26.85 22.475 22.6375 28.037499999999998 18-19 26.075 23.125 23.1 27.700000000000003 20-21 26.787499999999998 24.1125 22.112499999999997 26.987499999999997 22-23 27.0875 23.6875 22.35 26.875 24-25 26.275 23.925 22.6375 27.1625 26-27 26.0125 23.7125 23.1625 27.1125 28-29 28.275 23.150000000000002 21.6875 26.887499999999996 30-31 26.0 23.7875 23.5125 26.700000000000003 32-33 26.687499999999996 23.6375 22.525000000000002 27.150000000000002 34-35 26.900000000000002 23.5 22.375 27.224999999999998 36-37 26.6625 23.1625 22.575 27.6 38-39 26.7625 24.212500000000002 22.9375 26.087500000000002 40-41 27.0 23.275000000000002 22.787499999999998 26.937499999999996 42-43 26.450000000000003 23.175 22.575 27.800000000000004 44-45 27.1125 22.5625 23.400000000000002 26.924999999999997 46-47 27.6625 22.825 22.375 27.1375 48-49 25.6 23.0375 23.599999999999998 27.762500000000003 50-51 26.200000000000003 23.35 21.975 28.475 52-53 26.924999999999997 22.725 23.549999999999997 26.8 54-55 25.900000000000002 22.5125 24.325 27.2625 56-57 26.0375 24.2625 23.05 26.650000000000002 58-59 28.175 23.0375 21.637500000000003 27.150000000000002 60-61 25.0625 24.625 22.8375 27.474999999999998 62-63 27.05 23.075000000000003 23.150000000000002 26.724999999999998 64-65 26.700000000000003 23.775 21.9625 27.5625 66-67 26.35 23.3375 23.962500000000002 26.35 68-69 27.187499999999996 24.0125 22.55 26.25 70-71 26.625 22.8625 22.875 27.6375 72-73 25.362499999999997 22.9625 24.2875 27.3875 74-75 27.212500000000002 22.325 23.8625 26.6 76-77 26.3625 23.0 23.2125 27.425 78-79 27.0875 23.0125 23.0375 26.8625 80-81 26.55 23.549999999999997 23.0375 26.8625 82-83 26.787499999999998 23.3 22.287499999999998 27.625 84-85 26.387500000000003 24.337500000000002 23.3 25.974999999999998 86-87 26.5875 23.0375 23.3875 26.987499999999997 88-89 27.0875 22.6 23.4125 26.900000000000002 90-91 27.1 23.7 22.6125 26.5875 92-93 26.474999999999998 24.2625 22.55 26.7125 94-95 28.262500000000003 22.75 22.125 26.8625 96-97 26.3625 23.3875 22.8875 27.3625 98-99 28.287499999999998 22.8875 23.1625 25.662499999999998 100 26.875 23.025000000000002 23.125 26.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.0 27 1.0 28 1.5 29 0.5 30 1.5 31 5.5 32 9.5 33 11.5 34 14.5 35 20.0 36 37.5 37 45.0 38 45.0 39 70.0 40 97.0 41 100.5 42 114.0 43 133.5 44 132.5 45 135.5 46 143.0 47 154.5 48 157.0 49 140.0 50 123.0 51 117.0 52 112.5 53 106.5 54 102.0 55 99.0 56 88.5 57 88.0 58 95.0 59 103.5 60 115.5 61 111.5 62 108.5 63 112.0 64 102.0 65 91.0 66 99.0 67 92.5 68 82.5 69 75.5 70 60.5 71 58.5 72 53.0 73 47.0 74 50.0 75 41.5 76 29.5 77 20.0 78 12.5 79 9.0 80 7.0 81 5.0 82 4.0 83 3.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0375 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88663967611336 97.7 2 1.0627530364372468 2.1 3 0.025303643724696356 0.075 4 0.0 0.0 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGACGCCACACAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562525 spots for SRR8618234.sra Written 562525 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra Read 562510 spots for SRR8618234.sra Written 562510 spots for SRR8618234.sra SRR ids: ['SRR8618234.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hh9q5pbr SRR8618234.sra spots: 11250215 blocks: [[1, 562510], [562511, 1125020], [1125021, 1687530], [1687531, 2250040], [2250041, 2812550], [2812551, 3375060], [3375061, 3937570], [3937571, 4500080], [4500081, 5062590], [5062591, 5625100], [5625101, 6187610], [6187611, 6750120], [6750121, 7312630], [7312631, 7875140], [7875141, 8437650], [8437651, 9000160], [9000161, 9562670], [9562671, 10125180], [10125181, 10687690], [10687691, 11250215]] SRR8618234 file size 2927876 SRR8618234 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618234 SRR8618234_1.fastq SRR8618234_2.fastq Input file: SRR8618234_1.fastq Paired file: SRR8618234_2.fastq trimmed: SRR8618234-trimmed-pair1.fastq, SRR8618234-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:48:57 2024 >> started Sat Dec 7 08:49:08 2024 >> done (11.473s) 11250215 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11250215 (100.00%) read pairs available; of these: 1401417 (12.46%) trimmed read pairs available after processing 9848798 (87.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 7 0.00% 82 30 0.00% 83 86 0.00% 84 5576 0.05% 85 6096 0.05% 86 6731 0.06% 87 7561 0.07% 88 9124 0.08% 89 11379 0.10% 90 17996 0.16% 91 32204 0.29% 92 45769 0.41% 93 63124 0.56% 94 85706 0.76% 95 109360 0.97% 96 145264 1.29% 97 199987 1.78% 98 279509 2.48% 99 375908 3.34% 100 9848798 87.54% 11250215 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=4.21 fanout-score-rank=13 prefix-density=0.45 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=35 fanout-score=42.65 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.5 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=16 prefix-density=0.42 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=32 fanout-score=41.79 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=9.5 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618234 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:49:42 Started mapping on | Dec 07 08:49:43 Finished on | Dec 07 08:50:22 Mapping speed, Million of reads per hour | 1038.48 Number of input reads | 11250215 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10959768 Uniquely mapped reads % | 97.42% Average mapped length | 198.19 Number of splices: Total | 6766994 Number of splices: Annotated (sjdb) | 6439327 Number of splices: GT/AG | 6669382 Number of splices: GC/AG | 78008 Number of splices: AT/AC | 1992 Number of splices: Non-canonical | 17612 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 114257 % of reads mapped to multiple loci | 1.02% Number of reads mapped to too many loci | 9665 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.12% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 176190 176190 176190 N_multimapping 114257 114257 114257 N_noFeature 284406 5494219 5541240 N_ambiguous 250373 20833 22358 UnstrandedReadsAssigned:10424989 PositiveStrandReadsAssigned:5444716 NegativeStrandReadsAssigned:5396170 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618234 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618234-trimmed-pair1.fastq SRR8618234-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,250,215 reads, 10,643,046 reads pseudoaligned [quant] estimated average fragment length: 163.225 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52973 SRR8618234.ke.tsv 35125 SRR8618234.se.tsv 88098 total ==> SRR8618234.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.916 0 0 PNS24247 1044 881.775 14.4345 2.10735 PNS24249 1928 1765.77 77.7835 5.67083 PNS24246 1044 881.775 14.4345 2.10735 PNS24248 1044 881.775 14.4345 2.10735 PNS24244 1471 1308.77 15.9131 1.56525 PNS24243 293 137.241 6 5.6281 KQK14069 1603 1440.77 4715.31 421.316 KQK14071 474 313.026 500.844 205.976 ==> SRR8618234.se.tsv <== BRADI_1g14170v3 5640 BRADI_1g53295v3 223 BRADI_1g59795v3 279 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 222 BRADI_1g74790v3 23 BRADI_1g09890v3 1 BRADI_1g77505v3 130 BRADI_1g48960v3 0 SRR8618234 completed mapping pipeline successfully