Starting /dee2/code/volunteer_pipeline.sh SRR8618237 current disk space = 1544305209344 free memory = 1602372852 SRR8618237 SRAfilesize 1cc214609b2e82e90c2456050966a735 SRR8618237.sra SRR8618237.sra file validated SRR8618237 is paired end SRR8618237 is conventional basespace SRR8618237 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618237_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94525 34.0 31.0 34.0 31.0 34.0 2 33.0975 34.0 31.0 34.0 31.0 34.0 3 33.183 34.0 33.0 34.0 31.0 34.0 4 34.6105 37.0 37.0 37.0 35.0 37.0 5 35.50675 37.0 37.0 37.0 35.0 37.0 6 36.16825 37.0 37.0 37.0 35.0 37.0 7 36.2585 37.0 37.0 37.0 35.0 37.0 8 36.37425 37.0 37.0 37.0 35.0 37.0 9 38.33475 39.0 39.0 39.0 37.0 39.0 10-11 38.338375 39.0 39.0 39.0 37.0 39.0 12-13 38.289874999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.848875 41.0 40.0 41.0 38.0 41.0 16-17 39.846625 41.0 40.0 41.0 38.0 41.0 18-19 39.80875 41.0 40.0 41.0 38.0 41.0 20-21 39.66775 41.0 39.5 41.0 37.0 41.0 22-23 39.59075 41.0 39.0 41.0 37.0 41.0 24-25 39.4285 41.0 39.0 41.0 36.0 41.0 26-27 39.325874999999996 40.0 39.0 41.0 36.0 41.0 28-29 39.211124999999996 40.0 38.5 41.0 36.0 41.0 30-31 38.95075 40.0 38.0 41.0 35.0 41.0 32-33 38.83325 40.0 38.0 41.0 35.0 41.0 34-35 39.124875 40.0 38.0 41.0 35.0 41.0 36-37 39.064 40.0 38.0 41.0 35.0 41.0 38-39 38.91075 40.0 38.0 41.0 35.0 41.0 40-41 38.795874999999995 40.0 38.0 41.0 35.0 41.0 42-43 38.601124999999996 40.0 37.0 41.0 35.0 41.0 44-45 38.36075 40.0 36.5 41.0 34.5 41.0 46-47 38.099500000000006 40.0 35.5 41.0 34.0 41.0 48-49 37.8335 39.0 35.0 41.0 33.5 41.0 50-51 37.57275 39.0 35.0 41.0 33.0 41.0 52-53 37.414249999999996 39.0 35.0 41.0 33.0 41.0 54-55 36.951375 37.5 35.0 40.5 32.5 41.0 56-57 36.634874999999994 37.0 35.0 40.0 32.0 41.0 58-59 36.584 37.0 35.0 40.0 32.5 41.0 60-61 36.3505 36.0 35.0 40.0 32.0 41.0 62-63 36.040499999999994 35.5 35.0 39.5 31.5 41.0 64-65 35.816125 35.0 35.0 39.0 31.5 41.0 66-67 35.454375 35.0 34.0 38.5 31.0 41.0 68-69 35.1455 35.0 34.0 37.5 31.0 40.0 70-71 34.60275 35.0 34.0 37.0 30.0 39.5 72-73 34.503625 35.0 34.0 36.5 30.5 39.0 74-75 34.197625 35.0 33.0 36.0 30.0 38.5 76-77 33.235625 34.5 32.5 35.0 28.0 37.0 78-79 33.794875 35.0 33.0 35.0 29.5 37.0 80-81 33.68775 35.0 33.0 35.0 29.5 36.5 82-83 33.364000000000004 35.0 33.0 35.0 29.0 36.0 84-85 33.29475 35.0 33.0 35.0 29.0 36.0 86-87 33.192499999999995 35.0 33.0 35.0 29.0 35.5 88-89 32.77475 35.0 33.0 35.0 28.0 35.0 90-91 32.561125 35.0 33.0 35.0 27.0 35.0 92-93 32.462375 35.0 33.0 35.0 27.0 35.0 94-95 32.152249999999995 34.5 32.0 35.0 27.0 35.0 96-97 31.855874999999997 34.0 32.0 35.0 27.0 35.0 98-99 31.62025 34.0 32.0 35.0 26.0 35.0 100 31.327 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.04755500909346466 1101 2 0.004277773508540861 1101 3 -0.008350623735239537 1101 4 -1.3292348676964068 1101 5 -0.7087271702656324 1101 6 -0.09530213376367414 1101 7 -0.03338968723583946 1101 8 0.012589974128438541 1101 9 -0.008491508491509592 1101 10-11 0.07106995568533847 1101 12-13 0.05612336381567218 1101 14-15 0.15219395988626871 1101 16-17 0.05644996029611349 1101 18-19 0.09628832705755741 1101 20-21 0.07062168600629803 1101 22-23 0.15518455903070816 1101 24-25 0.09882425267040418 1101 26-27 0.21068674914829444 1101 28-29 0.174421732114034 1101 30-31 0.056827787597015345 1101 32-33 -0.16773611004379774 1101 34-35 -0.03917236609544261 1101 36-37 0.20277158738697665 1101 38-39 0.252260559952866 1101 40-41 0.08120085043162106 1101 42-43 0.12264658418504126 1101 44-45 0.13653013653013346 1101 46-47 -0.0027664643049263304 1101 48-49 0.04943133789287657 1101 50-51 0.2021760290990997 1101 52-53 0.20150362458054616 1101 54-55 0.3249699018929846 1101 56-57 0.45039575808807086 1101 58-59 0.12554112554112606 1101 60-61 0.18937472783626674 1101 62-63 0.13560157790927008 1101 64-65 0.07587284510361059 1101 66-67 0.061739542508775 1101 68-69 -0.04041471349164283 1101 70-71 0.037897999436459884 1101 72-73 0.01599041983656946 1101 74-75 -0.054797766336228904 1101 76-77 -0.21832654524962436 1101 78-79 -0.03963344347960174 1101 80-81 -0.2432503394041845 1101 82-83 -0.06522964215272253 1101 84-85 0.20139475908706572 1101 86-87 0.021151924998079608 1101 88-89 0.4399126514511167 1101 90-91 0.4179346294730877 1101 92-93 0.2617126463280357 1101 94-95 0.19340915494761646 1101 96-97 -0.1003931965470457 1101 98-99 0.35618868311176044 1101 100 0.0026383872537714126 1103 1 -0.04755500909347177 1103 2 -0.004277773508540861 1103 3 0.008350623735239537 1103 4 1.3292348676964068 1103 5 0.7087271702656324 1103 6 0.09530213376367414 1103 7 0.03338968723583946 1103 8 -0.012589974128431436 1103 9 0.008491508491509592 1103 10-11 -0.07106995568533847 1103 12-13 -0.05612336381567218 1103 14-15 -0.15219395988626871 1103 16-17 -0.05644996029611349 1103 18-19 -0.09628832705755741 1103 20-21 -0.07062168600630514 1103 22-23 -0.15518455903071526 1103 24-25 -0.09882425267040418 1103 26-27 -0.21068674914828733 1103 28-29 -0.1744217321140411 1103 30-31 -0.05682778759702245 1103 32-33 0.16773611004380484 1103 34-35 0.03917236609544261 1103 36-37 -0.20277158738696954 1103 38-39 -0.252260559952866 1103 40-41 -0.08120085043162106 1103 42-43 -0.12264658418504126 1103 44-45 -0.13653013653013346 1103 46-47 0.0027664643049263304 1103 48-49 -0.049431337892869465 1103 50-51 -0.2021760290991068 1103 52-53 -0.20150362458055326 1103 54-55 -0.3249699018929775 1103 56-57 -0.45039575808806376 1103 58-59 -0.12554112554112606 1103 60-61 -0.18937472783626674 1103 62-63 -0.13560157790927008 1103 64-65 -0.07587284510361059 1103 66-67 -0.061739542508775 1103 68-69 0.04041471349163572 1103 70-71 -0.037897999436459884 1103 72-73 -0.015990419836576564 1103 74-75 0.054797766336228904 1103 76-77 0.21832654524962436 1103 78-79 0.03963344347959463 1103 80-81 0.2432503394041845 1103 82-83 0.06522964215272253 1103 84-85 -0.20139475908706572 1103 86-87 -0.021151924998079608 1103 88-89 -0.4399126514511096 1103 90-91 -0.4179346294730877 1103 92-93 -0.2617126463280286 1103 94-95 -0.19340915494761646 1103 96-97 0.1003931965470457 1103 98-99 -0.356188683111764 1103 100 -0.0026383872537714126 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 7.0 28 33.0 29 45.0 30 68.0 31 97.0 32 140.0 33 203.0 34 281.0 35 479.0 36 737.0 37 925.0 38 859.0 39 124.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.974999999999998 9.9 14.899999999999999 48.225 2 27.025 17.75 29.45 25.775 3 27.125 22.25 23.549999999999997 27.075 4 29.72972972972973 26.20561738208797 17.011128775834656 27.05352411234764 5 29.675 29.4 19.1 21.825 6 22.630657664416105 33.30832708177044 19.42985746436609 24.63115778944736 7 20.8 13.625000000000002 38.875 26.700000000000003 8 23.35 18.55 24.15 33.95 9 23.45 18.025 28.475 30.049999999999997 10-11 27.700000000000003 26.7125 19.0125 26.575 12-13 25.5125 21.1875 25.1875 28.1125 14-15 26.237500000000004 23.0125 23.1625 27.5875 16-17 27.150000000000002 23.9375 22.6 26.3125 18-19 26.887499999999996 24.175 22.525000000000002 26.4125 20-21 26.1 23.7875 23.7625 26.35 22-23 26.200000000000003 23.3375 23.599999999999998 26.8625 24-25 26.437500000000004 23.3 22.7125 27.55 26-27 27.187499999999996 23.6625 22.900000000000002 26.25 28-29 26.400000000000002 23.849999999999998 21.5625 28.1875 30-31 26.075 24.275 22.6125 27.037499999999998 32-33 25.9625 22.9375 23.5125 27.5875 34-35 26.400000000000002 23.6625 23.375 26.5625 36-37 25.7625 22.7375 23.8875 27.6125 38-39 26.924999999999997 22.3875 22.7125 27.975 40-41 26.4625 23.875 22.7375 26.924999999999997 42-43 25.55 23.8875 22.662499999999998 27.900000000000002 44-45 26.7125 23.65 22.95 26.687499999999996 46-47 27.375 23.025000000000002 22.7125 26.887499999999996 48-49 26.1125 22.45 23.2375 28.199999999999996 50-51 26.2875 24.1875 21.837500000000002 27.6875 52-53 27.775 22.6875 22.925 26.6125 54-55 26.3625 23.45 22.875 27.3125 56-57 27.3625 23.2875 22.7 26.650000000000002 58-59 27.287499999999998 23.3625 22.125 27.224999999999998 60-61 25.874999999999996 23.4875 23.0625 27.575 62-63 26.787499999999998 23.0375 23.425 26.75 64-65 27.425 23.0 22.3375 27.237499999999997 66-67 26.187500000000004 23.625 23.65 26.5375 68-69 27.224999999999998 22.650000000000002 23.0875 27.037499999999998 70-71 26.700000000000003 23.2375 22.525000000000002 27.537499999999998 72-73 26.887499999999996 23.1125 23.0875 26.9125 74-75 27.1375 23.2375 22.725 26.900000000000002 76-77 26.0375 23.4125 23.0375 27.5125 78-79 26.137500000000003 22.75 24.337500000000002 26.775 80-81 27.212500000000002 24.375 21.712500000000002 26.700000000000003 82-83 27.237499999999997 24.075 22.5 26.187500000000004 84-85 26.937499999999996 22.425 23.3 27.3375 86-87 27.0 22.45 23.325000000000003 27.224999999999998 88-89 27.500000000000004 23.425 22.625 26.450000000000003 90-91 27.05 22.9875 23.375 26.5875 92-93 27.474999999999998 23.225 23.3125 25.9875 94-95 28.4 23.3875 22.3625 25.85 96-97 26.5 23.175 23.225 27.1 98-99 27.55 23.6875 21.95 26.8125 100 28.525 22.275 22.7 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.0 26 2.0 27 3.5 28 1.5 29 2.0 30 3.0 31 3.5 32 8.5 33 10.5 34 13.5 35 26.0 36 36.5 37 37.5 38 46.0 39 63.0 40 89.5 41 111.5 42 122.0 43 138.0 44 144.0 45 130.0 46 135.5 47 154.5 48 150.5 49 130.5 50 113.0 51 106.5 52 110.5 53 104.0 54 92.0 55 95.5 56 97.5 57 94.0 58 100.0 59 115.0 60 122.5 61 122.0 62 119.0 63 114.0 64 108.5 65 98.5 66 90.5 67 90.5 68 86.5 69 80.0 70 66.5 71 58.5 72 52.5 73 46.5 74 40.0 75 31.0 76 25.0 77 19.0 78 14.5 79 8.5 80 5.0 81 3.5 82 2.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 5.65 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618237 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618237_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.86225 33.0 31.0 34.0 30.0 34.0 2 32.6695 34.0 31.0 34.0 31.0 34.0 3 32.9395 34.0 31.0 34.0 31.0 34.0 4 36.4085 37.0 37.0 37.0 35.0 37.0 5 36.43275 37.0 37.0 37.0 35.0 37.0 6 36.48925 37.0 37.0 37.0 35.0 37.0 7 36.4695 37.0 37.0 37.0 35.0 37.0 8 36.4945 37.0 37.0 37.0 35.0 37.0 9 38.32225 39.0 39.0 39.0 37.0 39.0 10-11 38.2885 39.0 39.0 39.0 37.0 39.0 12-13 38.230125 39.0 39.0 39.0 37.0 39.0 14-15 39.78425 41.0 40.0 41.0 37.0 41.0 16-17 39.731875 41.0 40.0 41.0 37.0 41.0 18-19 39.733125 41.0 40.0 41.0 37.5 41.0 20-21 39.69375 41.0 40.0 41.0 37.0 41.0 22-23 39.6095 41.0 39.0 41.0 37.0 41.0 24-25 39.555875 41.0 39.0 41.0 37.0 41.0 26-27 39.45325 41.0 39.0 41.0 36.0 41.0 28-29 39.34475 40.5 39.0 41.0 36.0 41.0 30-31 39.069874999999996 40.0 38.0 41.0 35.0 41.0 32-33 39.080375000000004 40.0 38.0 41.0 35.0 41.0 34-35 39.00625 40.0 38.0 41.0 35.0 41.0 36-37 38.731625 40.0 38.0 41.0 35.0 41.0 38-39 38.543875 40.0 37.5 41.0 34.0 41.0 40-41 38.310500000000005 40.0 37.0 41.0 34.0 41.0 42-43 38.039125 40.0 36.0 41.0 33.0 41.0 44-45 37.789500000000004 39.5 35.5 41.0 33.0 41.0 46-47 37.39675 39.0 35.0 41.0 33.0 41.0 48-49 37.3615 39.0 35.0 41.0 33.0 41.0 50-51 36.846500000000006 38.0 34.5 40.0 32.0 40.5 52-53 36.813375 38.0 35.0 40.0 32.5 41.0 54-55 36.9755 37.5 35.0 41.0 33.0 41.0 56-57 36.807 37.0 35.0 40.5 33.0 41.0 58-59 36.693625 37.0 35.0 40.0 33.0 41.0 60-61 36.430625 36.0 35.0 40.0 33.0 41.0 62-63 36.08925 35.0 35.0 39.5 32.0 41.0 64-65 35.803125 35.0 35.0 39.0 31.5 41.0 66-67 35.627125 35.0 35.0 39.0 31.5 41.0 68-69 35.285875 35.0 34.0 37.5 31.5 40.0 70-71 34.982749999999996 35.0 34.0 37.0 31.0 39.5 72-73 34.769625 35.0 34.0 36.5 31.0 39.0 74-75 34.52375 35.0 34.0 36.0 31.0 39.0 76-77 34.325 35.0 34.0 36.0 30.5 37.5 78-79 34.060125 35.0 34.0 35.0 30.5 37.0 80-81 33.750875 35.0 33.0 35.0 29.5 37.0 82-83 33.525625 35.0 33.0 35.0 29.0 36.0 84-85 33.259125 35.0 33.0 35.0 29.0 36.0 86-87 33.088 35.0 33.0 35.0 29.0 35.5 88-89 32.831875 35.0 33.0 35.0 29.0 35.0 90-91 32.654375 35.0 33.0 35.0 28.0 35.0 92-93 32.310874999999996 35.0 32.5 35.0 27.0 35.0 94-95 32.023 34.5 32.0 35.0 26.5 35.0 96-97 31.743625 34.0 32.0 35.0 25.0 35.0 98-99 31.358625 34.0 31.5 35.0 25.0 35.0 100 31.0695 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.7635313404544206 1101 2 0.24560055329286 1101 3 0.05238351392198126 1101 4 0.10530495145879826 1101 5 0.10061733138656592 1101 6 0.010784087707165213 1101 7 0.09636517328824823 1101 8 0.08546581623505034 1101 9 0.20105535490151283 1101 10-11 0.18373293373293365 1101 12-13 0.12199339122415864 1101 14-15 0.15729142652219963 1101 16-17 0.14722457030149627 1101 18-19 0.1092689361920165 1101 20-21 0.17918619841696426 1101 22-23 0.21771817925664294 1101 24-25 0.2010361433438348 1101 26-27 0.14896641819719036 1101 28-29 0.0733049002279813 1101 30-31 0.23831296908220168 1101 32-33 0.14652655037270534 1101 34-35 0.22936038320654006 1101 36-37 0.2588437203821812 1101 38-39 0.22380824303901647 1101 40-41 0.03495863111248099 1101 42-43 0.16727503265964572 1101 44-45 0.23937600860678288 1101 46-47 0.1982888905965865 1101 48-49 0.14669305053920567 1101 50-51 0.27662081508235303 1101 52-53 0.045454545454546746 1101 54-55 0.31327006327006046 1101 56-57 0.2998475883091203 1101 58-59 0.21249903942212 1101 60-61 0.21250544327467225 1101 62-63 -0.002772868157485675 1101 64-65 0.19663029278413546 1101 66-67 0.15448653910192434 1101 68-69 0.17559363713209564 1101 70-71 0.1855580317118779 1101 72-73 0.00831860447244992 1101 74-75 0.17092522861753423 1101 76-77 -0.024545966853658285 1101 78-79 -0.062450370142677514 1101 80-81 0.03622659391890437 1101 82-83 0.07171034094110951 1101 84-85 -0.06765670227208886 1101 86-87 -0.17816798586029847 1101 88-89 -0.13836163836163706 1101 90-91 -0.08814903045672651 1101 92-93 -0.36706882860729095 1101 94-95 -0.5368349599118787 1101 96-97 -0.2903698865237345 1101 98-99 0.08062450370142571 1101 100 -0.01731601731601984 1103 1 -0.7635313404544171 1103 2 -0.24560055329286 1103 3 -0.052383513921974156 1103 4 -0.10530495145879826 1103 5 -0.10061733138655882 1103 6 -0.010784087707165213 1103 7 -0.09636517328824823 1103 8 -0.08546581623504323 1103 9 -0.20105535490150572 1103 10-11 -0.18373293373293365 1103 12-13 -0.12199339122416575 1103 14-15 -0.15729142652219963 1103 16-17 -0.14722457030148917 1103 18-19 -0.10926893619200939 1103 20-21 -0.17918619841697137 1103 22-23 -0.21771817925664294 1103 24-25 -0.2010361433438348 1103 26-27 -0.14896641819719036 1103 28-29 -0.0733049002279742 1103 30-31 -0.23831296908220168 1103 32-33 -0.14652655037269824 1103 34-35 -0.22936038320653296 1103 36-37 -0.2588437203821812 1103 38-39 -0.22380824303900937 1103 40-41 -0.03495863111247388 1103 42-43 -0.16727503265965282 1103 44-45 -0.23937600860677577 1103 46-47 -0.1982888905965794 1103 48-49 -0.14669305053919857 1103 50-51 -0.27662081508235303 1103 52-53 -0.045454545454546746 1103 54-55 -0.31327006327006046 1103 56-57 -0.2998475883091274 1103 58-59 -0.2124990394221129 1103 60-61 -0.21250544327467225 1103 62-63 0.0027728681574785696 1103 64-65 -0.19663029278413546 1103 66-67 -0.15448653910192434 1103 68-69 -0.17559363713210274 1103 70-71 -0.1855580317118779 1103 72-73 -0.00831860447244992 1103 74-75 -0.17092522861754134 1103 76-77 0.024545966853658285 1103 78-79 0.062450370142677514 1103 80-81 -0.03622659391890437 1103 82-83 -0.07171034094110951 1103 84-85 0.06765670227208886 1103 86-87 0.17816798586029137 1103 88-89 0.13836163836163706 1103 90-91 0.08814903045672651 1103 92-93 0.3670688286072874 1103 94-95 0.5368349599118858 1103 96-97 0.29036988652373097 1103 98-99 -0.08062450370142571 1103 100 0.017316017316016286 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 4.0 27 13.0 28 31.0 29 52.0 30 67.0 31 102.0 32 154.0 33 181.0 34 287.0 35 463.0 36 781.0 37 869.0 38 856.0 39 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.725 7.375 14.725 50.175000000000004 2 28.175 18.0 28.675 25.15 3 27.500000000000004 21.75 22.1 28.65 4 29.299999999999997 27.525 15.8 27.375 5 30.625000000000004 29.45 18.275 21.65 6 23.45 32.1 20.200000000000003 24.25 7 20.5 13.900000000000002 38.2 27.400000000000002 8 23.275000000000002 19.400000000000002 22.650000000000002 34.675 9 24.125 19.475 26.974999999999998 29.425 10-11 27.660372639739904 27.335250719019633 17.931724396648743 27.072652244591723 12-13 25.624999999999996 21.9625 24.575 27.8375 14-15 25.624999999999996 22.45 24.25 27.675 16-17 25.75 22.1875 22.5875 29.475 18-19 25.900000000000002 23.7125 23.275000000000002 27.1125 20-21 26.85 22.4625 23.4375 27.250000000000004 22-23 26.7125 22.55 23.0375 27.700000000000003 24-25 25.5375 23.125 23.1 28.237499999999997 26-27 26.887499999999996 24.2625 22.95 25.900000000000002 28-29 27.8875 23.200000000000003 22.375 26.5375 30-31 26.075 23.3125 22.8625 27.750000000000004 32-33 26.0 24.375 23.0875 26.5375 34-35 26.4125 22.8 22.9625 27.825 36-37 27.3625 23.075000000000003 22.45 27.1125 38-39 26.650000000000002 23.5375 22.537499999999998 27.275 40-41 26.0375 23.1125 23.0375 27.8125 42-43 26.700000000000003 22.6 23.4375 27.2625 44-45 27.025 23.9 22.3375 26.737499999999997 46-47 27.0 22.2125 22.4375 28.349999999999998 48-49 26.2625 23.2125 23.3625 27.1625 50-51 26.35 23.5625 23.200000000000003 26.887499999999996 52-53 26.8 22.575 22.775000000000002 27.85 54-55 25.9875 23.3625 21.9625 28.6875 56-57 27.237499999999997 22.900000000000002 22.9875 26.875 58-59 27.375 21.475 22.787499999999998 28.3625 60-61 26.4125 23.9375 22.2125 27.437499999999996 62-63 26.6125 23.7375 23.025000000000002 26.625 64-65 26.8 23.175 22.7125 27.3125 66-67 26.387500000000003 22.95 23.7125 26.950000000000003 68-69 27.6375 22.0875 23.3375 26.937499999999996 70-71 26.437500000000004 22.8375 23.175 27.55 72-73 26.450000000000003 23.5625 23.45 26.5375 74-75 26.8375 23.425 22.925 26.8125 76-77 26.700000000000003 22.900000000000002 23.2125 27.187499999999996 78-79 26.775 23.3125 23.225 26.687499999999996 80-81 27.6125 22.3625 23.4375 26.5875 82-83 27.05 22.8625 22.787499999999998 27.3 84-85 26.1625 23.549999999999997 23.7625 26.525 86-87 26.674999999999997 23.5 22.5 27.325 88-89 27.474999999999998 22.375 22.825 27.325 90-91 25.662499999999998 24.2375 23.75 26.35 92-93 26.474999999999998 22.75 23.6875 27.0875 94-95 27.900000000000002 22.6875 22.9375 26.474999999999998 96-97 27.125 23.0 23.400000000000002 26.474999999999998 98-99 26.950000000000003 22.6 23.6375 26.8125 100 28.025 22.425 22.025 27.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 1.0 29 2.0 30 4.5 31 5.0 32 6.0 33 11.5 34 14.0 35 17.5 36 30.0 37 44.0 38 53.0 39 70.0 40 94.5 41 102.5 42 114.0 43 132.5 44 143.0 45 135.5 46 145.5 47 156.5 48 142.0 49 129.5 50 117.5 51 108.5 52 95.0 53 94.0 54 96.5 55 102.0 56 95.5 57 96.5 58 105.0 59 115.0 60 124.5 61 114.5 62 106.5 63 107.5 64 103.0 65 98.5 66 97.5 67 86.0 68 77.5 69 85.5 70 79.0 71 61.5 72 62.0 73 49.0 74 37.0 75 33.0 76 24.0 77 18.5 78 18.0 79 14.0 80 8.0 81 4.5 82 3.0 83 3.0 84 1.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0375 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7060010085728694 1.4000000000000001 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560249 spots for SRR8618237.sra Written 560249 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra Read 560243 spots for SRR8618237.sra Written 560243 spots for SRR8618237.sra SRR ids: ['SRR8618237.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c1ukidwa SRR8618237.sra spots: 11204866 blocks: [[1, 560243], [560244, 1120486], [1120487, 1680729], [1680730, 2240972], [2240973, 2801215], [2801216, 3361458], [3361459, 3921701], [3921702, 4481944], [4481945, 5042187], [5042188, 5602430], [5602431, 6162673], [6162674, 6722916], [6722917, 7283159], [7283160, 7843402], [7843403, 8403645], [8403646, 8963888], [8963889, 9524131], [9524132, 10084374], [10084375, 10644617], [10644618, 11204866]] SRR8618237 file size 2916031 SRR8618237 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618237 SRR8618237_1.fastq SRR8618237_2.fastq Input file: SRR8618237_1.fastq Paired file: SRR8618237_2.fastq trimmed: SRR8618237-trimmed-pair1.fastq, SRR8618237-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:04:09 2024 >> started Sat Dec 7 09:04:21 2024 >> done (11.931s) 11204866 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11204866 (100.00%) read pairs available; of these: 1402081 (12.51%) trimmed read pairs available after processing 9802785 (87.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 13 0.00% 82 26 0.00% 83 111 0.00% 84 4457 0.04% 85 4500 0.04% 86 5111 0.05% 87 5689 0.05% 88 7076 0.06% 89 9019 0.08% 90 15496 0.14% 91 29938 0.27% 92 44231 0.39% 93 61828 0.55% 94 84501 0.75% 95 110108 0.98% 96 146177 1.30% 97 202701 1.81% 98 287105 2.56% 99 383993 3.43% 100 9802785 87.49% 11204866 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=17 prefix-density=0.39 prefix-fanout=2.7 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=30 fanout-score=41.90 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=9.4 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=20 prefix-density=0.39 prefix-fanout=2.6 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=34 fanout-score=41.50 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.4 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618237 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:04:54 Started mapping on | Dec 07 09:05:01 Finished on | Dec 07 09:05:38 Mapping speed, Million of reads per hour | 1090.20 Number of input reads | 11204866 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10939244 Uniquely mapped reads % | 97.63% Average mapped length | 198.23 Number of splices: Total | 6816758 Number of splices: Annotated (sjdb) | 6484323 Number of splices: GT/AG | 6717594 Number of splices: GC/AG | 79894 Number of splices: AT/AC | 2247 Number of splices: Non-canonical | 17023 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 110442 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 6776 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 155180 155180 155180 N_multimapping 110442 110442 110442 N_noFeature 271527 5467721 5523871 N_ambiguous 258432 20094 20583 UnstrandedReadsAssigned:10409285 PositiveStrandReadsAssigned:5451429 NegativeStrandReadsAssigned:5394790 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618237 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618237-trimmed-pair1.fastq SRR8618237-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,204,866 reads, 10,634,086 reads pseudoaligned [quant] estimated average fragment length: 166.534 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52973 SRR8618237.ke.tsv 35125 SRR8618237.se.tsv 88098 total ==> SRR8618237.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.514 0 0 PNS24247 1044 878.466 17.3874 2.56227 PNS24249 1928 1762.47 60.423 4.43809 PNS24246 1044 878.466 17.3874 2.56227 PNS24248 1044 878.466 17.3874 2.56227 PNS24244 1471 1305.47 24.4147 2.42103 PNS24243 293 134.788 0 0 KQK14069 1603 1437.47 4724.38 425.463 KQK14071 474 309.797 451.403 188.626 ==> SRR8618237.se.tsv <== BRADI_1g14170v3 5563 BRADI_1g53295v3 201 BRADI_1g59795v3 228 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 290 BRADI_1g74790v3 24 BRADI_1g09890v3 1 BRADI_1g77505v3 143 BRADI_1g48960v3 0 SRR8618237 completed mapping pipeline successfully