Starting /dee2/code/volunteer_pipeline.sh SRR8618236 current disk space = 1544319172608 free memory = 1598494236 SRR8618236 SRAfilesize fb7db3a3ab080c821b8fae105e965e8b SRR8618236.sra SRR8618236.sra file validated SRR8618236 is paired end SRR8618236 is conventional basespace SRR8618236 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618236_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.013 34.0 31.0 34.0 31.0 34.0 2 33.19375 34.0 33.0 34.0 31.0 34.0 3 33.253 34.0 34.0 34.0 31.0 34.0 4 34.5805 37.0 37.0 37.0 35.0 37.0 5 35.4925 37.0 37.0 37.0 35.0 37.0 6 36.20975 37.0 37.0 37.0 35.0 37.0 7 36.238 37.0 37.0 37.0 35.0 37.0 8 36.3545 37.0 37.0 37.0 35.0 37.0 9 38.36975 39.0 39.0 39.0 37.0 39.0 10-11 38.37975 39.0 39.0 39.0 37.0 39.0 12-13 38.295500000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.888374999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.818625 41.0 40.0 41.0 38.0 41.0 18-19 39.805375 41.0 40.0 41.0 37.5 41.0 20-21 39.688 41.0 40.0 41.0 37.0 41.0 22-23 39.647875 41.0 40.0 41.0 37.0 41.0 24-25 39.49575 41.0 39.0 41.0 37.0 41.0 26-27 39.354625 40.5 39.0 41.0 36.0 41.0 28-29 39.166624999999996 40.0 38.5 41.0 35.5 41.0 30-31 38.919875000000005 40.0 38.0 41.0 35.0 41.0 32-33 38.830875 40.0 38.0 41.0 35.0 41.0 34-35 38.87575 40.0 38.0 41.0 35.0 41.0 36-37 38.972875 40.0 38.0 41.0 35.0 41.0 38-39 38.829499999999996 40.0 38.0 41.0 35.0 41.0 40-41 38.698625 40.0 37.5 41.0 35.0 41.0 42-43 38.492000000000004 40.0 37.0 41.0 35.0 41.0 44-45 38.205625 40.0 36.0 41.0 34.0 41.0 46-47 37.85725 39.0 35.0 41.0 33.5 41.0 48-49 37.611000000000004 39.0 35.0 41.0 33.5 41.0 50-51 37.416875 39.0 35.0 41.0 33.0 41.0 52-53 37.185125 38.0 35.0 41.0 33.0 41.0 54-55 36.7885 37.0 35.0 40.5 33.0 41.0 56-57 36.616749999999996 37.0 35.0 40.0 33.0 41.0 58-59 36.35975 36.0 35.0 40.0 32.0 41.0 60-61 35.98575 35.5 35.0 39.0 32.0 41.0 62-63 35.812625 35.0 35.0 39.0 31.5 41.0 64-65 35.58125 35.0 34.0 39.0 31.0 41.0 66-67 35.322 35.0 34.0 38.5 31.0 40.5 68-69 34.95125 35.0 34.0 37.0 30.5 40.0 70-71 34.736875 35.0 34.0 37.0 30.5 39.5 72-73 34.369875 35.0 33.5 36.0 30.0 39.0 74-75 34.11775 35.0 33.0 36.0 30.0 38.5 76-77 33.194874999999996 34.5 32.5 35.0 28.0 37.0 78-79 33.778125 35.0 33.0 35.0 29.5 37.0 80-81 33.722375 35.0 33.0 35.0 30.0 36.5 82-83 33.589124999999996 35.0 33.0 35.0 30.0 36.0 84-85 33.208124999999995 35.0 33.0 35.0 29.0 36.0 86-87 33.0155 35.0 33.0 35.0 29.0 35.5 88-89 32.851749999999996 35.0 33.0 35.0 28.5 35.0 90-91 32.509125 35.0 33.0 35.0 27.0 35.0 92-93 32.187 35.0 32.0 35.0 27.0 35.0 94-95 32.051249999999996 34.0 32.0 35.0 27.0 35.0 96-97 31.75625 34.0 32.0 35.0 25.0 35.0 98-99 31.426375 34.0 32.0 35.0 25.0 35.0 100 31.0575 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0028318401812370553 1101 2 0.012485840799094206 1101 3 0.029322417876635143 1101 4 -2.5969776542065723 1101 5 -1.3724127278344156 1101 6 -0.3853619606631611 1101 7 -0.10972093502213909 1101 8 0.04183400267737625 1101 9 0.08256101328390741 1101 10-11 0.03462568221604556 1101 12-13 0.13918494490783218 1101 14-15 0.017390073112963478 1101 16-17 0.13309648851817713 1101 18-19 0.1957445165276539 1101 20-21 0.28337709813613543 1101 22-23 0.08581762949232541 1101 24-25 0.07940737308207702 1101 26-27 -0.11610544743074769 1101 28-29 -0.07638245288848111 1101 30-31 -0.04575996292864204 1101 32-33 -0.013618576871593291 1101 34-35 0.14523478529502398 1101 36-37 0.16924106683143236 1101 38-39 0.28560395427865615 1101 40-41 0.015304808979507811 1101 42-43 0.13627587272166153 1101 44-45 0.17363041911234944 1101 46-47 0.31121923591803125 1101 48-49 0.20452322108948806 1101 50-51 0.21018690145195507 1101 52-53 0.16178817835444192 1101 54-55 0.06542838018742003 1101 56-57 0.2121563175780068 1101 58-59 0.1951781484914008 1101 60-61 0.29775512305632645 1101 62-63 0.23605962310781337 1101 64-65 0.24931778395633586 1101 66-67 0.035192050252284446 1101 68-69 -0.07748944495932619 1101 70-71 0.1123082071877235 1101 72-73 -0.03293945010813104 1101 74-75 0.044292554834719056 1101 76-77 -0.1250257440016469 1101 78-79 -0.2701318092884364 1101 80-81 -0.2236638863144904 1101 82-83 -0.14137318504788254 1101 84-85 -0.07150396457625163 1101 86-87 0.06663834826485271 1101 88-89 -0.09172587787045217 1101 90-91 -0.6453120172999682 1101 92-93 -0.6769385233240683 1101 94-95 -0.14900628153640483 1101 96-97 -0.010542168674700036 1101 98-99 0.1443208732365342 1101 100 0.015188960972093213 1104 1 -0.0028318401812370553 1104 2 -0.012485840799094206 1104 3 -0.029322417876635143 1104 4 2.596977654206569 1104 5 1.3724127278344085 1104 6 0.3853619606631682 1104 7 0.10972093502213909 1104 8 -0.04183400267737625 1104 9 -0.08256101328390031 1104 10-11 -0.03462568221604556 1104 12-13 -0.13918494490783218 1104 14-15 -0.017390073112963478 1104 16-17 -0.13309648851817002 1104 18-19 -0.1957445165276468 1104 20-21 -0.2833770981361283 1104 22-23 -0.08581762949233251 1104 24-25 -0.07940737308206991 1104 26-27 0.11610544743074769 1104 28-29 0.076382452888474 1104 30-31 0.04575996292864204 1104 32-33 0.013618576871593291 1104 34-35 -0.14523478529502398 1104 36-37 -0.16924106683143236 1104 38-39 -0.28560395427865615 1104 40-41 -0.015304808979507811 1104 42-43 -0.13627587272165442 1104 44-45 -0.17363041911234944 1104 46-47 -0.31121923591803125 1104 48-49 -0.20452322108948806 1104 50-51 -0.21018690145196217 1104 52-53 -0.16178817835444903 1104 54-55 -0.06542838018741293 1104 56-57 -0.2121563175779997 1104 58-59 -0.1951781484914008 1104 60-61 -0.29775512305632645 1104 62-63 -0.23605962310782047 1104 64-65 -0.24931778395634296 1104 66-67 -0.03519205025229155 1104 68-69 0.07748944495932619 1104 70-71 -0.1123082071877306 1104 72-73 0.032939450108123935 1104 74-75 -0.044292554834719056 1104 76-77 0.1250257440016469 1104 78-79 0.2701318092884364 1104 80-81 0.2236638863144833 1104 82-83 0.14137318504788965 1104 84-85 0.07150396457625874 1104 86-87 -0.06663834826485271 1104 88-89 0.09172587787045927 1104 90-91 0.6453120172999718 1104 92-93 0.6769385233240683 1104 94-95 0.14900628153640127 1104 96-97 0.010542168674696484 1104 98-99 -0.1443208732365342 1104 100 -0.015188960972093213 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 14.0 28 34.0 29 51.0 30 78.0 31 109.0 32 145.0 33 191.0 34 265.0 35 516.0 36 745.0 37 937.0 38 764.0 39 148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.175 11.5 12.85 48.475 2 26.55 17.7 30.625000000000004 25.124999999999996 3 26.950000000000003 21.825 22.25 28.975 4 30.53860440435129 25.89546298752985 16.025470947200848 27.540461660918012 5 30.475 28.425 19.400000000000002 21.7 6 23.78689344672336 30.76538269134567 19.809904952476238 25.63781890945473 7 21.45 14.274999999999999 37.875 26.400000000000002 8 22.725 18.85 24.575 33.85 9 23.1 17.849999999999998 27.750000000000004 31.3 10-11 27.462500000000002 26.5125 18.075 27.950000000000003 12-13 24.875 20.0375 25.525 29.562500000000004 14-15 27.125 21.6625 22.7375 28.475 16-17 26.875 22.6 21.825 28.7 18-19 26.6125 23.875 21.8625 27.650000000000002 20-21 27.025 23.1625 22.3125 27.500000000000004 22-23 27.1 22.8375 22.075 27.987499999999997 24-25 25.374999999999996 22.6125 22.662499999999998 29.349999999999998 26-27 26.700000000000003 22.75 22.3 28.249999999999996 28-29 27.05 22.2625 22.537499999999998 28.15 30-31 26.1 24.087500000000002 22.7125 27.1 32-33 27.200000000000003 22.8875 22.7625 27.150000000000002 34-35 26.6625 22.325 23.0375 27.975 36-37 26.387500000000003 22.7375 22.650000000000002 28.225 38-39 27.1125 23.575 21.85 27.462500000000002 40-41 26.200000000000003 22.925 22.7 28.175 42-43 26.4125 22.6875 23.3125 27.5875 44-45 27.025 22.875 21.8 28.299999999999997 46-47 26.687499999999996 22.675 23.1625 27.474999999999998 48-49 26.724999999999998 21.7 22.650000000000002 28.925 50-51 26.2125 23.2125 23.1875 27.3875 52-53 27.450000000000003 23.0375 21.712500000000002 27.800000000000004 54-55 27.075 22.1875 22.725 28.012500000000003 56-57 26.575 22.85 22.55 28.025 58-59 27.287499999999998 22.237499999999997 22.650000000000002 27.825 60-61 26.187500000000004 22.825 21.837500000000002 29.15 62-63 27.0 23.125 22.6875 27.187499999999996 64-65 28.000000000000004 22.05 21.625 28.325 66-67 26.450000000000003 21.712500000000002 23.175 28.6625 68-69 27.537499999999998 22.3125 22.8875 27.2625 70-71 27.900000000000002 22.3 22.325 27.474999999999998 72-73 27.05 22.975 22.525000000000002 27.450000000000003 74-75 27.237499999999997 23.1625 23.0625 26.5375 76-77 27.3625 21.8875 22.5875 28.1625 78-79 27.275 22.875 22.475 27.375 80-81 26.787499999999998 23.175 23.25 26.787499999999998 82-83 27.200000000000003 22.325 22.75 27.725 84-85 26.700000000000003 22.975 23.075000000000003 27.250000000000004 86-87 27.0 22.2625 22.95 27.787499999999998 88-89 27.6625 22.787499999999998 22.275 27.275 90-91 27.375 22.1 22.775000000000002 27.750000000000004 92-93 28.037499999999998 22.975 22.9625 26.025 94-95 28.275 22.575 22.400000000000002 26.75 96-97 28.025 22.3 22.6125 27.0625 98-99 28.512500000000003 22.8 22.5 26.187500000000004 100 28.549999999999997 21.925 21.6 27.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 0.5 29 0.5 30 2.5 31 8.5 32 8.5 33 6.0 34 16.0 35 23.0 36 30.0 37 40.5 38 51.5 39 61.5 40 67.5 41 84.5 42 103.0 43 124.5 44 144.5 45 142.0 46 131.5 47 121.5 48 119.0 49 125.5 50 116.5 51 98.0 52 99.5 53 108.0 54 98.0 55 87.0 56 94.0 57 96.0 58 103.5 59 124.0 60 127.5 61 125.0 62 122.5 63 119.0 64 118.0 65 113.5 66 105.5 67 103.0 68 97.5 69 92.5 70 91.5 71 71.5 72 63.5 73 55.0 74 37.5 75 34.0 76 26.0 77 17.5 78 13.0 79 11.0 80 7.0 81 4.5 82 3.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.775 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618236 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618236_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5595 34.0 31.0 34.0 31.0 34.0 2 32.987 34.0 31.0 34.0 31.0 34.0 3 33.04575 34.0 33.0 34.0 31.0 34.0 4 36.47225 37.0 37.0 37.0 35.0 37.0 5 36.529 37.0 37.0 37.0 35.0 37.0 6 36.51725 37.0 37.0 37.0 35.0 37.0 7 36.49375 37.0 37.0 37.0 35.0 37.0 8 36.57325 37.0 37.0 37.0 35.0 37.0 9 38.387 39.0 39.0 39.0 37.0 39.0 10-11 38.382875 39.0 39.0 39.0 37.0 39.0 12-13 38.31425 39.0 39.0 39.0 37.0 39.0 14-15 39.907875000000004 41.0 40.0 41.0 38.0 41.0 16-17 39.82025 41.0 40.0 41.0 38.0 41.0 18-19 39.761375 41.0 40.0 41.0 37.5 41.0 20-21 39.774125 41.0 40.0 41.0 37.5 41.0 22-23 39.699875 41.0 40.0 41.0 37.0 41.0 24-25 39.60575 41.0 39.0 41.0 37.0 41.0 26-27 39.472625 41.0 39.0 41.0 36.0 41.0 28-29 39.355875 41.0 39.0 41.0 36.0 41.0 30-31 39.150375 40.0 38.0 41.0 35.0 41.0 32-33 39.050125 40.0 38.0 41.0 35.0 41.0 34-35 39.006625 40.0 38.0 41.0 35.0 41.0 36-37 38.7585 40.0 38.0 41.0 35.0 41.0 38-39 38.558499999999995 40.0 37.5 41.0 35.0 41.0 40-41 38.36475 40.0 37.0 41.0 34.0 41.0 42-43 38.063375 40.0 36.0 41.0 33.0 41.0 44-45 37.761750000000006 39.5 35.5 41.0 33.0 41.0 46-47 37.46525 39.0 35.0 41.0 33.0 41.0 48-49 37.282125 39.0 35.0 41.0 33.0 41.0 50-51 36.73725 38.0 34.5 40.0 32.0 40.5 52-53 36.730374999999995 38.0 35.0 40.0 32.5 41.0 54-55 36.969125000000005 37.0 35.0 40.0 33.0 41.0 56-57 36.812 37.0 35.0 40.0 33.0 41.0 58-59 36.616625 36.0 35.0 40.0 33.0 41.0 60-61 36.35025 35.5 35.0 40.0 33.0 41.0 62-63 36.141875 35.0 35.0 39.0 33.0 41.0 64-65 35.877375 35.0 35.0 39.0 32.0 41.0 66-67 35.63725 35.0 35.0 38.5 32.0 41.0 68-69 35.301375 35.0 34.5 37.5 31.5 40.0 70-71 34.913250000000005 35.0 34.0 37.0 31.0 39.5 72-73 34.625125 35.0 34.0 36.5 31.0 39.0 74-75 34.294875000000005 35.0 34.0 36.0 30.0 38.5 76-77 34.114625000000004 35.0 34.0 35.5 30.0 37.0 78-79 33.96925 35.0 34.0 35.0 30.0 37.0 80-81 33.747749999999996 35.0 33.5 35.0 30.0 36.5 82-83 33.42775 35.0 33.0 35.0 29.0 36.0 84-85 33.350625 35.0 33.0 35.0 29.0 36.0 86-87 33.184625 35.0 33.0 35.0 29.0 35.5 88-89 32.969625 35.0 33.0 35.0 29.0 35.0 90-91 32.751625000000004 35.0 33.0 35.0 28.0 35.0 92-93 32.423 35.0 33.0 35.0 27.0 35.0 94-95 32.106375 35.0 32.5 35.0 26.0 35.0 96-97 31.7435 34.0 32.0 35.0 25.0 35.0 98-99 31.36475 34.0 31.5 35.0 24.5 35.0 100 30.94925 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.12691792812275082 1101 2 0.0899752857584204 1101 3 0.05694573164452521 1101 4 -0.02098136134280537 1101 5 0.10385130264648268 1101 6 0.11940067964164314 1101 7 0.02973432190299974 1101 8 0.07939450108125357 1101 9 0.15173514571105073 1101 10-11 0.1089228709710639 1101 12-13 0.21630110184327123 1101 14-15 0.19257800432499295 1101 16-17 0.14204252909072324 1101 18-19 0.1601791782514681 1101 20-21 0.09808464627741387 1101 22-23 0.08758109360518773 1101 24-25 0.051320667284528554 1101 26-27 0.20696890124601452 1101 28-29 0.1670270826897351 1101 30-31 0.2493821439604602 1101 32-33 0.019951601276900988 1101 34-35 0.23139995880959674 1101 36-37 0.44208886829368765 1101 38-39 0.36309339923797523 1101 40-41 0.2657682010091662 1101 42-43 0.3331531253217932 1101 44-45 0.10996550303779173 1101 46-47 0.20581042117186854 1101 48-49 -0.02555092163525785 1101 50-51 0.1890253320976214 1101 52-53 -0.05309700339820722 1101 54-55 0.0995649263721532 1101 56-57 0.2093373493975932 1101 58-59 0.1739522191329428 1101 60-61 0.12977551230562767 1101 62-63 0.12816651220265385 1101 64-65 0.13603130470600888 1101 66-67 -0.009576768612909348 1101 68-69 -0.05617341159509692 1101 70-71 0.022886417464732745 1101 72-73 0.12659612810215037 1101 74-75 0.23240397487385422 1101 76-77 0.19802286067346841 1101 78-79 0.3315569972196428 1101 80-81 0.10898723097518115 1101 82-83 0.09296158994953885 1101 84-85 0.30532385954072794 1101 86-87 0.17962877149624035 1101 88-89 0.3803032643394033 1101 90-91 0.17375913912059104 1101 92-93 0.09996395839769434 1101 94-95 0.14940531356193532 1101 96-97 0.024817217588303464 1101 98-99 -0.15315106580166926 1101 100 -0.34926887035320675 1104 1 -0.12691792812274372 1104 2 -0.0899752857584204 1104 3 -0.05694573164452521 1104 4 0.02098136134280537 1104 5 -0.10385130264648268 1104 6 -0.11940067964164314 1104 7 -0.029734321902992633 1104 8 -0.07939450108124646 1104 9 -0.15173514571105073 1104 10-11 -0.1089228709710639 1104 12-13 -0.21630110184327123 1104 14-15 -0.19257800432499295 1104 16-17 -0.14204252909071613 1104 18-19 -0.1601791782514681 1104 20-21 -0.09808464627742097 1104 22-23 -0.08758109360518773 1104 24-25 -0.05132066728452145 1104 26-27 -0.20696890124600742 1104 28-29 -0.167027082689728 1104 30-31 -0.2493821439604602 1104 32-33 -0.019951601276900988 1104 34-35 -0.23139995880959674 1104 36-37 -0.44208886829368765 1104 38-39 -0.36309339923798234 1104 40-41 -0.2657682010091591 1104 42-43 -0.3331531253218003 1104 44-45 -0.10996550303779173 1104 46-47 -0.20581042117186144 1104 48-49 0.02555092163525785 1104 50-51 -0.1890253320976214 1104 52-53 0.05309700339820722 1104 54-55 -0.0995649263721532 1104 56-57 -0.20933734939758608 1104 58-59 -0.1739522191329428 1104 60-61 -0.12977551230563478 1104 62-63 -0.12816651220265385 1104 64-65 -0.13603130470600178 1104 66-67 0.009576768612909348 1104 68-69 0.05617341159509692 1104 70-71 -0.022886417464732745 1104 72-73 -0.12659612810215037 1104 74-75 -0.23240397487384712 1104 76-77 -0.1980228606734613 1104 78-79 -0.33155699721964993 1104 80-81 -0.10898723097518115 1104 82-83 -0.09296158994954595 1104 84-85 -0.30532385954072794 1104 86-87 -0.17962877149624035 1104 88-89 -0.3803032643394104 1104 90-91 -0.17375913912058394 1104 92-93 -0.09996395839769434 1104 94-95 -0.14940531356194242 1104 96-97 -0.02481721758829991 1104 98-99 0.15315106580166926 1104 100 0.34926887035320675 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 11.0 28 34.0 29 38.0 30 76.0 31 102.0 32 134.0 33 195.0 34 267.0 35 471.0 36 781.0 37 904.0 38 840.0 39 144.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.85 9.8 12.8 50.55 2 26.85 17.9 30.075000000000003 25.174999999999997 3 28.549999999999997 22.15 21.45 27.85 4 29.849999999999998 25.275 16.275000000000002 28.599999999999998 5 30.625000000000004 29.725 18.275 21.375 6 23.724999999999998 32.074999999999996 19.3 24.9 7 21.15 13.125 37.35 28.375 8 22.25 19.875 23.9 33.975 9 22.975 18.8 28.199999999999996 30.025000000000002 10-11 28.214107053526767 25.387693846923458 18.496748374187096 27.901450725362682 12-13 25.162499999999998 21.275 24.7375 28.825 14-15 26.825 22.6875 22.650000000000002 27.8375 16-17 26.987499999999997 22.7625 22.3375 27.9125 18-19 26.437500000000004 22.4375 22.4625 28.6625 20-21 26.687499999999996 23.799999999999997 21.837500000000002 27.675 22-23 27.3 22.7 21.85 28.15 24-25 26.424999999999997 23.599999999999998 21.099999999999998 28.875 26-27 26.55 23.4875 21.8125 28.15 28-29 26.924999999999997 22.775000000000002 22.0125 28.287499999999998 30-31 26.025 22.9625 22.7375 28.275 32-33 26.75 23.1125 22.7125 27.425 34-35 26.825 23.275000000000002 22.275 27.625 36-37 26.575 23.0625 22.525000000000002 27.8375 38-39 27.0125 22.975 22.35 27.6625 40-41 27.05 22.075 23.0625 27.8125 42-43 26.775 22.537499999999998 22.5625 28.125 44-45 27.3 22.775000000000002 22.925 27.0 46-47 26.8625 23.2125 21.525 28.4 48-49 27.3625 22.5625 23.0 27.075 50-51 26.575 23.35 22.537499999999998 27.537499999999998 52-53 26.8625 22.3375 23.3875 27.4125 54-55 26.9625 23.2375 22.6875 27.1125 56-57 27.1 23.400000000000002 22.8 26.700000000000003 58-59 28.4125 23.05 21.325 27.212500000000002 60-61 27.425 21.75 23.4625 27.3625 62-63 27.0 22.900000000000002 22.425 27.675 64-65 27.6125 22.412499999999998 22.675 27.3 66-67 26.6 22.650000000000002 23.0 27.750000000000004 68-69 27.250000000000004 23.3875 22.7375 26.625 70-71 28.025 22.275 22.2625 27.437499999999996 72-73 26.974999999999998 23.2875 22.025 27.712500000000002 74-75 27.900000000000002 23.0125 22.0125 27.075 76-77 28.175 22.025 21.775 28.025 78-79 26.8125 23.025000000000002 22.85 27.3125 80-81 27.3 23.0125 22.0125 27.675 82-83 27.175 23.4375 22.225 27.1625 84-85 27.3875 22.35 22.4375 27.825 86-87 26.987499999999997 22.7125 22.7125 27.5875 88-89 27.55 22.425 22.775000000000002 27.250000000000004 90-91 27.4125 22.900000000000002 22.6375 27.05 92-93 27.762500000000003 23.400000000000002 22.4625 26.375 94-95 27.525 22.7 22.3375 27.437499999999996 96-97 27.5125 22.4875 22.125 27.875 98-99 27.975 23.05 22.45 26.525 100 28.299999999999997 21.925 23.05 26.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 1.0 25 0.5 26 0.0 27 0.5 28 0.5 29 0.0 30 1.0 31 4.5 32 9.0 33 12.5 34 10.0 35 16.5 36 34.0 37 47.0 38 47.0 39 56.5 40 78.5 41 89.0 42 106.0 43 118.0 44 138.0 45 135.0 46 130.0 47 141.5 48 133.0 49 125.5 50 112.0 51 105.5 52 101.5 53 91.5 54 88.0 55 87.5 56 89.0 57 100.5 58 106.5 59 116.5 60 128.0 61 123.0 62 122.0 63 118.0 64 110.0 65 108.5 66 105.0 67 106.5 68 105.0 69 93.0 70 81.0 71 69.0 72 65.5 73 58.5 74 45.0 75 38.5 76 26.0 77 15.0 78 11.5 79 12.5 80 9.0 81 4.5 82 4.0 83 2.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.05 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.7065354529396921 1.4000000000000001 3 0.0757002271006813 0.22499999999999998 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558224 spots for SRR8618236.sra Written 558224 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra Read 558209 spots for SRR8618236.sra Written 558209 spots for SRR8618236.sra SRR ids: ['SRR8618236.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_94pabi_c SRR8618236.sra spots: 11164195 blocks: [[1, 558209], [558210, 1116418], [1116419, 1674627], [1674628, 2232836], [2232837, 2791045], [2791046, 3349254], [3349255, 3907463], [3907464, 4465672], [4465673, 5023881], [5023882, 5582090], [5582091, 6140299], [6140300, 6698508], [6698509, 7256717], [7256718, 7814926], [7814927, 8373135], [8373136, 8931344], [8931345, 9489553], [9489554, 10047762], [10047763, 10605971], [10605972, 11164195]] SRR8618236 file size 2905398 SRR8618236 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618236 SRR8618236_1.fastq SRR8618236_2.fastq Input file: SRR8618236_1.fastq Paired file: SRR8618236_2.fastq trimmed: SRR8618236-trimmed-pair1.fastq, SRR8618236-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:02:57 2024 >> started Sat Dec 7 09:03:07 2024 >> done (10.383s) 11164195 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11164195 (100.00%) read pairs available; of these: 1500822 (13.44%) trimmed read pairs available after processing 9663373 (86.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 77 1 0.00% 78 0 0.00% 79 0 0.00% 80 1 0.00% 81 7 0.00% 82 25 0.00% 83 97 0.00% 84 6709 0.06% 85 7105 0.06% 86 7661 0.07% 87 8417 0.08% 88 9865 0.09% 89 12314 0.11% 90 19462 0.17% 91 35683 0.32% 92 51002 0.46% 93 70213 0.63% 94 94804 0.85% 95 118819 1.06% 96 156070 1.40% 97 211303 1.89% 98 295721 2.65% 99 395543 3.54% 100 9663373 86.56% 11164195 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=25 prefix-density=0.43 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.24 sequence-density-rank=9 fanout-score=8.84 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=3.6 sequence=GGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=30 prefix-density=0.43 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=27 fanout-score=9.31 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=5.1 sequence=GGCGGCAGCTTCGACCCCCTTGGCTTGGCTGACGACCC SRR8618236 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:03:36 Started mapping on | Dec 07 09:03:36 Finished on | Dec 07 09:04:04 Mapping speed, Million of reads per hour | 1435.40 Number of input reads | 11164195 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10916068 Uniquely mapped reads % | 97.78% Average mapped length | 198.25 Number of splices: Total | 6608710 Number of splices: Annotated (sjdb) | 6291194 Number of splices: GT/AG | 6517361 Number of splices: GC/AG | 76552 Number of splices: AT/AC | 1674 Number of splices: Non-canonical | 13123 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 99780 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 8944 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 148347 148347 148347 N_multimapping 99780 99780 99780 N_noFeature 243481 5453268 5505103 N_ambiguous 246482 23058 24100 UnstrandedReadsAssigned:10426105 PositiveStrandReadsAssigned:5439742 NegativeStrandReadsAssigned:5386865 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618236 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618236-trimmed-pair1.fastq SRR8618236-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,164,195 reads, 10,629,288 reads pseudoaligned [quant] estimated average fragment length: 164.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR8618236.ke.tsv 35125 SRR8618236.se.tsv 88098 total ==> SRR8618236.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 772.512 0 0 PNS24247 1044 880.351 15.2673 2.18375 PNS24249 1928 1764.35 33.6913 2.40453 PNS24246 1044 880.351 15.2673 2.18375 PNS24248 1044 880.351 15.2673 2.18375 PNS24244 1471 1307.35 30.5069 2.93835 PNS24243 293 136.681 4 3.68511 KQK14069 1603 1439.35 3101.78 271.357 KQK14071 474 311.86 275.462 111.224 ==> SRR8618236.se.tsv <== BRADI_1g14170v3 3661 BRADI_1g53295v3 151 BRADI_1g59795v3 255 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 183 BRADI_1g74790v3 38 BRADI_1g09890v3 1 BRADI_1g77505v3 151 BRADI_1g48960v3 0 SRR8618236 completed mapping pipeline successfully