Starting /dee2/code/volunteer_pipeline.sh SRR8618239 current disk space = 1544241176576 free memory = 1604135904 SRR8618239 SRAfilesize b5100111b126cc6aef1aa9a06f15db68 SRR8618239.sra SRR8618239.sra file validated SRR8618239 is paired end SRR8618239 is conventional basespace SRR8618239 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618239_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0635 34.0 31.0 34.0 31.0 34.0 2 33.225 34.0 33.0 34.0 31.0 34.0 3 33.2925 34.0 34.0 34.0 31.0 34.0 4 33.0545 37.0 37.0 37.0 2.0 37.0 5 34.74875 37.0 37.0 37.0 19.0 37.0 6 36.00675 37.0 37.0 37.0 32.0 37.0 7 36.2835 37.0 36.0 37.0 35.0 37.0 8 36.3955 37.0 37.0 37.0 35.0 37.0 9 38.39375 39.0 39.0 39.0 37.0 39.0 10-11 38.420500000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.33175 39.0 39.0 39.0 37.0 39.0 14-15 39.935125 41.0 40.0 41.0 38.0 41.0 16-17 39.84625 41.0 40.0 41.0 38.0 41.0 18-19 39.81825 41.0 40.0 41.0 38.0 41.0 20-21 39.735875 41.0 40.0 41.0 37.5 41.0 22-23 39.626875 41.0 39.5 41.0 37.0 41.0 24-25 39.476 41.0 39.0 41.0 36.5 41.0 26-27 39.388125 40.5 39.0 41.0 36.0 41.0 28-29 39.218 40.0 39.0 41.0 36.0 41.0 30-31 38.94625 40.0 38.0 41.0 35.0 41.0 32-33 38.888999999999996 40.0 38.0 41.0 35.0 41.0 34-35 39.087625 40.0 38.0 41.0 35.0 41.0 36-37 39.114 40.0 38.0 41.0 35.0 41.0 38-39 39.04025 40.0 38.0 41.0 35.0 41.0 40-41 38.8835 40.0 38.0 41.0 35.0 41.0 42-43 38.70525 40.0 37.5 41.0 35.0 41.0 44-45 38.426249999999996 40.0 36.5 41.0 34.5 41.0 46-47 38.232625 40.0 36.0 41.0 34.0 41.0 48-49 37.930875 39.5 35.0 41.0 34.0 41.0 50-51 37.635 39.0 35.0 41.0 33.0 41.0 52-53 37.472375 39.0 35.0 41.0 33.0 41.0 54-55 37.130625 38.0 35.0 41.0 33.0 41.0 56-57 36.89975 37.0 35.0 40.5 33.0 41.0 58-59 36.657125 37.0 35.0 40.0 33.0 41.0 60-61 36.307874999999996 36.0 35.0 40.0 32.0 41.0 62-63 36.059125 35.5 35.0 39.5 32.0 41.0 64-65 35.80475 35.0 35.0 39.0 31.0 41.0 66-67 35.58775 35.0 34.0 39.0 31.0 41.0 68-69 35.253125 35.0 34.0 38.0 31.0 40.0 70-71 34.937250000000006 35.0 34.0 37.0 31.0 39.5 72-73 34.590125 35.0 34.0 36.5 30.0 39.0 74-75 34.381875 35.0 34.0 36.0 30.0 39.0 76-77 33.516000000000005 34.5 33.0 35.0 29.0 37.0 78-79 33.869875 35.0 33.0 35.0 30.0 37.0 80-81 33.734375 35.0 33.0 35.0 30.0 37.0 82-83 33.54525 35.0 33.0 35.0 29.5 36.0 84-85 33.4375 35.0 33.0 35.0 29.0 36.0 86-87 33.2235 35.0 33.0 35.0 29.0 35.5 88-89 32.880624999999995 35.0 33.0 35.0 28.5 35.0 90-91 32.494 35.0 32.5 35.0 27.0 35.0 92-93 32.344875 35.0 32.0 35.0 27.0 35.0 94-95 32.157375 34.5 32.0 35.0 27.0 35.0 96-97 31.8045 34.0 32.0 35.0 27.0 35.0 98-99 31.2075 34.0 32.0 35.0 24.0 35.0 100 30.75775 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.05961533124254004 1101 2 -0.025186644833610217 1101 3 -0.073700424634346 1101 4 -4.492215037051427 1101 5 -2.225861064083702 1101 6 -0.686936249340846 1101 7 -0.14494463101218713 1101 8 -0.0921845077849639 1101 9 0.02119008631456154 1101 10-11 0.07038383614109733 1101 12-13 -0.018615914073990325 1101 14-15 0.06008020870916653 1101 16-17 0.004884682634390458 1101 18-19 -0.026213538341977483 1101 20-21 0.06073242485636854 1101 22-23 0.18145485831644947 1101 24-25 0.03251366878521367 1101 26-27 0.10202325775026821 1101 28-29 -0.045814715106438086 1101 30-31 0.020045238822127942 1101 32-33 0.1474424800865961 1101 34-35 0.15243817823540695 1101 36-37 0.37630790152924476 1101 38-39 0.2457467181038524 1101 40-41 0.2887513530015866 1101 42-43 0.27481196747245207 1101 44-45 0.3964502789264799 1101 46-47 0.4322944131442412 1101 48-49 0.3995864672087919 1101 50-51 0.14400099913962805 1101 52-53 0.08831978018928055 1101 54-55 0.23922455663178965 1101 56-57 0.1824193055979535 1101 58-59 0.15007216008437751 1101 60-61 0.1813577197413352 1101 62-63 0.10073964086481624 1101 64-65 0.0895409508478835 1101 66-67 0.01629846521051803 1101 68-69 -0.09164330715217517 1101 70-71 -0.11956370902833413 1101 72-73 0.07036995920179834 1101 74-75 0.11244483916627246 1101 76-77 0.12158280369681762 1101 78-79 0.2674918819905088 1101 80-81 -0.00723682384613511 1101 82-83 0.16624573284116195 1101 84-85 0.029585634592429244 1101 86-87 0.26839388304515666 1101 88-89 0.2231481224501124 1101 90-91 0.40476950403818535 1101 92-93 0.15734367627875656 1101 94-95 -0.013835308484360098 1101 96-97 -0.02012850045793968 1101 98-99 -0.09514723432599936 1101 100 0.305833865282672 1104 1 -0.05961533124254714 1104 2 0.025186644833617322 1104 3 0.073700424634346 1104 4 4.49221503705143 1104 5 2.225861064083709 1104 6 0.686936249340846 1104 7 0.14494463101218003 1104 8 0.0921845077849639 1104 9 -0.02119008631456154 1104 10-11 -0.07038383614110444 1104 12-13 0.01861591407399743 1104 14-15 -0.06008020870916653 1104 16-17 -0.0048846826343975636 1104 18-19 0.026213538341984588 1104 20-21 -0.060732424856375644 1104 22-23 -0.18145485831644947 1104 24-25 -0.03251366878521367 1104 26-27 -0.10202325775027532 1104 28-29 0.04581471510643098 1104 30-31 -0.020045238822127942 1104 32-33 -0.147442480086589 1104 34-35 -0.15243817823540695 1104 36-37 -0.37630790152923765 1104 38-39 -0.2457467181038524 1104 40-41 -0.2887513530015795 1104 42-43 -0.27481196747245207 1104 44-45 -0.3964502789264799 1104 46-47 -0.4322944131442412 1104 48-49 -0.3995864672087919 1104 50-51 -0.14400099913963516 1104 52-53 -0.08831978018928055 1104 54-55 -0.23922455663178965 1104 56-57 -0.1824193055979606 1104 58-59 -0.1500721600843704 1104 60-61 -0.1813577197413352 1104 62-63 -0.10073964086480913 1104 64-65 -0.08954095084787639 1104 66-67 -0.016298465210510926 1104 68-69 0.09164330715216806 1104 70-71 0.11956370902833413 1104 72-73 -0.07036995920179834 1104 74-75 -0.11244483916627246 1104 76-77 -0.12158280369681052 1104 78-79 -0.2674918819905088 1104 80-81 0.00723682384613511 1104 82-83 -0.16624573284116195 1104 84-85 -0.029585634592429244 1104 86-87 -0.26839388304514955 1104 88-89 -0.2231481224501124 1104 90-91 -0.40476950403819245 1104 92-93 -0.15734367627876367 1104 94-95 0.013835308484360098 1104 96-97 0.020128500457936127 1104 98-99 0.09514723432599581 1104 100 -0.30583386528267553 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 16.0 28 24.0 29 54.0 30 54.0 31 103.0 32 132.0 33 202.0 34 299.0 35 445.0 36 722.0 37 919.0 38 892.0 39 136.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.900000000000002 11.1 13.625000000000002 48.375 2 25.45 19.55 29.45 25.55 3 27.400000000000002 22.0 23.400000000000002 27.200000000000003 4 28.965709506551434 27.237245609144132 15.918594926122106 27.878449958182326 5 31.35 28.475 18.325 21.85 6 21.79134350763072 32.874655991994 19.389542156617463 25.94445834375782 7 21.575 14.325 37.6 26.5 8 23.025000000000002 19.85 24.325 32.800000000000004 9 23.325000000000003 18.5 28.449999999999996 29.725 10-11 27.1 26.937499999999996 18.587500000000002 27.375 12-13 25.75 20.6875 24.825 28.7375 14-15 25.6125 22.5875 24.3875 27.4125 16-17 26.450000000000003 22.0625 23.125 28.3625 18-19 25.5125 23.3625 23.075000000000003 28.050000000000004 20-21 25.7375 23.5875 23.0375 27.6375 22-23 26.737499999999997 23.1 22.375 27.787499999999998 24-25 26.025 24.1625 22.1375 27.675 26-27 25.837500000000002 23.5625 23.200000000000003 27.400000000000002 28-29 26.237500000000004 22.9875 22.7125 28.0625 30-31 25.55 23.1625 23.674999999999997 27.6125 32-33 25.900000000000002 23.5375 23.4375 27.125 34-35 26.887499999999996 23.375 23.2375 26.5 36-37 25.8 22.75 23.6625 27.787499999999998 38-39 27.275 23.575 22.025 27.125 40-41 25.724999999999998 23.7875 22.8625 27.625 42-43 25.85 23.674999999999997 22.775000000000002 27.700000000000003 44-45 26.0375 23.799999999999997 22.7375 27.425 46-47 27.625 23.3125 22.5625 26.5 48-49 26.650000000000002 23.05 23.325000000000003 26.974999999999998 50-51 26.0125 23.0875 23.4375 27.462500000000002 52-53 26.8625 23.2375 23.0 26.900000000000002 54-55 26.2125 23.599999999999998 23.3 26.887499999999996 56-57 26.237500000000004 23.2125 23.0625 27.487499999999997 58-59 27.187499999999996 23.575 22.975 26.2625 60-61 26.424999999999997 22.7625 22.975 27.8375 62-63 27.125 23.0375 23.3 26.5375 64-65 26.775 23.7 22.5125 27.0125 66-67 26.424999999999997 23.1625 23.0 27.4125 68-69 26.637499999999996 23.4375 22.537499999999998 27.3875 70-71 27.1375 22.900000000000002 22.912499999999998 27.05 72-73 25.937500000000004 23.4125 23.6125 27.037499999999998 74-75 25.937500000000004 23.200000000000003 23.875 26.987499999999997 76-77 27.400000000000002 22.400000000000002 22.775000000000002 27.425 78-79 26.375 23.175 23.3375 27.1125 80-81 27.025 23.2875 22.5625 27.125 82-83 26.637499999999996 22.325 23.474999999999998 27.5625 84-85 27.0 23.474999999999998 22.8875 26.637499999999996 86-87 25.6 24.375 22.3875 27.6375 88-89 26.787499999999998 23.625 22.7375 26.85 90-91 28.262500000000003 22.237499999999997 23.5 26.0 92-93 26.544136034008503 23.905976494123532 22.99324831207802 26.556639159789945 94-95 26.75 23.200000000000003 23.0 27.05 96-97 27.537499999999998 23.3625 22.5 26.6 98-99 28.075 23.6375 22.5625 25.724999999999998 100 26.825 23.5 23.075000000000003 26.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 2.0 29 3.0 30 2.5 31 4.0 32 5.0 33 9.0 34 13.0 35 18.5 36 29.5 37 47.5 38 55.5 39 66.5 40 83.0 41 99.5 42 115.5 43 133.5 44 145.0 45 144.5 46 155.0 47 162.0 48 147.0 49 132.0 50 134.5 51 123.5 52 114.0 53 112.5 54 110.0 55 98.5 56 89.0 57 88.5 58 93.0 59 112.5 60 121.0 61 106.0 62 88.5 63 95.0 64 103.0 65 97.5 66 91.0 67 96.5 68 95.0 69 77.0 70 65.0 71 54.5 72 46.5 73 43.5 74 41.5 75 36.0 76 28.5 77 19.0 78 13.0 79 10.0 80 7.5 81 5.5 82 4.5 83 3.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 10.325 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618239 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618239_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2965 34.0 31.0 34.0 31.0 34.0 2 32.9055 34.0 31.0 34.0 31.0 34.0 3 33.059 34.0 33.0 34.0 31.0 34.0 4 36.503 37.0 37.0 37.0 35.0 37.0 5 36.48025 37.0 37.0 37.0 35.0 37.0 6 36.5095 37.0 37.0 37.0 35.0 37.0 7 36.47475 37.0 37.0 37.0 35.0 37.0 8 36.52475 37.0 37.0 37.0 35.0 37.0 9 38.26725 39.0 39.0 39.0 37.0 39.0 10-11 38.300625 39.0 39.0 39.0 37.0 39.0 12-13 38.216750000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.88912500000001 41.0 40.0 41.0 38.0 41.0 16-17 39.771625 41.0 40.0 41.0 37.5 41.0 18-19 39.889875 41.0 40.0 41.0 38.0 41.0 20-21 39.791 41.0 40.0 41.0 38.0 41.0 22-23 39.681125 41.0 40.0 41.0 37.0 41.0 24-25 39.542375 41.0 39.0 41.0 36.5 41.0 26-27 39.440250000000006 41.0 39.0 41.0 36.0 41.0 28-29 39.364125 40.5 39.0 41.0 36.0 41.0 30-31 39.1545 40.0 39.0 41.0 35.5 41.0 32-33 39.090375 40.0 38.5 41.0 35.0 41.0 34-35 39.015125 40.0 38.0 41.0 35.0 41.0 36-37 38.857749999999996 40.0 38.0 41.0 35.0 41.0 38-39 38.697 40.0 38.0 41.0 35.0 41.0 40-41 38.45425 40.0 37.5 41.0 34.5 41.0 42-43 38.173875 40.0 36.5 41.0 34.0 41.0 44-45 37.921 39.5 35.5 41.0 33.0 41.0 46-47 37.65075 39.0 35.0 41.0 33.0 41.0 48-49 37.5105 39.0 35.0 41.0 33.0 41.0 50-51 37.043125 38.5 35.0 40.5 32.5 40.5 52-53 37.064125000000004 38.0 35.0 40.0 33.0 41.0 54-55 37.278999999999996 38.0 35.0 41.0 33.0 41.0 56-57 37.133750000000006 37.5 35.0 41.0 33.0 41.0 58-59 36.823 37.0 35.0 40.0 33.0 41.0 60-61 36.644875 36.5 35.0 40.0 33.0 41.0 62-63 36.290625 36.0 35.0 39.5 32.5 41.0 64-65 36.016999999999996 35.0 35.0 39.0 32.5 41.0 66-67 35.73325 35.0 35.0 39.0 32.0 41.0 68-69 35.406000000000006 35.0 35.0 37.5 31.5 40.5 70-71 35.223749999999995 35.0 34.5 37.0 31.5 40.0 72-73 34.905125 35.0 34.0 37.0 31.0 39.0 74-75 34.576125000000005 35.0 34.0 36.0 31.0 39.0 76-77 34.317750000000004 35.0 34.0 36.0 30.5 38.0 78-79 34.053375 35.0 34.0 35.0 30.0 37.0 80-81 33.86775 35.0 34.0 35.0 30.0 37.0 82-83 33.650375 35.0 33.0 35.0 29.5 36.0 84-85 33.375125 35.0 33.0 35.0 29.0 36.0 86-87 33.215875 35.0 33.0 35.0 29.0 36.0 88-89 33.039500000000004 35.0 33.0 35.0 29.0 35.0 90-91 32.885125 35.0 33.0 35.0 29.0 35.0 92-93 32.547125 35.0 33.0 35.0 27.0 35.0 94-95 32.050124999999994 35.0 32.0 35.0 26.5 35.0 96-97 31.758625000000002 34.0 32.0 35.0 26.0 35.0 98-99 31.386875 34.0 32.0 35.0 24.5 35.0 100 30.78525 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.01268352252227345 1101 2 -0.14561072409868814 1101 3 0.06394493630484277 1101 4 0.09956703949377044 1101 5 0.08048624795315362 1101 6 0.05592406538814032 1101 7 0.07242374621853287 1101 8 0.0667897088618119 1101 9 0.10726874080653204 1101 10-11 -0.0065637922899739465 1101 12-13 -0.024846659820710215 1101 14-15 0.12029224834170549 1101 16-17 -0.17049901473730955 1101 18-19 -0.03128555965696478 1101 20-21 0.03579556493019709 1101 22-23 0.003601065748938481 1101 24-25 0.11079348338930117 1101 26-27 0.10589492381560461 1101 28-29 0.08168660320279741 1101 30-31 0.12352557519913887 1101 32-33 0.17713913019344574 1101 34-35 0.2506660930865081 1101 36-37 0.13568871249757564 1101 38-39 0.029321972745691482 1101 40-41 0.16088923427049195 1101 42-43 0.2832977158557952 1101 44-45 0.27811467902639464 1101 46-47 0.32354083983236137 1101 48-49 0.09672920540645435 1101 50-51 0.14513196969276265 1101 52-53 0.19755210790707878 1101 54-55 0.38861674669035295 1101 56-57 0.3427326468874057 1101 58-59 0.26704781993283433 1101 60-61 0.23094696233798828 1101 62-63 0.2899378313119243 1101 64-65 0.19788515445033283 1101 66-67 0.23247342566124019 1101 68-69 -0.010921151230881776 1101 70-71 0.1502664372346061 1101 72-73 0.0749285337625949 1101 74-75 0.055195526074768964 1101 76-77 -0.218922594432577 1101 78-79 -0.06728234020704349 1101 80-81 0.03209042213649127 1101 82-83 0.21152618578446436 1101 84-85 -0.03542088756903894 1101 86-87 0.033242208098585024 1101 88-89 -0.096000666093083 1101 90-91 0.0053703755099761 1101 92-93 0.17787460797646304 1101 94-95 0.0798340318059445 1101 96-97 6.175237989474169E-4 1101 98-99 -0.2050734090089108 1101 100 0.040825955427273186 1104 1 -0.01268352252227345 1104 2 0.14561072409869524 1104 3 -0.06394493630484988 1104 4 -0.09956703949376333 1104 5 -0.08048624795314652 1104 6 -0.05592406538814032 1104 7 -0.07242374621853997 1104 8 -0.0667897088618119 1104 9 -0.10726874080652493 1104 10-11 0.0065637922899739465 1104 12-13 0.024846659820710215 1104 14-15 -0.12029224834170549 1104 16-17 0.17049901473730955 1104 18-19 0.03128555965695767 1104 20-21 -0.03579556493019709 1104 22-23 -0.003601065748938481 1104 24-25 -0.11079348338930828 1104 26-27 -0.10589492381560461 1104 28-29 -0.08168660320279741 1104 30-31 -0.12352557519913177 1104 32-33 -0.17713913019343863 1104 34-35 -0.2506660930865081 1104 36-37 -0.13568871249757564 1104 38-39 -0.029321972745691482 1104 40-41 -0.16088923427048485 1104 42-43 -0.2832977158557881 1104 44-45 -0.27811467902639464 1104 46-47 -0.3235408398323685 1104 48-49 -0.09672920540645435 1104 50-51 -0.14513196969276265 1104 52-53 -0.19755210790707878 1104 54-55 -0.38861674669034585 1104 56-57 -0.3427326468874057 1104 58-59 -0.26704781993283433 1104 60-61 -0.23094696233798118 1104 62-63 -0.2899378313119314 1104 64-65 -0.19788515445033283 1104 66-67 -0.23247342566124019 1104 68-69 0.010921151230888881 1104 70-71 -0.1502664372346061 1104 72-73 -0.07492853376258779 1104 74-75 -0.055195526074768964 1104 76-77 0.2189225944325699 1104 78-79 0.06728234020704349 1104 80-81 -0.03209042213649127 1104 82-83 -0.21152618578446436 1104 84-85 0.03542088756903894 1104 86-87 -0.03324220809857792 1104 88-89 0.0960006660930901 1104 90-91 -0.0053703755099761 1104 92-93 -0.17787460797646304 1104 94-95 -0.0798340318059445 1104 96-97 -6.175237989509696E-4 1104 98-99 0.20507340900890725 1104 100 -0.04082595542726963 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 17.0 28 24.0 29 43.0 30 67.0 31 99.0 32 147.0 33 158.0 34 266.0 35 440.0 36 776.0 37 897.0 38 903.0 39 161.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.974999999999998 10.325 15.024999999999999 47.675 2 26.674999999999997 16.725 31.1 25.5 3 27.625 21.375 22.275 28.725 4 29.925 26.700000000000003 16.475 26.900000000000002 5 30.099999999999998 29.075 19.675 21.15 6 23.1 32.85 18.425 25.624999999999996 7 21.15 13.850000000000001 38.65 26.35 8 23.525 20.575 23.25 32.65 9 24.025 17.925 28.525 29.525000000000002 10-11 26.773426748404855 26.310521706493184 19.429500813211558 27.486550731890404 12-13 25.109416031011627 21.370513942728522 24.871826935100664 28.648243091159188 14-15 25.374999999999996 22.787499999999998 23.925 27.9125 16-17 26.200000000000003 21.9375 23.674999999999997 28.1875 18-19 26.5625 23.0875 22.425 27.925 20-21 26.85 24.0125 22.3375 26.8 22-23 26.887499999999996 23.3625 22.025 27.725 24-25 26.737499999999997 23.7375 22.1375 27.3875 26-27 26.087500000000002 23.5375 23.325000000000003 27.05 28-29 26.775 22.9875 22.1375 28.1 30-31 26.174999999999997 22.650000000000002 23.425 27.750000000000004 32-33 27.537499999999998 23.45 22.8125 26.200000000000003 34-35 26.337500000000002 23.525 23.0375 27.1 36-37 26.387500000000003 22.7125 24.15 26.75 38-39 26.2875 23.3125 23.2375 27.1625 40-41 26.4625 23.400000000000002 22.775000000000002 27.3625 42-43 26.337500000000002 23.3 22.7125 27.650000000000002 44-45 26.650000000000002 23.9125 23.1875 26.25 46-47 26.6 23.9 22.35 27.150000000000002 48-49 26.5 22.787499999999998 23.0125 27.700000000000003 50-51 26.737499999999997 23.549999999999997 22.4875 27.224999999999998 52-53 26.75 22.7375 23.3 27.212500000000002 54-55 26.5875 23.2125 23.325000000000003 26.875 56-57 25.887500000000003 23.6125 23.0375 27.462500000000002 58-59 27.037499999999998 23.0875 22.900000000000002 26.974999999999998 60-61 27.200000000000003 23.5875 22.425 26.787499999999998 62-63 27.0875 23.1875 23.75 25.974999999999998 64-65 26.787499999999998 23.1125 22.9625 27.1375 66-67 26.474999999999998 23.525 23.4125 26.5875 68-69 26.775 22.9875 23.5625 26.674999999999997 70-71 26.187500000000004 22.7125 23.474999999999998 27.625 72-73 27.400000000000002 23.025000000000002 23.4625 26.1125 74-75 26.6125 22.625 23.525 27.237499999999997 76-77 26.487500000000004 22.75 22.400000000000002 28.3625 78-79 26.174999999999997 22.6125 23.95 27.2625 80-81 26.6 22.9875 23.1875 27.224999999999998 82-83 27.675 22.900000000000002 22.675 26.75 84-85 26.5875 23.2625 23.7375 26.4125 86-87 27.175 23.0875 23.200000000000003 26.5375 88-89 26.6125 23.025000000000002 22.662499999999998 27.700000000000003 90-91 27.200000000000003 23.2625 23.3125 26.224999999999998 92-93 27.712500000000002 23.1875 23.125 25.974999999999998 94-95 27.6625 23.3125 22.55 26.474999999999998 96-97 27.462500000000002 22.825 22.912499999999998 26.8 98-99 26.987499999999997 23.599999999999998 22.662499999999998 26.75 100 26.075 23.375 22.975 27.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 3.5 29 3.5 30 3.5 31 4.5 32 6.0 33 8.5 34 15.5 35 19.0 36 24.5 37 40.0 38 52.5 39 69.5 40 89.5 41 98.0 42 117.0 43 137.5 44 147.5 45 152.5 46 141.5 47 142.0 48 140.0 49 135.5 50 137.5 51 132.5 52 127.0 53 113.5 54 98.0 55 99.0 56 92.0 57 82.0 58 94.5 59 101.5 60 102.5 61 117.5 62 108.5 63 88.5 64 98.5 65 95.0 66 87.0 67 87.5 68 83.5 69 73.0 70 65.0 71 65.0 72 61.0 73 55.5 74 46.5 75 37.0 76 29.0 77 18.0 78 16.5 79 14.5 80 7.5 81 4.5 82 2.0 83 2.0 84 1.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.08750000000000001 12-13 0.0375 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra Read 555209 spots for SRR8618239.sra Written 555209 spots for SRR8618239.sra Read 555208 spots for SRR8618239.sra Written 555208 spots for SRR8618239.sra SRR ids: ['SRR8618239.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_06c9psjs SRR8618239.sra spots: 11104161 blocks: [[1, 555208], [555209, 1110416], [1110417, 1665624], [1665625, 2220832], [2220833, 2776040], [2776041, 3331248], [3331249, 3886456], [3886457, 4441664], [4441665, 4996872], [4996873, 5552080], [5552081, 6107288], [6107289, 6662496], [6662497, 7217704], [7217705, 7772912], [7772913, 8328120], [8328121, 8883328], [8883329, 9438536], [9438537, 9993744], [9993745, 10548952], [10548953, 11104161]] SRR8618239 file size 2889720 SRR8618239 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618239 SRR8618239_1.fastq SRR8618239_2.fastq Input file: SRR8618239_1.fastq Paired file: SRR8618239_2.fastq trimmed: SRR8618239-trimmed-pair1.fastq, SRR8618239-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:17:08 2024 >> started Sat Dec 7 09:17:20 2024 >> done (11.678s) 11104161 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11104161 (100.00%) read pairs available; of these: 1449536 (13.05%) trimmed read pairs available after processing 9654625 (86.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 79 1 0.00% 80 0 0.00% 81 13 0.00% 82 32 0.00% 83 97 0.00% 84 4263 0.04% 85 4590 0.04% 86 5142 0.05% 87 5676 0.05% 88 6948 0.06% 89 9319 0.08% 90 16028 0.14% 91 30653 0.28% 92 44910 0.40% 93 63273 0.57% 94 85645 0.77% 95 112252 1.01% 96 149378 1.35% 97 210778 1.90% 98 300147 2.70% 99 400391 3.61% 100 9654625 86.95% 11104161 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=17 prefix-density=0.37 prefix-fanout=2.7 sequence=CAGGTGCTCAAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=36 fanout-score=52.56 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=9.5 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=28 prefix-density=0.33 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=33 fanout-score=54.36 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=9.9 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCC SRR8618239 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:18:02 Started mapping on | Dec 07 09:18:02 Finished on | Dec 07 09:18:34 Mapping speed, Million of reads per hour | 1249.22 Number of input reads | 11104161 Average input read length | 191 UNIQUE READS: Uniquely mapped reads number | 10497509 Uniquely mapped reads % | 94.54% Average mapped length | 190.12 Number of splices: Total | 6433406 Number of splices: Annotated (sjdb) | 6134715 Number of splices: GT/AG | 6342378 Number of splices: GC/AG | 73847 Number of splices: AT/AC | 1993 Number of splices: Non-canonical | 15188 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 110985 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 11359 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.12% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 495667 495667 495667 N_multimapping 110985 110985 110985 N_noFeature 233729 5240712 5292456 N_ambiguous 239404 20418 22214 UnstrandedReadsAssigned:10024376 PositiveStrandReadsAssigned:5236379 NegativeStrandReadsAssigned:5182839 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618239 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618239-trimmed-pair1.fastq SRR8618239-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,104,161 reads, 10,575,132 reads pseudoaligned [quant] estimated average fragment length: 159.338 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR8618239.ke.tsv 35125 SRR8618239.se.tsv 88098 total ==> SRR8618239.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 777.743 19.1463 3.2505 PNS24247 1044 885.662 11.8106 1.76078 PNS24249 1928 1769.66 90.4218 6.74657 PNS24246 1044 885.662 11.8106 1.76078 PNS24248 1044 885.662 11.8106 1.76078 PNS24244 1471 1312.66 0 0 PNS24243 293 141.894 5 4.65273 KQK14069 1603 1444.66 3481.73 318.221 KQK14071 474 317.064 264.098 109.981 ==> SRR8618239.se.tsv <== BRADI_1g14170v3 3826 BRADI_1g53295v3 138 BRADI_1g59795v3 152 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 187 BRADI_1g74790v3 17 BRADI_1g09890v3 0 BRADI_1g77505v3 146 BRADI_1g48960v3 0 SRR8618239 completed mapping pipeline successfully