Starting /dee2/code/volunteer_pipeline.sh SRR8618235 current disk space = 1544415612928 free memory = 1597155124 SRR8618235 SRAfilesize 53b0cde2ce7277c0df21d580f231a16f SRR8618235.sra SRR8618235.sra file validated SRR8618235 is paired end SRR8618235 is conventional basespace SRR8618235 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618235_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00675 34.0 31.0 34.0 31.0 34.0 2 33.16175 34.0 33.0 34.0 31.0 34.0 3 33.25575 34.0 34.0 34.0 31.0 34.0 4 34.86525 37.0 37.0 37.0 35.0 37.0 5 35.63975 37.0 37.0 37.0 35.0 37.0 6 36.2555 37.0 37.0 37.0 35.0 37.0 7 36.31325 37.0 37.0 37.0 35.0 37.0 8 36.4095 37.0 37.0 37.0 35.0 37.0 9 38.40025 39.0 39.0 39.0 37.0 39.0 10-11 38.366625 39.0 39.0 39.0 37.0 39.0 12-13 38.35425 39.0 39.0 39.0 37.0 39.0 14-15 39.9185 41.0 40.0 41.0 38.0 41.0 16-17 39.9165 41.0 40.0 41.0 38.0 41.0 18-19 39.78875 41.0 40.0 41.0 38.0 41.0 20-21 39.665625000000006 41.0 39.5 41.0 37.0 41.0 22-23 39.60025 41.0 39.0 41.0 37.0 41.0 24-25 39.482625 41.0 39.0 41.0 36.5 41.0 26-27 39.352875 40.5 39.0 41.0 36.5 41.0 28-29 39.220749999999995 40.0 39.0 41.0 36.0 41.0 30-31 38.940749999999994 40.0 38.0 41.0 35.0 41.0 32-33 38.841499999999996 40.0 38.0 41.0 35.0 41.0 34-35 39.101749999999996 40.0 38.0 41.0 35.0 41.0 36-37 39.131125 40.0 38.0 41.0 35.0 41.0 38-39 39.020875 40.0 38.0 41.0 35.0 41.0 40-41 38.825625 40.0 38.0 41.0 35.0 41.0 42-43 38.649125 40.0 37.0 41.0 35.0 41.0 44-45 38.388999999999996 40.0 36.5 41.0 34.5 41.0 46-47 38.102625 40.0 36.0 41.0 34.0 41.0 48-49 37.82125 39.0 35.0 41.0 33.5 41.0 50-51 37.604875 39.0 35.0 41.0 33.0 41.0 52-53 37.509625 39.0 35.0 41.0 33.0 41.0 54-55 37.218125 38.0 35.0 41.0 33.0 41.0 56-57 36.942499999999995 37.5 35.0 40.5 33.0 41.0 58-59 36.742000000000004 37.0 35.0 40.0 33.0 41.0 60-61 36.499624999999995 36.5 35.0 40.0 33.0 41.0 62-63 36.037375 36.0 35.0 39.5 32.0 41.0 64-65 35.873875 35.0 35.0 39.0 31.5 41.0 66-67 35.644999999999996 35.0 34.5 39.0 32.0 41.0 68-69 35.31925 35.0 34.0 37.5 31.0 40.0 70-71 34.964875 35.0 34.0 37.0 31.0 39.5 72-73 34.697125 35.0 34.0 36.5 30.5 39.0 74-75 34.202625 35.0 33.5 36.0 30.0 39.0 76-77 33.42975 34.5 32.5 35.0 29.0 37.0 78-79 33.938 35.0 33.0 35.0 30.0 37.0 80-81 33.763375 35.0 33.5 35.0 29.5 36.5 82-83 33.501999999999995 35.0 33.0 35.0 29.0 36.0 84-85 33.393375 35.0 33.0 35.0 29.0 36.0 86-87 33.274375000000006 35.0 33.0 35.0 29.0 36.0 88-89 33.032624999999996 35.0 33.0 35.0 29.0 35.0 90-91 32.72475 35.0 33.0 35.0 28.5 35.0 92-93 32.460125000000005 35.0 33.0 35.0 27.0 35.0 94-95 32.187749999999994 35.0 32.5 35.0 27.0 35.0 96-97 31.863625 34.5 32.0 35.0 27.0 35.0 98-99 31.537125 34.0 32.0 35.0 25.5 35.0 100 30.99725 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.014707730986799561 1101 2 0.04550597108736554 1101 3 0.049968573224383306 1101 4 -1.1724072910119432 1101 5 -0.5133249528598398 1101 6 -0.17932118164676325 1101 7 -0.14506599622878724 1101 8 -0.08076681332494928 1101 9 0.025832809553740788 1101 10-11 -0.013670647391577972 1101 12-13 0.06134506599623535 1101 14-15 -0.007888120678821053 1101 16-17 -0.08532369578881571 1101 18-19 0.13010685103708397 1101 20-21 0.045725958516655396 1101 22-23 0.06455059710873456 1101 24-25 0.03711502199874417 1101 26-27 0.129509742300435 1101 28-29 0.031049654305469687 1101 30-31 0.13004399748585627 1101 32-33 -0.011973601508479703 1101 34-35 -0.03733500942803403 1101 36-37 0.05527969830295376 1101 38-39 0.14764299182903784 1101 40-41 0.18771213073538462 1101 42-43 0.23504085480829673 1101 44-45 0.21891891891891646 1101 46-47 0.12482715273412737 1101 48-49 -0.05917661847894351 1101 50-51 0.05163419233186772 1101 52-53 0.23400377121307514 1101 54-55 0.0575738529226868 1101 56-57 0.0905405405405375 1101 58-59 0.01794468887492684 1101 60-61 0.007008170961654514 1101 62-63 0.153205531112512 1101 64-65 0.0072281583909443725 1101 66-67 0.01257071024512868 1101 68-69 -0.20386549340037163 1101 70-71 -0.1409176618479009 1101 72-73 -0.198805782526712 1101 74-75 -0.39544311753614636 1101 76-77 -0.34773727215587513 1101 78-79 -0.2407291011942192 1101 80-81 -0.17712130735386467 1101 82-83 -0.10861093651791265 1101 84-85 -0.17655562539283665 1101 86-87 -0.20920804525455594 1101 88-89 -0.2304211187932097 1101 90-91 -0.03771213073538604 1101 92-93 -0.024418604651167186 1101 94-95 0.5052482715273428 1101 96-97 -0.020364550597108177 1101 98-99 -0.16065367693274624 1101 100 -0.14688874921433026 1104 1 0.014707730986799561 1104 2 -0.04550597108736554 1104 3 -0.04996857322439041 1104 4 1.1724072910119432 1104 5 0.5133249528598327 1104 6 0.17932118164676325 1104 7 0.14506599622878724 1104 8 0.08076681332495639 1104 9 -0.025832809553740788 1104 10-11 0.013670647391577972 1104 12-13 -0.06134506599622824 1104 14-15 0.007888120678813948 1104 16-17 0.08532369578881571 1104 18-19 -0.13010685103708397 1104 20-21 -0.045725958516655396 1104 22-23 -0.06455059710873456 1104 24-25 -0.03711502199874417 1104 26-27 -0.1295097423004421 1104 28-29 -0.031049654305469687 1104 30-31 -0.13004399748585627 1104 32-33 0.011973601508486809 1104 34-35 0.03733500942803403 1104 36-37 -0.05527969830295376 1104 38-39 -0.14764299182903784 1104 40-41 -0.18771213073538462 1104 42-43 -0.23504085480829673 1104 44-45 -0.21891891891891646 1104 46-47 -0.12482715273413447 1104 48-49 0.05917661847894351 1104 50-51 -0.05163419233186772 1104 52-53 -0.23400377121307514 1104 54-55 -0.0575738529226939 1104 56-57 -0.0905405405405375 1104 58-59 -0.01794468887492684 1104 60-61 -0.0070081709616616195 1104 62-63 -0.153205531112512 1104 64-65 -0.007228158390951478 1104 66-67 -0.01257071024512868 1104 68-69 0.20386549340037874 1104 70-71 0.14091766184789378 1104 72-73 0.198805782526712 1104 74-75 0.39544311753613925 1104 76-77 0.34773727215587513 1104 78-79 0.2407291011942192 1104 80-81 0.17712130735386467 1104 82-83 0.10861093651791265 1104 84-85 0.17655562539282954 1104 86-87 0.20920804525455594 1104 88-89 0.2304211187932097 1104 90-91 0.037712130735393146 1104 92-93 0.02441860465116008 1104 94-95 -0.5052482715273392 1104 96-97 0.020364550597108177 1104 98-99 0.16065367693274624 1104 100 0.14688874921433026 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 14.0 28 23.0 29 47.0 30 78.0 31 85.0 32 135.0 33 191.0 34 262.0 35 442.0 36 749.0 37 909.0 38 924.0 39 138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.449999999999996 9.6 14.45 47.5 2 26.0 18.75 30.75 24.5 3 25.95 22.925 22.75 28.375 4 29.568193786203267 27.251184834123222 15.982095839915743 27.198525539757767 5 29.175 30.25 18.725 21.85 6 22.191643732799598 33.87540655491619 19.5896922692019 24.34325744308231 7 21.775 13.55 38.375 26.3 8 23.925 18.425 24.224999999999998 33.425 9 24.2 17.875 27.625 30.3 10-11 27.1625 26.674999999999997 19.1 27.0625 12-13 25.687500000000004 21.087500000000002 25.5125 27.712500000000002 14-15 24.975 23.525 23.6875 27.8125 16-17 25.974999999999998 22.75 22.9375 28.3375 18-19 26.337500000000002 24.0 23.125 26.5375 20-21 25.9625 23.175 23.3625 27.500000000000004 22-23 26.55 22.575 23.5375 27.3375 24-25 25.5125 23.7875 22.9875 27.712500000000002 26-27 27.075 23.599999999999998 23.175 26.150000000000002 28-29 26.2875 22.6125 23.525 27.575 30-31 25.624999999999996 23.674999999999997 23.200000000000003 27.500000000000004 32-33 26.424999999999997 23.9875 22.237499999999997 27.35 34-35 26.337500000000002 23.3625 23.4375 26.8625 36-37 26.575 23.025000000000002 23.2625 27.1375 38-39 26.187500000000004 23.9375 22.825 27.05 40-41 26.787499999999998 23.325000000000003 22.3875 27.500000000000004 42-43 26.187500000000004 23.4625 23.575 26.775 44-45 26.6125 23.075000000000003 23.225 27.0875 46-47 27.3125 22.662499999999998 23.175 26.85 48-49 26.087500000000002 23.7375 23.75 26.424999999999997 50-51 25.9625 22.900000000000002 23.875 27.2625 52-53 26.4125 24.1625 22.3125 27.1125 54-55 26.0125 23.2375 22.925 27.825 56-57 26.6125 23.200000000000003 23.075000000000003 27.1125 58-59 26.637499999999996 22.975 22.525000000000002 27.8625 60-61 26.125 23.962500000000002 22.825 27.0875 62-63 26.674999999999997 24.5 22.675 26.150000000000002 64-65 26.025 23.325000000000003 22.8 27.85 66-67 26.5625 22.8375 22.6875 27.9125 68-69 26.737499999999997 23.75 23.175 26.337500000000002 70-71 26.1125 24.349999999999998 21.9625 27.575 72-73 25.924999999999997 23.4375 23.125 27.5125 74-75 26.35 23.962500000000002 23.025000000000002 26.6625 76-77 27.075 23.2875 23.425 26.2125 78-79 26.5375 23.0375 23.5125 26.9125 80-81 26.7125 22.237499999999997 23.400000000000002 27.650000000000002 82-83 25.474999999999998 23.35 23.175 28.000000000000004 84-85 26.224999999999998 23.7875 23.200000000000003 26.787499999999998 86-87 27.250000000000004 22.900000000000002 23.5 26.35 88-89 26.9125 22.6875 23.1875 27.212500000000002 90-91 26.900000000000002 22.55 23.200000000000003 27.35 92-93 27.075 22.9625 23.225 26.737499999999997 94-95 27.025 23.175 22.925 26.875 96-97 27.325 23.1625 23.25 26.2625 98-99 27.750000000000004 23.0625 23.400000000000002 25.7875 100 27.525 23.65 22.375 26.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 3.0 30 5.5 31 5.0 32 8.5 33 11.0 34 14.5 35 24.0 36 32.5 37 44.0 38 55.5 39 71.0 40 85.5 41 100.5 42 119.5 43 142.5 44 155.5 45 153.0 46 151.0 47 151.5 48 143.5 49 131.0 50 118.5 51 110.0 52 101.5 53 98.0 54 95.5 55 95.0 56 97.0 57 96.0 58 97.0 59 114.0 60 119.5 61 102.5 62 107.0 63 116.0 64 115.5 65 97.0 66 90.0 67 92.5 68 78.5 69 76.0 70 67.5 71 50.5 72 49.0 73 45.5 74 37.5 75 33.5 76 28.0 77 17.0 78 11.5 79 9.5 80 8.5 81 8.0 82 3.5 83 1.0 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.050000000000001 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11727616645649 98.25 2 0.8827238335435058 1.7500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618235 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618235_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48175 34.0 31.0 34.0 31.0 34.0 2 32.8925 34.0 31.0 34.0 31.0 34.0 3 33.03725 34.0 33.0 34.0 31.0 34.0 4 36.448 37.0 37.0 37.0 35.0 37.0 5 36.486 37.0 37.0 37.0 35.0 37.0 6 36.50275 37.0 37.0 37.0 35.0 37.0 7 36.4905 37.0 37.0 37.0 35.0 37.0 8 36.515 37.0 37.0 37.0 35.0 37.0 9 38.29975 39.0 39.0 39.0 37.0 39.0 10-11 38.343375 39.0 39.0 39.0 37.0 39.0 12-13 38.230000000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.867625000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.781375 41.0 40.0 41.0 37.5 41.0 18-19 39.787000000000006 41.0 40.0 41.0 37.5 41.0 20-21 39.797124999999994 41.0 40.0 41.0 37.5 41.0 22-23 39.728375 41.0 40.0 41.0 37.5 41.0 24-25 39.611375 41.0 39.5 41.0 37.0 41.0 26-27 39.512375000000006 41.0 39.0 41.0 36.5 41.0 28-29 39.36 40.5 39.0 41.0 36.0 41.0 30-31 39.22525 40.0 38.5 41.0 35.5 41.0 32-33 39.136624999999995 40.0 38.0 41.0 35.5 41.0 34-35 39.032375 40.0 38.0 41.0 35.0 41.0 36-37 38.889875 40.0 38.0 41.0 35.0 41.0 38-39 38.698125 40.0 38.0 41.0 35.0 41.0 40-41 38.559375 40.0 37.5 41.0 34.5 41.0 42-43 38.274625 40.0 36.5 41.0 34.0 41.0 44-45 38.02525 40.0 36.0 41.0 33.5 41.0 46-47 37.780875 39.0 35.0 41.0 33.0 41.0 48-49 37.623375 39.0 35.0 41.0 33.0 41.0 50-51 37.046875 38.5 34.5 40.0 32.0 40.5 52-53 37.0045 38.5 35.0 40.0 33.0 41.0 54-55 37.24375 38.5 35.0 41.0 33.0 41.0 56-57 37.101625 37.5 35.0 41.0 33.0 41.0 58-59 36.987 37.0 35.0 40.5 33.0 41.0 60-61 36.641625000000005 36.5 35.0 40.0 33.0 41.0 62-63 36.367625000000004 36.0 35.0 40.0 33.0 41.0 64-65 36.179249999999996 35.5 35.0 39.0 33.0 41.0 66-67 35.830124999999995 35.0 35.0 39.0 32.0 41.0 68-69 35.567625 35.0 35.0 38.5 32.0 41.0 70-71 35.24925 35.0 34.0 37.0 31.0 40.0 72-73 34.928250000000006 35.0 34.0 37.0 31.0 39.0 74-75 34.662375 35.0 34.0 36.0 31.0 39.0 76-77 34.444874999999996 35.0 34.0 36.0 31.0 38.0 78-79 34.121125 35.0 34.0 35.0 30.0 37.0 80-81 33.880624999999995 35.0 33.5 35.0 30.0 37.0 82-83 33.65325 35.0 33.0 35.0 30.0 36.0 84-85 33.399 35.0 33.0 35.0 29.0 36.0 86-87 33.298 35.0 33.0 35.0 29.0 36.0 88-89 33.16175 35.0 33.0 35.0 29.0 35.5 90-91 32.840500000000006 35.0 33.0 35.0 28.0 35.0 92-93 32.543125 35.0 33.0 35.0 27.0 35.0 94-95 32.272375 35.0 33.0 35.0 27.0 35.0 96-97 32.0505 35.0 32.5 35.0 27.0 35.0 98-99 31.649375 35.0 32.0 35.0 26.0 35.0 100 31.251 35.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.15543683218101734 1101 2 0.16134506599622256 1101 3 0.03746071653048233 1101 4 0.18516656191074787 1101 5 0.048460087994975254 1101 6 0.05160276555625387 1101 7 0.2925204274041491 1101 8 0.05581395348836793 1101 9 0.2562539283469505 1101 10-11 0.1528284098051529 1101 12-13 0.2212130735386566 1101 14-15 0.14446888749213826 1101 16-17 0.0562225015713409 1101 18-19 0.15021998742928844 1101 20-21 0.03425518541797601 1101 22-23 0.2772470144563215 1101 24-25 0.11763042111879685 1101 26-27 0.0028598365807681603 1101 28-29 0.1704588309239483 1101 30-31 0.11737900691389314 1101 32-33 0.10314267756128004 1101 34-35 0.19792583280955256 1101 36-37 0.13082966687617414 1101 38-39 0.3138906348208721 1101 40-41 0.13434946574481899 1101 42-43 0.07221873035826576 1101 44-45 0.13856065367692594 1101 46-47 -0.05025141420490087 1101 48-49 0.19010056568196632 1101 50-51 -0.008390949088628474 1101 52-53 -0.07250157133878332 1101 54-55 -0.10043997485858114 1101 56-57 0.010339409176616243 1101 58-59 -0.11304211187931656 1101 60-61 -0.15188560653676575 1101 62-63 0.0023255813953468873 1101 64-65 -0.15304839723444275 1101 66-67 -0.02001885606536291 1101 68-69 -0.08205531112507458 1101 70-71 -0.006976744186040662 1101 72-73 0.08020113136392126 1101 74-75 -0.29883720930232016 1101 76-77 -0.22159019484601572 1101 78-79 -0.09437460716529955 1101 80-81 -0.1530798240100566 1101 82-83 -0.16961030798240273 1101 84-85 -0.5379949717158965 1101 86-87 -0.1649905719673157 1101 88-89 -0.35235700817096216 1101 90-91 -0.22602137020741964 1101 92-93 0.26888749214330687 1101 94-95 0.13048397234443598 1101 96-97 0.05424261470773217 1101 98-99 0.1153048397234464 1101 100 0.18026398491514684 1104 1 -0.15543683218101734 1104 2 -0.16134506599622966 1104 3 -0.037460716530489435 1104 4 -0.18516656191074787 1104 5 -0.04846008799496815 1104 6 -0.05160276555625387 1104 7 -0.2925204274041491 1104 8 -0.055813953488375034 1104 9 -0.2562539283469576 1104 10-11 -0.1528284098051529 1104 12-13 -0.2212130735386495 1104 14-15 -0.14446888749214537 1104 16-17 -0.056222501571333794 1104 18-19 -0.15021998742928844 1104 20-21 -0.03425518541797601 1104 22-23 -0.2772470144563144 1104 24-25 -0.11763042111879685 1104 26-27 -0.0028598365807681603 1104 28-29 -0.1704588309239483 1104 30-31 -0.11737900691389314 1104 32-33 -0.10314267756128004 1104 34-35 -0.19792583280955256 1104 36-37 -0.13082966687618125 1104 38-39 -0.313890634820865 1104 40-41 -0.13434946574481899 1104 42-43 -0.07221873035826576 1104 44-45 -0.13856065367693304 1104 46-47 0.05025141420490087 1104 48-49 -0.1901005656819592 1104 50-51 0.008390949088621369 1104 52-53 0.07250157133877622 1104 54-55 0.10043997485858114 1104 56-57 -0.010339409176616243 1104 58-59 0.11304211187932367 1104 60-61 0.15188560653677285 1104 62-63 -0.0023255813953468873 1104 64-65 0.15304839723444275 1104 66-67 0.020018856065370016 1104 68-69 0.08205531112508169 1104 70-71 0.0069767441860477675 1104 72-73 -0.08020113136392126 1104 74-75 0.29883720930232727 1104 76-77 0.22159019484600861 1104 78-79 0.09437460716530666 1104 80-81 0.1530798240100566 1104 82-83 0.16961030798240273 1104 84-85 0.5379949717159036 1104 86-87 0.1649905719673157 1104 88-89 0.35235700817096216 1104 90-91 0.22602137020741253 1104 92-93 -0.26888749214330687 1104 94-95 -0.13048397234443954 1104 96-97 -0.05424261470773217 1104 98-99 -0.11530483972344285 1104 100 -0.18026398491514684 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 13.0 28 31.0 29 40.0 30 73.0 31 90.0 32 119.0 33 151.0 34 261.0 35 475.0 36 715.0 37 947.0 38 893.0 39 190.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.999999999999996 10.549999999999999 13.15 47.3 2 26.3 18.05 31.7 23.95 3 27.875 22.425 22.175 27.525 4 29.349999999999998 27.875 15.45 27.325 5 31.275 28.199999999999996 18.9 21.625 6 22.675 32.300000000000004 19.55 25.474999999999998 7 21.4 15.25 37.925 25.424999999999997 8 23.7 19.425 24.525 32.35 9 23.45 18.7 27.250000000000004 30.599999999999998 10-11 26.42901813633521 27.654784240150093 18.936835522201374 26.97936210131332 12-13 25.3125 21.349999999999998 25.5125 27.825 14-15 26.1 22.8375 23.4875 27.575 16-17 27.187499999999996 22.875 22.5 27.437499999999996 18-19 26.6625 23.1 23.5625 26.674999999999997 20-21 26.974999999999998 23.825 22.5 26.700000000000003 22-23 26.237500000000004 23.200000000000003 22.8625 27.700000000000003 24-25 25.7375 23.625 23.2625 27.375 26-27 25.9625 23.525 23.3625 27.150000000000002 28-29 27.025 22.650000000000002 23.5375 26.787499999999998 30-31 26.775 23.1 22.875 27.250000000000004 32-33 26.5125 23.6625 23.5625 26.2625 34-35 26.8625 22.5875 24.075 26.474999999999998 36-37 25.724999999999998 23.775 22.675 27.825 38-39 25.937500000000004 23.5125 23.375 27.175 40-41 27.487499999999997 22.825 23.150000000000002 26.5375 42-43 25.724999999999998 24.0625 22.8125 27.400000000000002 44-45 26.450000000000003 22.7 24.05 26.8 46-47 27.075 23.95 22.325 26.650000000000002 48-49 26.987499999999997 22.6875 22.475 27.85 50-51 26.0375 22.7 23.6875 27.575 52-53 27.0125 23.3 22.95 26.737499999999997 54-55 26.187500000000004 23.0125 23.6125 27.187499999999996 56-57 26.3625 23.1125 23.3625 27.1625 58-59 27.0625 23.575 23.4875 25.874999999999996 60-61 26.2125 23.575 23.3625 26.85 62-63 25.937500000000004 23.5 23.0125 27.55 64-65 27.175 23.3875 23.275000000000002 26.1625 66-67 26.6625 24.1625 22.7625 26.4125 68-69 26.887499999999996 22.8625 23.3625 26.887499999999996 70-71 26.424999999999997 23.75 22.475 27.35 72-73 26.5375 23.5625 22.9625 26.937499999999996 74-75 26.637499999999996 24.0375 23.05 26.275 76-77 26.987499999999997 22.95 23.3625 26.700000000000003 78-79 27.3 23.0875 22.925 26.687499999999996 80-81 26.85 23.375 23.775 26.0 82-83 26.8375 23.3 23.275000000000002 26.5875 84-85 26.5125 22.875 23.474999999999998 27.1375 86-87 27.1 23.4625 22.3625 27.075 88-89 27.037499999999998 23.1625 23.35 26.450000000000003 90-91 26.7125 23.4625 22.5875 27.237499999999997 92-93 27.037499999999998 23.575 22.7375 26.650000000000002 94-95 26.2625 22.662499999999998 24.725 26.35 96-97 27.2625 23.1875 22.8875 26.6625 98-99 26.75 22.975 22.8625 27.4125 100 26.924999999999997 24.125 22.475 26.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 1.5 29 4.5 30 6.5 31 7.0 32 10.5 33 12.0 34 19.5 35 29.0 36 34.5 37 48.5 38 62.5 39 67.5 40 73.5 41 90.0 42 112.5 43 142.5 44 154.0 45 141.5 46 140.0 47 143.0 48 144.0 49 142.5 50 132.5 51 111.5 52 103.5 53 112.5 54 107.0 55 87.0 56 89.5 57 103.5 58 96.5 59 99.5 60 113.0 61 118.0 62 116.5 63 103.0 64 86.0 65 90.5 66 93.5 67 87.5 68 82.5 69 75.5 70 76.0 71 63.0 72 46.0 73 47.5 74 49.0 75 34.5 76 24.0 77 19.0 78 12.5 79 10.0 80 8.0 81 5.5 82 3.5 83 1.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0625 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88776541961577 97.8 2 1.1122345803842264 2.1999999999999997 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562460 spots for SRR8618235.sra Written 562460 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra Read 562458 spots for SRR8618235.sra Written 562458 spots for SRR8618235.sra SRR ids: ['SRR8618235.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m0uat97_ SRR8618235.sra spots: 11249162 blocks: [[1, 562458], [562459, 1124916], [1124917, 1687374], [1687375, 2249832], [2249833, 2812290], [2812291, 3374748], [3374749, 3937206], [3937207, 4499664], [4499665, 5062122], [5062123, 5624580], [5624581, 6187038], [6187039, 6749496], [6749497, 7311954], [7311955, 7874412], [7874413, 8436870], [8436871, 8999328], [8999329, 9561786], [9561787, 10124244], [10124245, 10686702], [10686703, 11249162]] SRR8618235 file size 2927612 SRR8618235 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618235 SRR8618235_1.fastq SRR8618235_2.fastq Input file: SRR8618235_1.fastq Paired file: SRR8618235_2.fastq trimmed: SRR8618235-trimmed-pair1.fastq, SRR8618235-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 08:49:06 2024 >> started Sat Dec 7 08:49:16 2024 >> done (10.091s) 11249162 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11249162 (100.00%) read pairs available; of these: 1365839 (12.14%) trimmed read pairs available after processing 9883323 (87.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 76 1 0.00% 77 0 0.00% 78 0 0.00% 79 0 0.00% 80 0 0.00% 81 10 0.00% 82 34 0.00% 83 83 0.00% 84 4908 0.04% 85 5146 0.05% 86 5575 0.05% 87 6275 0.06% 88 7437 0.07% 89 9431 0.08% 90 15872 0.14% 91 29825 0.27% 92 43571 0.39% 93 60902 0.54% 94 82272 0.73% 95 106363 0.95% 96 141690 1.26% 97 196396 1.75% 98 277042 2.46% 99 373006 3.32% 100 9883323 87.86% 11249162 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=14 prefix-density=0.40 prefix-fanout=3.8 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=32 fanout-score=37.87 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=9.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=15 prefix-density=0.40 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=31 fanout-score=39.78 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=9.6 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618235 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 08:49:47 Started mapping on | Dec 07 08:49:47 Finished on | Dec 07 08:50:21 Mapping speed, Million of reads per hour | 1191.09 Number of input reads | 11249162 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10959047 Uniquely mapped reads % | 97.42% Average mapped length | 198.20 Number of splices: Total | 6736537 Number of splices: Annotated (sjdb) | 6411919 Number of splices: GT/AG | 6637836 Number of splices: GC/AG | 78763 Number of splices: AT/AC | 2227 Number of splices: Non-canonical | 17711 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 119413 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 8070 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 170702 170702 170702 N_multimapping 119413 119413 119413 N_noFeature 279772 5485759 5538623 N_ambiguous 254025 19996 20936 UnstrandedReadsAssigned:10425250 PositiveStrandReadsAssigned:5453292 NegativeStrandReadsAssigned:5399488 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618235 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618235-trimmed-pair1.fastq SRR8618235-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,249,162 reads, 10,652,520 reads pseudoaligned [quant] estimated average fragment length: 167.678 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52973 SRR8618235.ke.tsv 35125 SRR8618235.se.tsv 88098 total ==> SRR8618235.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.455 0 0 PNS24247 1044 877.322 12.8139 1.87556 PNS24249 1928 1761.32 63.8216 4.65303 PNS24246 1044 877.322 12.8139 1.87556 PNS24248 1044 877.322 12.8139 1.87556 PNS24244 1471 1304.32 13.7367 1.3524 PNS24243 293 134.149 2 1.91447 KQK14069 1603 1436.32 3182.15 284.496 KQK14071 474 308.928 274.022 113.903 ==> SRR8618235.se.tsv <== BRADI_1g14170v3 3788 BRADI_1g53295v3 193 BRADI_1g59795v3 208 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 832 BRADI_1g74790v3 30 BRADI_1g09890v3 3 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR8618235 completed mapping pipeline successfully