Starting /dee2/code/volunteer_pipeline.sh SRR8618238 current disk space = 1544261967872 free memory = 1598497216 SRR8618238 SRAfilesize 11d78b6cd4cdef4873a605e1acd76404 SRR8618238.sra SRR8618238.sra file validated SRR8618238 is paired end SRR8618238 is conventional basespace SRR8618238 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618238_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.888 34.0 31.0 34.0 31.0 34.0 2 33.07825 34.0 31.0 34.0 31.0 34.0 3 33.232 34.0 33.0 34.0 31.0 34.0 4 32.23475 37.0 37.0 37.0 2.0 37.0 5 34.32125 37.0 35.0 37.0 19.0 37.0 6 35.85625 37.0 35.0 37.0 32.0 37.0 7 36.24025 37.0 35.0 37.0 35.0 37.0 8 36.3945 37.0 37.0 37.0 35.0 37.0 9 38.39325 39.0 39.0 39.0 37.0 39.0 10-11 38.387 39.0 39.0 39.0 37.0 39.0 12-13 38.383875 39.0 39.0 39.0 37.0 39.0 14-15 39.923 41.0 40.0 41.0 38.0 41.0 16-17 39.8225 41.0 40.0 41.0 38.0 41.0 18-19 39.830124999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.762875 41.0 40.0 41.0 37.5 41.0 22-23 39.6525 41.0 39.0 41.0 37.0 41.0 24-25 39.519625000000005 41.0 39.0 41.0 37.0 41.0 26-27 39.38175 40.0 39.0 41.0 36.0 41.0 28-29 39.168125 40.0 38.5 41.0 36.0 41.0 30-31 38.8855 40.0 38.0 41.0 35.0 41.0 32-33 38.867999999999995 40.0 38.0 41.0 35.0 41.0 34-35 39.148250000000004 40.0 38.5 41.0 35.0 41.0 36-37 39.175124999999994 40.0 38.0 41.0 35.0 41.0 38-39 39.020625 40.0 38.0 41.0 35.0 41.0 40-41 38.896375 40.0 38.0 41.0 35.0 41.0 42-43 38.757999999999996 40.0 37.5 41.0 35.0 41.0 44-45 38.54475 40.0 37.0 41.0 35.0 41.0 46-47 38.290125 40.0 36.5 41.0 34.0 41.0 48-49 38.039 40.0 35.5 41.0 34.0 41.0 50-51 37.756125 39.0 35.0 41.0 33.5 41.0 52-53 37.534625 39.0 35.0 41.0 33.0 41.0 54-55 37.3465 38.5 35.0 41.0 33.0 41.0 56-57 37.03475 38.0 35.0 40.5 33.0 41.0 58-59 36.656875 37.0 35.0 40.0 32.5 41.0 60-61 36.434875 36.5 35.0 40.0 32.5 41.0 62-63 36.09725 36.0 35.0 39.5 31.5 41.0 64-65 35.731375 35.0 34.0 39.0 31.0 41.0 66-67 35.504374999999996 35.0 34.0 39.0 31.0 41.0 68-69 35.24975 35.0 34.0 37.5 31.0 40.0 70-71 34.7845 35.0 34.0 37.0 30.5 39.5 72-73 34.385999999999996 35.0 33.5 36.5 30.0 39.0 74-75 34.176500000000004 35.0 33.0 36.0 29.5 39.0 76-77 33.206 34.5 32.5 35.0 28.0 37.0 78-79 33.7345 35.0 33.0 35.0 29.5 37.0 80-81 33.594750000000005 35.0 33.0 35.0 29.0 37.0 82-83 33.471625 35.0 33.0 35.0 29.0 36.0 84-85 33.29975 35.0 33.0 35.0 29.0 36.0 86-87 33.122749999999996 35.0 33.0 35.0 29.0 36.0 88-89 32.877375 35.0 33.0 35.0 29.0 35.0 90-91 32.53375 35.0 33.0 35.0 27.0 35.0 92-93 32.271125 34.5 32.5 35.0 27.0 35.0 94-95 32.090875 34.5 32.0 35.0 27.0 35.0 96-97 31.758875 34.5 32.0 35.0 25.5 35.0 98-99 31.337 34.0 32.0 35.0 24.5 35.0 100 30.83175 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.19944431929113193 1101 2 0.24078245851167424 1101 3 0.10298866110986182 1101 4 -3.4844684738805007 1101 5 -1.7551750894846165 1101 6 -0.4833170634026729 1101 7 -0.21313609171235015 1101 8 -0.12138619809266515 1101 9 0.02242747365522746 1101 10-11 0.02587544742308978 1101 12-13 -0.033847713448977856 1101 14-15 0.015932016720483944 1101 16-17 -0.03636329503641633 1101 18-19 0.11434632424720093 1101 20-21 0.20165953292783456 1101 22-23 0.22647743485770633 1101 24-25 0.0988961477810264 1101 26-27 0.13021576431128068 1101 28-29 0.11404595629645797 1101 30-31 -0.1054979850316613 1101 32-33 -0.15578458611799562 1101 34-35 0.04160096117744416 1101 36-37 0.10126780305874661 1101 38-39 0.0019523916798078744 1101 40-41 0.22936847638356994 1101 42-43 0.055787089184249794 1101 44-45 0.11224374859202868 1101 46-47 0.02855372831719194 1101 48-49 -0.02979900377962963 1101 50-51 -0.14654201396710675 1101 52-53 0.02492428224574894 1101 54-55 5.444169107136076E-4 1101 56-57 -0.04905384095517462 1101 58-59 -0.04167605316512635 1101 60-61 0.008047358013563155 1101 62-63 -0.1558409051087537 1101 64-65 -0.07885910240043614 1101 66-67 -0.15153563114815682 1101 68-69 -0.02182673775374866 1101 70-71 -0.07159395259191825 1101 72-73 -0.06842757377788189 1101 74-75 -0.1895321769167282 1101 76-77 -0.20699732171910767 1101 78-79 -0.20415008385271705 1101 80-81 -0.18752972391179412 1101 82-83 -0.06156917223599123 1101 84-85 -0.16079697629596268 1101 86-87 0.19403143851217663 1101 88-89 0.02821581437260079 1101 90-91 -0.07970388726189981 1101 92-93 -0.45836775049435374 1101 94-95 -0.18509549197766972 1101 96-97 -0.2005268954469237 1101 98-99 -0.017289930164452016 1101 100 0.1339891366924455 1103 1 -0.19944431929113193 1103 2 -0.24078245851167424 1103 3 -0.10298866110986182 1103 4 3.4844684738805043 1103 5 1.7551750894846236 1103 6 0.4833170634026658 1103 7 0.21313609171235015 1103 8 0.12138619809266515 1103 9 -0.02242747365522746 1103 10-11 -0.025875447423096887 1103 12-13 0.033847713448977856 1103 14-15 -0.015932016720476838 1103 16-17 0.03636329503641633 1103 18-19 -0.11434632424720093 1103 20-21 -0.20165953292783456 1103 22-23 -0.22647743485769922 1103 24-25 -0.0988961477810335 1103 26-27 -0.13021576431128778 1103 28-29 -0.11404595629646508 1103 30-31 0.1054979850316613 1103 32-33 0.15578458611799562 1103 34-35 -0.04160096117744416 1103 36-37 -0.10126780305874661 1103 38-39 -0.0019523916798078744 1103 40-41 -0.22936847638356994 1103 42-43 -0.055787089184249794 1103 44-45 -0.11224374859202157 1103 46-47 -0.02855372831719194 1103 48-49 0.029799003779636735 1103 50-51 0.14654201396711386 1103 52-53 -0.02492428224574894 1103 54-55 -5.444169107207131E-4 1103 56-57 0.049053840955167516 1103 58-59 0.04167605316512635 1103 60-61 -0.008047358013563155 1103 62-63 0.1558409051087608 1103 64-65 0.07885910240044325 1103 66-67 0.15153563114815682 1103 68-69 0.02182673775374866 1103 70-71 0.07159395259192536 1103 72-73 0.06842757377788189 1103 74-75 0.18953217691672108 1103 76-77 0.20699732171910767 1103 78-79 0.20415008385271705 1103 80-81 0.18752972391179412 1103 82-83 0.06156917223599123 1103 84-85 0.16079697629596268 1103 86-87 -0.19403143851218374 1103 88-89 -0.028215814372607895 1103 90-91 0.0797038872618927 1103 92-93 0.45836775049435374 1103 94-95 0.18509549197766972 1103 96-97 0.20052689544692015 1103 98-99 0.017289930164448464 1103 100 -0.13398913669244905 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 3.0 28 34.0 29 51.0 30 88.0 31 83.0 32 147.0 33 193.0 34 307.0 35 437.0 36 688.0 37 973.0 38 853.0 39 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.449999999999996 11.1 13.575000000000001 46.875 2 26.575 17.549999999999997 30.825000000000003 25.05 3 27.3 22.775000000000002 22.55 27.375 4 28.506010303377217 27.59015455065827 17.458500286204924 26.44533485975959 5 29.549999999999997 29.775000000000002 20.625 20.05 6 22.5 33.975 20.150000000000002 23.375 7 20.9 13.750000000000002 38.425 26.924999999999997 8 22.175 20.1 24.175 33.550000000000004 9 22.45 19.475 26.974999999999998 31.1 10-11 27.6375 28.375 17.837500000000002 26.150000000000002 12-13 25.1 20.837500000000002 25.637500000000003 28.425 14-15 25.937500000000004 22.650000000000002 25.1 26.3125 16-17 26.275 22.8125 23.175 27.737499999999997 18-19 25.674999999999997 23.325000000000003 24.175 26.825 20-21 26.1 23.549999999999997 24.0375 26.3125 22-23 26.3 24.0 22.8625 26.8375 24-25 25.775 23.3 23.9 27.025 26-27 25.474999999999998 24.15 23.3125 27.0625 28-29 27.450000000000003 23.4625 22.05 27.037499999999998 30-31 25.387500000000003 23.45 23.9375 27.224999999999998 32-33 25.474999999999998 23.4625 23.125 27.9375 34-35 26.625 23.962500000000002 23.4125 26.0 36-37 25.724999999999998 23.4125 23.5 27.3625 38-39 25.75 23.9875 23.200000000000003 27.0625 40-41 26.187500000000004 23.2625 23.3625 27.187499999999996 42-43 26.625 23.200000000000003 23.8125 26.3625 44-45 26.724999999999998 23.325000000000003 23.0375 26.9125 46-47 26.85 23.3875 23.3875 26.375 48-49 26.174999999999997 22.5875 23.7625 27.474999999999998 50-51 26.0625 23.1125 23.799999999999997 27.025 52-53 26.3125 23.65 22.325 27.712500000000002 54-55 25.55 23.125 24.0125 27.3125 56-57 27.2625 23.875 22.8625 26.0 58-59 27.150000000000002 23.962500000000002 22.0875 26.8 60-61 26.5875 23.95 22.2625 27.200000000000003 62-63 26.4625 23.8625 23.65 26.025 64-65 26.674999999999997 24.637500000000003 22.162499999999998 26.525 66-67 26.8625 23.1625 23.1 26.875 68-69 26.224999999999998 22.787499999999998 23.7375 27.250000000000004 70-71 27.487499999999997 23.0375 22.900000000000002 26.575 72-73 26.474999999999998 23.3 23.2125 27.0125 74-75 26.950000000000003 23.5625 23.0125 26.474999999999998 76-77 25.95 23.8375 23.1 27.1125 78-79 26.650000000000002 23.7 22.8125 26.8375 80-81 26.687499999999996 23.775 23.7875 25.75 82-83 26.687499999999996 23.0625 23.525 26.724999999999998 84-85 26.224999999999998 22.825 23.4625 27.487499999999997 86-87 26.75 23.400000000000002 23.2625 26.5875 88-89 26.937499999999996 23.0625 24.1625 25.837500000000002 90-91 26.224999999999998 23.4125 23.875 26.487500000000004 92-93 25.828228528566072 23.22790348793599 24.415551943992998 26.52831603950494 94-95 26.737499999999997 24.45 23.200000000000003 25.6125 96-97 26.4625 22.4875 24.0375 27.0125 98-99 27.425 23.7875 22.8375 25.95 100 27.375 23.175 22.55 26.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.0 28 4.0 29 6.0 30 7.0 31 7.5 32 9.0 33 12.0 34 18.0 35 28.0 36 34.5 37 38.0 38 55.0 39 79.5 40 91.5 41 110.0 42 125.5 43 132.5 44 142.5 45 142.0 46 147.5 47 148.0 48 133.0 49 137.5 50 133.0 51 126.5 52 122.5 53 116.0 54 113.5 55 106.0 56 104.5 57 101.0 58 102.5 59 105.0 60 105.0 61 97.5 62 89.0 63 93.0 64 101.0 65 100.5 66 91.5 67 82.0 68 76.5 69 67.5 70 60.0 71 50.5 72 46.0 73 44.0 74 32.5 75 30.0 76 30.0 77 21.5 78 14.0 79 11.0 80 6.5 81 3.5 82 2.0 83 1.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 12.65 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0125 0.0 0.0 0.0 0.025 86-87 0.07500000000000001 0.0 0.0 0.0 0.025 88 0.125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618238 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618238_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.249 34.0 31.0 34.0 31.0 34.0 2 32.90675 34.0 31.0 34.0 31.0 34.0 3 33.0805 34.0 33.0 34.0 31.0 34.0 4 36.4795 37.0 37.0 37.0 35.0 37.0 5 36.5095 37.0 37.0 37.0 35.0 37.0 6 36.53825 37.0 37.0 37.0 35.0 37.0 7 36.49175 37.0 37.0 37.0 35.0 37.0 8 36.5315 37.0 37.0 37.0 35.0 37.0 9 38.32225 39.0 39.0 39.0 37.0 39.0 10-11 38.36150000000001 39.0 39.0 39.0 37.0 39.0 12-13 38.304249999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.934375 41.0 40.0 41.0 38.0 41.0 16-17 39.805125000000004 41.0 40.0 41.0 38.0 41.0 18-19 39.849500000000006 41.0 40.0 41.0 38.0 41.0 20-21 39.798625 41.0 40.0 41.0 37.5 41.0 22-23 39.754625000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.683499999999995 41.0 39.5 41.0 37.0 41.0 26-27 39.559375 41.0 39.0 41.0 37.0 41.0 28-29 39.474625 41.0 39.0 41.0 37.0 41.0 30-31 39.257125 40.0 39.0 41.0 36.0 41.0 32-33 39.275375 40.0 39.0 41.0 35.5 41.0 34-35 39.156375 40.0 38.5 41.0 35.0 41.0 36-37 38.947125 40.0 38.0 41.0 35.0 41.0 38-39 38.741749999999996 40.0 38.0 41.0 35.0 41.0 40-41 38.470875 40.0 37.0 41.0 34.0 41.0 42-43 38.2265 40.0 37.0 41.0 34.0 41.0 44-45 37.92275 40.0 36.0 41.0 33.0 41.0 46-47 37.637375000000006 39.0 35.0 41.0 33.0 41.0 48-49 37.571749999999994 39.0 35.0 41.0 33.0 41.0 50-51 37.037875 38.5 34.5 40.0 32.0 40.5 52-53 37.063125 38.5 35.0 40.0 33.0 41.0 54-55 37.275125 38.0 35.0 41.0 33.0 41.0 56-57 37.153499999999994 38.0 35.0 41.0 33.0 41.0 58-59 36.847 37.0 35.0 40.5 33.0 41.0 60-61 36.631 37.0 35.0 40.0 33.0 41.0 62-63 36.389625 36.0 35.0 40.0 32.5 41.0 64-65 36.05075 35.5 35.0 39.0 32.0 41.0 66-67 35.786500000000004 35.0 35.0 39.0 32.0 41.0 68-69 35.508 35.0 34.5 38.5 31.5 41.0 70-71 35.160875000000004 35.0 34.0 37.0 31.0 40.0 72-73 34.813625 35.0 34.0 37.0 31.0 39.0 74-75 34.492125 35.0 34.0 36.0 30.0 39.0 76-77 34.265 35.0 34.0 36.0 30.0 38.0 78-79 34.010374999999996 35.0 33.5 35.5 30.0 37.0 80-81 33.756125 35.0 33.5 35.0 29.5 37.0 82-83 33.551125 35.0 33.0 35.0 29.5 36.0 84-85 33.3005 35.0 33.0 35.0 29.0 36.0 86-87 33.1365 35.0 33.0 35.0 29.0 36.0 88-89 32.76525 35.0 33.0 35.0 28.0 35.5 90-91 32.549875 35.0 33.0 35.0 27.0 35.0 92-93 32.187625 34.5 32.0 35.0 27.0 35.0 94-95 31.90475 34.5 32.0 35.0 25.5 35.0 96-97 31.593375 34.0 32.0 35.0 25.0 35.0 98-99 31.143625 34.0 31.5 35.0 24.5 35.0 100 30.69625 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.4099396761032281 1101 2 0.029936672423716004 1101 3 0.01554404145078081 1101 4 0.003416685439667333 1101 5 -0.025819128432331695 1101 6 0.032051763410180456 1101 7 -0.03267752997422235 1101 8 0.00351680808990551 1101 9 0.07196315486470439 1101 10-11 0.002402943605922303 1101 12-13 -0.028278391029012084 1101 14-15 0.06307101198968468 1101 16-17 -0.12477159520413039 1101 18-19 0.018966984556080035 1101 20-21 0.028453605666946657 1101 22-23 0.18015819378738485 1101 24-25 0.044679732672520345 1101 26-27 0.18018322444994794 1101 28-29 -0.18191659783234115 1101 30-31 -0.005976070686593005 1101 32-33 -0.031288328202052185 1101 34-35 -0.13984005406623368 1101 36-37 -0.19097769767965644 1101 38-39 -0.08263873244725062 1101 40-41 -0.13566619108407707 1101 42-43 -0.11604215163575304 1101 44-45 -0.3412305073715345 1101 46-47 -0.38930815248679806 1101 48-49 -0.18090285599859612 1101 50-51 0.037815073464997795 1101 52-53 -0.18687266901955013 1101 54-55 -0.13627318465119487 1101 56-57 -0.2753372881780223 1101 58-59 -0.38525318515181084 1101 60-61 -0.2019661585442165 1101 62-63 -0.13918925683962868 1101 64-65 -0.23362368901904773 1101 66-67 -0.10949663337588333 1101 68-69 -0.1564353833445935 1101 70-71 -0.11856399088883762 1101 72-73 -0.19535180596230362 1101 74-75 -0.19776726489950391 1101 76-77 -0.4291444519536398 1101 78-79 -0.3153988636079177 1101 80-81 -0.1661535380841599 1101 82-83 -0.19398137718705044 1101 84-85 -0.11136767540237003 1101 86-87 -0.44284873970614314 1101 88-89 -0.21908087407073396 1101 90-91 -0.3326262171159726 1101 92-93 -0.47816700458060524 1101 94-95 -0.4617218592776098 1101 96-97 -0.25078846587069137 1101 98-99 -0.6595266701709583 1101 100 -0.8232710069835534 1103 1 -0.40993967610322457 1103 2 -0.029936672423716004 1103 3 -0.015544041450773705 1103 4 -0.0034166854396602275 1103 5 0.025819128432331695 1103 6 -0.03205176341017335 1103 7 0.03267752997421525 1103 8 -0.0035168080899126153 1103 9 -0.0719631548647115 1103 10-11 -0.0024029436059151976 1103 12-13 0.02827839102900498 1103 14-15 -0.06307101198968468 1103 16-17 0.12477159520412329 1103 18-19 -0.018966984556080035 1103 20-21 -0.028453605666946657 1103 22-23 -0.18015819378739195 1103 24-25 -0.044679732672520345 1103 26-27 -0.18018322444995505 1103 28-29 0.18191659783234115 1103 30-31 0.005976070686585899 1103 32-33 0.03128832820204508 1103 34-35 0.13984005406622657 1103 36-37 0.19097769767966355 1103 38-39 0.08263873244725062 1103 40-41 0.13566619108407707 1103 42-43 0.11604215163575304 1103 44-45 0.3412305073715274 1103 46-47 0.38930815248679806 1103 48-49 0.18090285599859612 1103 50-51 -0.037815073464997795 1103 52-53 0.18687266901955013 1103 54-55 0.13627318465119487 1103 56-57 0.2753372881780223 1103 58-59 0.38525318515181084 1103 60-61 0.2019661585442165 1103 62-63 0.13918925683962868 1103 64-65 0.23362368901904773 1103 66-67 0.10949663337589044 1103 68-69 0.1564353833445935 1103 70-71 0.11856399088883762 1103 72-73 0.19535180596230362 1103 74-75 0.19776726489950391 1103 76-77 0.4291444519536398 1103 78-79 0.3153988636079248 1103 80-81 0.16615353808415279 1103 82-83 0.19398137718705755 1103 84-85 0.11136767540237003 1103 86-87 0.44284873970613603 1103 88-89 0.21908087407074106 1103 90-91 0.3326262171159655 1103 92-93 0.47816700458061234 1103 94-95 0.4617218592776169 1103 96-97 0.25078846587069137 1103 98-99 0.6595266701709619 1103 100 0.8232710069835534 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 13.0 28 21.0 29 38.0 30 81.0 31 105.0 32 146.0 33 180.0 34 249.0 35 477.0 36 691.0 37 913.0 38 928.0 39 156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.474999999999998 9.950000000000001 14.424999999999999 49.15 2 25.5 17.0 32.425 25.074999999999996 3 27.450000000000003 21.475 23.3 27.775 4 28.725 27.35 16.35 27.575 5 29.75 28.849999999999998 19.525000000000002 21.875 6 22.475 32.625 19.950000000000003 24.95 7 20.575 15.049999999999999 38.45 25.924999999999997 8 22.425 19.325 23.625 34.625 9 23.275000000000002 19.0 27.55 30.175 10-11 26.207155366524894 27.570678008506377 18.87665749311984 27.34550913184889 12-13 25.275 21.6125 25.162499999999998 27.950000000000003 14-15 25.324999999999996 22.975 24.212500000000002 27.487499999999997 16-17 26.3125 22.5 23.6875 27.500000000000004 18-19 25.3125 23.400000000000002 23.8375 27.450000000000003 20-21 25.650000000000002 23.549999999999997 23.6125 27.187499999999996 22-23 26.625 22.7125 23.962500000000002 26.700000000000003 24-25 26.1125 23.200000000000003 23.35 27.3375 26-27 26.087500000000002 23.549999999999997 23.474999999999998 26.887499999999996 28-29 26.325 23.2625 23.8125 26.6 30-31 25.15 23.3875 23.3875 28.075 32-33 26.400000000000002 23.9125 22.825 26.8625 34-35 27.0125 23.4875 22.650000000000002 26.85 36-37 26.6125 22.400000000000002 23.9875 27.0 38-39 26.0125 23.6375 23.0 27.35 40-41 25.937500000000004 23.8875 23.3375 26.8375 42-43 25.887500000000003 23.474999999999998 23.375 27.2625 44-45 26.8 23.0 23.575 26.625 46-47 26.4125 23.525 23.2625 26.8 48-49 25.9875 23.962500000000002 22.85 27.200000000000003 50-51 25.900000000000002 23.95 23.799999999999997 26.35 52-53 26.5625 23.1375 23.3375 26.9625 54-55 25.7375 24.2625 22.525000000000002 27.474999999999998 56-57 27.425 23.4375 23.1625 25.974999999999998 58-59 25.724999999999998 23.724999999999998 23.75 26.8 60-61 25.75 23.0125 23.4125 27.825 62-63 26.8125 22.9625 23.625 26.6 64-65 25.7125 23.1375 23.65 27.500000000000004 66-67 26.625 22.925 23.1625 27.287499999999998 68-69 26.8375 23.6625 23.2375 26.2625 70-71 26.424999999999997 23.674999999999997 22.775000000000002 27.125 72-73 25.7375 23.7125 23.6375 26.9125 74-75 26.75 23.849999999999998 23.5375 25.8625 76-77 25.412499999999998 23.849999999999998 23.0625 27.675 78-79 26.1625 23.575 23.1625 27.1 80-81 26.3125 23.05 23.8625 26.775 82-83 26.5125 23.375 22.8 27.3125 84-85 26.0375 23.799999999999997 23.7 26.4625 86-87 27.175 23.4375 23.474999999999998 25.912499999999998 88-89 25.637500000000003 24.212500000000002 23.8625 26.2875 90-91 27.237499999999997 23.7 22.662499999999998 26.400000000000002 92-93 27.787499999999998 23.425 22.875 25.912499999999998 94-95 27.237499999999997 23.2125 22.825 26.724999999999998 96-97 26.55 23.2875 23.8625 26.3 98-99 27.700000000000003 23.2125 22.8625 26.224999999999998 100 26.974999999999998 23.225 22.825 26.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 1.5 29 3.5 30 7.0 31 9.0 32 8.5 33 15.0 34 23.5 35 28.0 36 35.0 37 44.0 38 56.5 39 73.0 40 84.0 41 98.5 42 124.5 43 136.5 44 131.5 45 139.5 46 154.0 47 157.0 48 147.0 49 137.5 50 132.0 51 131.5 52 124.5 53 105.0 54 93.0 55 96.0 56 100.0 57 101.5 58 98.0 59 100.5 60 113.5 61 111.0 62 95.5 63 82.0 64 85.0 65 91.0 66 92.5 67 94.0 68 83.0 69 80.5 70 75.0 71 60.0 72 50.5 73 40.5 74 40.5 75 35.0 76 22.0 77 14.0 78 10.0 79 6.5 80 7.5 81 5.0 82 1.5 83 2.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.075 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556572 spots for SRR8618238.sra Written 556572 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra Read 556565 spots for SRR8618238.sra Written 556565 spots for SRR8618238.sra SRR ids: ['SRR8618238.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qpy08d4h SRR8618238.sra spots: 11131307 blocks: [[1, 556565], [556566, 1113130], [1113131, 1669695], [1669696, 2226260], [2226261, 2782825], [2782826, 3339390], [3339391, 3895955], [3895956, 4452520], [4452521, 5009085], [5009086, 5565650], [5565651, 6122215], [6122216, 6678780], [6678781, 7235345], [7235346, 7791910], [7791911, 8348475], [8348476, 8905040], [8905041, 9461605], [9461606, 10018170], [10018171, 10574735], [10574736, 11131307]] SRR8618238 file size 2896806 SRR8618238 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618238 SRR8618238_1.fastq SRR8618238_2.fastq Input file: SRR8618238_1.fastq Paired file: SRR8618238_2.fastq trimmed: SRR8618238-trimmed-pair1.fastq, SRR8618238-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:16:02 2024 >> started Sat Dec 7 09:16:12 2024 >> done (10.097s) 11131307 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11131307 (100.00%) read pairs available; of these: 1515085 (13.61%) trimmed read pairs available after processing 9616222 (86.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 78 1 0.00% 79 0 0.00% 80 1 0.00% 81 8 0.00% 82 28 0.00% 83 101 0.00% 84 5877 0.05% 85 6498 0.06% 86 6755 0.06% 87 7637 0.07% 88 9191 0.08% 89 11573 0.10% 90 18589 0.17% 91 34366 0.31% 92 49531 0.44% 93 69187 0.62% 94 92514 0.83% 95 118974 1.07% 96 156625 1.41% 97 216931 1.95% 98 304505 2.74% 99 406193 3.65% 100 9616222 86.39% 11131307 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=22 prefix-density=0.34 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=50.20 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=9.9 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=20 prefix-density=0.36 prefix-fanout=2.6 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=149.68 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=19.5 sequence=GCCGCCGCCGCC SRR8618238 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:16:42 Started mapping on | Dec 07 09:16:43 Finished on | Dec 07 09:17:16 Mapping speed, Million of reads per hour | 1214.32 Number of input reads | 11131307 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10867536 Uniquely mapped reads % | 97.63% Average mapped length | 198.15 Number of splices: Total | 6902330 Number of splices: Annotated (sjdb) | 6571441 Number of splices: GT/AG | 6803157 Number of splices: GC/AG | 79910 Number of splices: AT/AC | 2338 Number of splices: Non-canonical | 16925 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 111244 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 5205 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 152527 152527 152527 N_multimapping 111244 111244 111244 N_noFeature 255603 5429818 5486826 N_ambiguous 244909 19433 20249 UnstrandedReadsAssigned:10367024 PositiveStrandReadsAssigned:5418285 NegativeStrandReadsAssigned:5360461 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618238 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618238-trimmed-pair1.fastq SRR8618238-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,131,307 reads, 10,583,316 reads pseudoaligned [quant] estimated average fragment length: 165.538 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR8618238.ke.tsv 35125 SRR8618238.se.tsv 88098 total ==> SRR8618238.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.559 0 0 PNS24247 1044 879.462 7.7404 1.16462 PNS24249 1928 1763.46 90.4217 6.7849 PNS24246 1044 879.462 7.7404 1.16462 PNS24248 1044 879.462 7.7404 1.16462 PNS24244 1471 1306.46 25.3571 2.56827 PNS24243 293 136.378 3 2.91082 KQK14069 1603 1438.46 4013.47 369.198 KQK14071 474 310.967 339.717 144.557 ==> SRR8618238.se.tsv <== BRADI_1g14170v3 4583 BRADI_1g53295v3 187 BRADI_1g59795v3 178 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 355 BRADI_1g74790v3 23 BRADI_1g09890v3 0 BRADI_1g77505v3 189 BRADI_1g48960v3 0 SRR8618238 completed mapping pipeline successfully