Starting /dee2/code/volunteer_pipeline.sh SRR8618240 current disk space = 1544211337216 free memory = 1597101332 SRR8618240 SRAfilesize 5b73bbf965017b17563bce8e3b920d98 SRR8618240.sra SRR8618240.sra file validated SRR8618240 is paired end SRR8618240 is conventional basespace SRR8618240 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618240_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02575 34.0 31.0 34.0 31.0 34.0 2 33.1595 34.0 33.0 34.0 31.0 34.0 3 33.22025 34.0 34.0 34.0 31.0 34.0 4 32.70275 37.0 37.0 37.0 2.0 37.0 5 34.5485 37.0 35.0 37.0 19.0 37.0 6 35.86375 37.0 35.0 37.0 32.0 37.0 7 36.2175 37.0 35.0 37.0 35.0 37.0 8 36.331 37.0 37.0 37.0 35.0 37.0 9 38.2915 39.0 39.0 39.0 37.0 39.0 10-11 38.345625 39.0 39.0 39.0 37.0 39.0 12-13 38.30275 39.0 39.0 39.0 37.0 39.0 14-15 39.881875 41.0 40.0 41.0 38.0 41.0 16-17 39.79975 41.0 40.0 41.0 37.5 41.0 18-19 39.75175 41.0 40.0 41.0 37.5 41.0 20-21 39.68925 41.0 40.0 41.0 37.0 41.0 22-23 39.565 41.0 39.0 41.0 37.0 41.0 24-25 39.469125000000005 41.0 39.0 41.0 36.5 41.0 26-27 39.33975 40.0 39.0 41.0 36.0 41.0 28-29 39.224875 40.0 38.0 41.0 36.0 41.0 30-31 38.897 40.0 38.0 41.0 35.0 41.0 32-33 38.92675 40.0 38.0 41.0 35.0 41.0 34-35 39.14425 40.0 38.5 41.0 35.0 41.0 36-37 39.188500000000005 40.0 38.0 41.0 35.0 41.0 38-39 39.002625 40.0 38.0 41.0 35.0 41.0 40-41 38.926874999999995 40.0 38.0 41.0 35.0 41.0 42-43 38.690625 40.0 37.5 41.0 35.0 41.0 44-45 38.48075 40.0 37.0 41.0 34.5 41.0 46-47 38.329625 40.0 36.5 41.0 34.0 41.0 48-49 38.088375 40.0 35.5 41.0 34.0 41.0 50-51 37.754000000000005 39.0 35.0 41.0 33.5 41.0 52-53 37.584375 39.0 35.0 41.0 33.0 41.0 54-55 37.331125 38.5 35.0 41.0 33.0 41.0 56-57 36.991625 37.5 35.0 40.5 33.0 41.0 58-59 36.779125 37.0 35.0 40.0 33.0 41.0 60-61 36.448125000000005 36.5 35.0 40.0 32.0 41.0 62-63 36.141000000000005 36.0 35.0 40.0 32.0 41.0 64-65 35.83525 35.0 35.0 39.0 31.0 41.0 66-67 35.525 35.0 34.0 39.0 31.0 41.0 68-69 35.19 35.0 34.0 38.0 31.0 40.0 70-71 34.861375 35.0 34.0 37.0 31.0 39.5 72-73 34.591499999999996 35.0 34.0 37.0 30.5 39.0 74-75 34.383375 35.0 34.0 36.0 30.5 39.0 76-77 33.434250000000006 34.5 32.5 35.0 29.0 37.0 78-79 33.823 35.0 33.0 35.0 30.0 37.0 80-81 33.758250000000004 35.0 33.0 35.0 29.5 37.0 82-83 33.569625 35.0 33.0 35.0 29.0 36.0 84-85 33.394999999999996 35.0 33.0 35.0 29.5 36.0 86-87 33.1275 35.0 33.0 35.0 29.0 36.0 88-89 32.753375 35.0 33.0 35.0 29.0 35.0 90-91 32.49875 35.0 33.0 35.0 27.0 35.0 92-93 32.282375 35.0 32.0 35.0 27.0 35.0 94-95 32.054249999999996 34.0 32.0 35.0 27.0 35.0 96-97 31.752375 34.0 32.0 35.0 26.0 35.0 98-99 31.428125 34.0 32.0 35.0 25.0 35.0 100 30.97125 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.06466748266013411 1101 2 0.06099551203590181 1101 3 0.04518563851489432 1101 4 -2.989392084863322 1101 5 -1.5209608323133423 1101 6 -0.6086801305589518 1101 7 -0.2027743778049782 1101 8 -0.17115463076295612 1101 9 -0.058088535291716425 1101 10-11 -0.035929212566294666 1101 12-13 -0.06719196246429959 1101 14-15 -0.003926968584252677 1101 16-17 -0.1319614443084447 1101 18-19 0.022006323949412376 1101 20-21 -0.0013514891880888058 1101 22-23 0.14116687066503175 1101 24-25 0.030217258261934887 1101 26-27 0.11263259893920718 1101 28-29 -0.008873929008572645 1101 30-31 -0.20397286821705762 1101 32-33 -0.07537739698082646 1101 34-35 -0.042992656058750356 1101 36-37 0.05987352101183063 1101 38-39 -0.043069155446751495 1101 40-41 -0.05064259485924083 1101 42-43 0.09279375764993603 1101 44-45 0.22411770705834755 1101 46-47 0.12242452060383613 1101 48-49 0.1593737250102052 1101 50-51 0.05153508771929438 1101 52-53 0.06471848225213961 1101 54-55 0.08833129334965406 1101 56-57 -0.029503263973893468 1101 58-59 0.2129232966136314 1101 60-61 -0.0014279885760899447 1101 62-63 0.12245002039983888 1101 64-65 -0.005813953488370771 1101 66-67 0.020527335781316935 1101 68-69 -0.11171460628315089 1101 70-71 0.019073847409217137 1101 72-73 -0.11617707058343285 1101 74-75 0.050974092207262345 1101 76-77 -0.13438392492859919 1101 78-79 -0.2847052223582196 1101 80-81 -0.24204406364749076 1101 82-83 -0.07002243982048384 1101 84-85 -0.27830477356180694 1101 86-87 -0.12028253773969766 1101 88-89 -0.05592105263158231 1101 90-91 -0.20917482660138376 1101 92-93 -0.3304773561811487 1101 94-95 0.11696756425948962 1101 96-97 -0.12910546715626126 1101 98-99 -0.15231028151774595 1101 100 -0.06364749082007393 1104 1 -0.06466748266014122 1104 2 -0.06099551203590181 1104 3 -0.045185638514887216 1104 4 2.9893920848633186 1104 5 1.5209608323133423 1104 6 0.6086801305589589 1104 7 0.2027743778049782 1104 8 0.171154630762949 1104 9 0.058088535291716425 1104 10-11 0.035929212566294666 1104 12-13 0.06719196246429959 1104 14-15 0.003926968584252677 1104 16-17 0.1319614443084447 1104 18-19 -0.02200632394940527 1104 20-21 0.0013514891880888058 1104 22-23 -0.14116687066503886 1104 24-25 -0.030217258261934887 1104 26-27 -0.11263259893921429 1104 28-29 0.00887392900856554 1104 30-31 0.20397286821705762 1104 32-33 0.07537739698081936 1104 34-35 0.042992656058750356 1104 36-37 -0.05987352101183063 1104 38-39 0.043069155446751495 1104 40-41 0.05064259485924083 1104 42-43 -0.09279375764993603 1104 44-45 -0.22411770705834755 1104 46-47 -0.12242452060383613 1104 48-49 -0.1593737250101981 1104 50-51 -0.05153508771930149 1104 52-53 -0.06471848225214671 1104 54-55 -0.08833129334965406 1104 56-57 0.029503263973886362 1104 58-59 -0.2129232966136243 1104 60-61 0.0014279885760899447 1104 62-63 -0.12245002039983888 1104 64-65 0.005813953488370771 1104 66-67 -0.020527335781316935 1104 68-69 0.11171460628315089 1104 70-71 -0.019073847409224243 1104 72-73 0.11617707058343285 1104 74-75 -0.050974092207262345 1104 76-77 0.13438392492859919 1104 78-79 0.2847052223582196 1104 80-81 0.24204406364749076 1104 82-83 0.07002243982048384 1104 84-85 0.27830477356181405 1104 86-87 0.12028253773969766 1104 88-89 0.05592105263157521 1104 90-91 0.20917482660139086 1104 92-93 0.3304773561811487 1104 94-95 -0.11696756425948251 1104 96-97 0.1291054671562648 1104 98-99 0.1523102815177495 1104 100 0.06364749082007393 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 14.0 28 31.0 29 58.0 30 61.0 31 88.0 32 139.0 33 179.0 34 278.0 35 494.0 36 726.0 37 920.0 38 866.0 39 143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.275 10.575 14.75 46.400000000000006 2 26.575 19.05 30.85 23.525 3 26.200000000000003 22.475 23.275000000000002 28.050000000000004 4 29.6421527190758 26.965342349957734 15.694561848408004 27.697943082558467 5 30.825000000000003 29.425 19.775000000000002 19.975 6 22.71135567783892 33.06653326663332 19.50975487743872 24.712356178089045 7 21.925 13.950000000000001 38.175 25.95 8 23.7 20.825 22.1 33.375 9 22.35 19.475 28.249999999999996 29.925 10-11 27.275 26.474999999999998 19.525000000000002 26.724999999999998 12-13 25.2 21.1375 24.9875 28.675 14-15 25.025 24.1875 24.775 26.0125 16-17 26.924999999999997 23.325000000000003 22.5 27.250000000000004 18-19 25.3125 24.474999999999998 22.7125 27.500000000000004 20-21 24.775 24.6125 23.8375 26.775 22-23 27.0875 23.5375 23.175 26.200000000000003 24-25 25.7125 24.8 23.5875 25.900000000000002 26-27 25.8 24.1125 23.3375 26.75 28-29 25.525 23.599999999999998 22.6875 28.1875 30-31 25.7125 24.1375 23.5 26.650000000000002 32-33 27.212500000000002 23.175 23.0125 26.6 34-35 26.4125 23.525 22.525000000000002 27.537499999999998 36-37 25.8625 23.7375 23.375 27.025 38-39 25.924999999999997 24.25 23.325000000000003 26.5 40-41 26.5375 23.599999999999998 23.175 26.687499999999996 42-43 25.650000000000002 23.5625 23.2875 27.500000000000004 44-45 26.687499999999996 23.549999999999997 23.575 26.187500000000004 46-47 26.7625 23.599999999999998 22.037499999999998 27.6 48-49 25.837500000000002 23.4125 22.8375 27.9125 50-51 26.1125 23.6875 22.912499999999998 27.287499999999998 52-53 26.4625 23.849999999999998 23.0375 26.650000000000002 54-55 25.8 23.799999999999997 23.3125 27.0875 56-57 26.437500000000004 23.4125 23.35 26.8 58-59 26.724999999999998 23.225 23.75 26.3 60-61 26.575 23.775 23.0 26.650000000000002 62-63 27.0 24.075 23.25 25.674999999999997 64-65 26.525 24.7375 22.2125 26.525 66-67 26.424999999999997 23.275000000000002 23.7 26.6 68-69 26.150000000000002 23.5375 24.025 26.2875 70-71 26.25 23.9375 23.5 26.3125 72-73 25.75 23.125 23.3625 27.762500000000003 74-75 25.937500000000004 23.724999999999998 23.9125 26.424999999999997 76-77 25.687500000000004 24.0125 22.5875 27.712500000000002 78-79 25.674999999999997 23.2625 23.7875 27.275 80-81 26.4625 23.1875 23.825 26.525 82-83 26.5 23.962500000000002 22.7 26.8375 84-85 26.5375 23.674999999999997 23.1875 26.6 86-87 26.775 23.3875 23.95 25.887500000000003 88-89 27.275 22.475 23.7375 26.5125 90-91 26.3125 23.075000000000003 23.425 27.187499999999996 92-93 26.178272284035504 23.865483185398176 23.39042380297537 26.56582072759095 94-95 27.55 22.7625 22.8375 26.85 96-97 27.275 23.2625 22.575 26.887499999999996 98-99 26.5375 23.45 24.2 25.8125 100 27.900000000000002 23.65 21.725 26.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 2.5 29 4.0 30 5.0 31 5.0 32 7.0 33 11.0 34 16.0 35 30.5 36 43.0 37 43.5 38 55.0 39 77.0 40 92.0 41 104.5 42 130.0 43 135.5 44 134.5 45 149.0 46 157.0 47 157.0 48 156.5 49 144.0 50 128.5 51 121.0 52 110.0 53 103.0 54 99.0 55 93.5 56 92.5 57 96.5 58 98.5 59 102.0 60 107.5 61 110.5 62 102.5 63 114.5 64 109.0 65 92.5 66 89.5 67 77.5 68 80.5 69 76.5 70 66.5 71 54.5 72 39.5 73 38.0 74 38.0 75 27.5 76 16.5 77 13.0 78 12.5 79 9.5 80 5.0 81 5.5 82 4.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 11.275 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618240 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618240_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.145 34.0 31.0 34.0 31.0 34.0 2 32.9075 34.0 31.0 34.0 31.0 34.0 3 33.01375 34.0 31.0 34.0 31.0 34.0 4 36.50275 37.0 37.0 37.0 35.0 37.0 5 36.526 37.0 37.0 37.0 35.0 37.0 6 36.49725 37.0 37.0 37.0 35.0 37.0 7 36.478 37.0 37.0 37.0 35.0 37.0 8 36.53025 37.0 37.0 37.0 35.0 37.0 9 38.38225 39.0 39.0 39.0 37.0 39.0 10-11 38.30925 39.0 39.0 39.0 37.0 39.0 12-13 38.278875 39.0 39.0 39.0 37.0 39.0 14-15 39.86 41.0 40.0 41.0 38.0 41.0 16-17 39.763000000000005 41.0 40.0 41.0 37.5 41.0 18-19 39.783375 41.0 40.0 41.0 38.0 41.0 20-21 39.729124999999996 41.0 40.0 41.0 37.0 41.0 22-23 39.718374999999995 41.0 40.0 41.0 37.0 41.0 24-25 39.64125 41.0 40.0 41.0 37.0 41.0 26-27 39.456625 41.0 39.0 41.0 36.5 41.0 28-29 39.2975 40.0 39.0 41.0 36.0 41.0 30-31 39.22025 40.0 39.0 41.0 35.5 41.0 32-33 39.158874999999995 40.0 39.0 41.0 35.0 41.0 34-35 39.075625 40.0 38.0 41.0 35.0 41.0 36-37 38.870875 40.0 38.0 41.0 35.0 41.0 38-39 38.645875000000004 40.0 38.0 41.0 35.0 41.0 40-41 38.42825 40.0 37.0 41.0 34.0 41.0 42-43 38.19775 40.0 36.5 41.0 34.0 41.0 44-45 37.7975 39.5 35.5 41.0 33.0 41.0 46-47 37.633875 39.0 35.0 41.0 33.0 41.0 48-49 37.521249999999995 39.0 35.0 41.0 33.0 41.0 50-51 37.083124999999995 38.5 35.0 40.5 32.5 40.5 52-53 37.11575 38.5 35.0 40.0 33.0 41.0 54-55 37.330124999999995 38.0 35.0 41.0 33.0 41.0 56-57 37.189875 38.0 35.0 41.0 33.0 41.0 58-59 36.887 37.0 35.0 40.0 33.0 41.0 60-61 36.588625 36.5 35.0 40.0 33.0 41.0 62-63 36.260625000000005 36.0 35.0 40.0 32.5 41.0 64-65 35.805499999999995 35.0 35.0 39.0 31.5 41.0 66-67 35.636250000000004 35.0 35.0 39.0 31.0 41.0 68-69 35.407624999999996 35.0 34.0 38.5 31.0 40.5 70-71 35.131375 35.0 34.0 37.0 31.0 40.0 72-73 34.698 35.0 34.0 37.0 30.5 39.0 74-75 34.356 35.0 34.0 36.0 30.5 39.0 76-77 34.063500000000005 35.0 33.5 36.0 29.5 37.5 78-79 33.83 35.0 33.0 35.0 30.0 37.0 80-81 33.6255 35.0 33.0 35.0 29.0 37.0 82-83 33.440375 35.0 33.0 35.0 29.0 36.0 84-85 33.221625 35.0 33.0 35.0 29.0 36.0 86-87 33.06725 35.0 33.0 35.0 29.0 36.0 88-89 32.73925 35.0 32.5 35.0 28.0 35.0 90-91 32.437125 35.0 32.5 35.0 27.0 35.0 92-93 32.214 35.0 32.0 35.0 27.0 35.0 94-95 31.896625 34.5 32.0 35.0 25.0 35.0 96-97 31.529125 34.0 32.0 35.0 25.0 35.0 98-99 30.9745 34.0 31.0 35.0 23.5 35.0 100 30.5215 34.0 31.0 35.0 22.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.19461444308445408 1101 2 0.040850673194611886 1101 3 0.04477764177886456 1101 4 0.0031619747041986557 1101 5 0.07736638106895555 1101 6 -0.01815585475316084 1101 7 -0.02330681354548858 1101 8 1.5299877600938316E-4 1101 9 0.08879028967768221 1101 10-11 -0.04500713994288219 1101 12-13 -0.037025703794363096 1101 14-15 0.06000101999184437 1101 16-17 -0.03539371685025827 1101 18-19 0.0014024887800871966 1101 20-21 -0.0823643410852739 1101 22-23 0.005074459404319498 1101 24-25 0.09470624235006397 1101 26-27 -0.07983986128110843 1101 28-29 0.015299877600973844 1101 30-31 -0.04796511627907307 1101 32-33 -0.08093635250917686 1101 34-35 0.025754793961645817 1101 36-37 0.10398816809465217 1101 38-39 0.22615769073847503 1101 40-41 0.18602101183190456 1101 42-43 0.07226642186861909 1101 44-45 0.16625866993063454 1101 46-47 0.13749490004079945 1101 48-49 -0.011398408812723915 1101 50-51 0.2854702162382736 1101 52-53 0.1588892288861672 1101 54-55 0.19655242758058478 1101 56-57 0.17997756017951616 1101 58-59 0.12946246430028907 1101 60-61 0.04796511627907307 1101 62-63 0.1074561403508767 1101 64-65 0.03350673194614728 1101 66-67 0.09613423092615392 1101 68-69 0.0726999184006516 1101 70-71 -0.13129844961240167 1101 72-73 -0.06206650346796749 1101 74-75 0.08733680130558952 1101 76-77 -0.08988678090575064 1101 78-79 -0.16355569155447114 1101 80-81 0.05515605875152829 1101 82-83 -0.21537127702978864 1101 84-85 0.25446246430028907 1101 86-87 0.1295899632802957 1101 88-89 0.13976438188494456 1101 90-91 0.12280701754385603 1101 92-93 7.904936760496639E-4 1101 94-95 0.05306507547939532 1101 96-97 -0.19058547531619752 1101 98-99 -0.4622858017135876 1101 100 0.015962872297023978 1104 1 0.19461444308445408 1104 2 -0.04085067319461899 1104 3 -0.04477764177886456 1104 4 -0.003161974704205761 1104 5 -0.07736638106894844 1104 6 0.01815585475316084 1104 7 0.023306813545495686 1104 8 -1.5299877600938316E-4 1104 9 -0.08879028967768221 1104 10-11 0.04500713994288219 1104 12-13 0.0370257037943702 1104 14-15 -0.06000101999183727 1104 16-17 0.03539371685026538 1104 18-19 -0.0014024887800871966 1104 20-21 0.0823643410852739 1104 22-23 -0.005074459404326603 1104 24-25 -0.09470624235006397 1104 26-27 0.07983986128110843 1104 28-29 -0.015299877600980949 1104 30-31 0.04796511627907307 1104 32-33 0.08093635250917686 1104 34-35 -0.025754793961645817 1104 36-37 -0.10398816809465927 1104 38-39 -0.22615769073847503 1104 40-41 -0.18602101183190456 1104 42-43 -0.0722664218686262 1104 44-45 -0.16625866993064164 1104 46-47 -0.13749490004080656 1104 48-49 0.01139840881273102 1104 50-51 -0.2854702162382736 1104 52-53 -0.1588892288861743 1104 54-55 -0.19655242758057767 1104 56-57 -0.17997756017951616 1104 58-59 -0.12946246430028197 1104 60-61 -0.04796511627906597 1104 62-63 -0.1074561403508767 1104 64-65 -0.03350673194614728 1104 66-67 -0.09613423092615392 1104 68-69 -0.0726999184006516 1104 70-71 0.13129844961240877 1104 72-73 0.06206650346796749 1104 74-75 -0.08733680130558952 1104 76-77 0.08988678090575064 1104 78-79 0.16355569155446403 1104 80-81 -0.05515605875152829 1104 82-83 0.21537127702978154 1104 84-85 -0.25446246430028907 1104 86-87 -0.1295899632802957 1104 88-89 -0.13976438188494456 1104 90-91 -0.12280701754386314 1104 92-93 -7.904936760496639E-4 1104 94-95 -0.05306507547939532 1104 96-97 0.19058547531619752 1104 98-99 0.4622858017135876 1104 100 -0.015962872297020425 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 16.0 28 37.0 29 55.0 30 53.0 31 106.0 32 121.0 33 196.0 34 292.0 35 466.0 36 732.0 37 886.0 38 899.0 39 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.825 8.175 15.925 49.075 2 26.450000000000003 17.724999999999998 30.8 25.025 3 26.724999999999998 21.75 22.650000000000002 28.875 4 29.475 27.150000000000002 16.025 27.35 5 30.3 30.075000000000003 18.224999999999998 21.4 6 22.5 31.225 20.325 25.95 7 20.875 14.7 38.275 26.150000000000002 8 22.225 18.6 24.5 34.675 9 23.275000000000002 18.025 28.7 30.0 10-11 26.095118898623284 26.495619524405505 19.336670838548184 28.07259073842303 12-13 24.493623405851466 21.43035758939735 26.60665166291573 27.46936734183546 14-15 26.450000000000003 22.2625 24.6125 26.674999999999997 16-17 26.387500000000003 23.175 22.112499999999997 28.325 18-19 26.187500000000004 23.4875 23.6625 26.6625 20-21 26.474999999999998 23.5 23.150000000000002 26.875 22-23 26.5875 24.1625 22.1 27.150000000000002 24-25 25.9625 23.6125 22.5625 27.8625 26-27 26.137500000000003 24.125 22.55 27.187499999999996 28-29 26.787499999999998 23.4125 22.5 27.3 30-31 26.2125 23.549999999999997 23.549999999999997 26.687499999999996 32-33 25.75 23.7375 23.5125 27.0 34-35 26.8 22.537499999999998 23.4875 27.175 36-37 25.8625 23.3375 22.9375 27.8625 38-39 25.637500000000003 23.6125 23.2125 27.537499999999998 40-41 25.825 23.6375 23.1125 27.425 42-43 25.637500000000003 24.025 23.7625 26.575 44-45 26.400000000000002 23.849999999999998 23.0 26.75 46-47 26.8 23.3875 22.6 27.212500000000002 48-49 26.237500000000004 24.0375 23.4625 26.2625 50-51 26.150000000000002 23.0375 23.425 27.3875 52-53 26.025 23.0875 23.4125 27.474999999999998 54-55 25.4875 23.4125 23.6875 27.4125 56-57 26.737499999999997 24.025 22.15 27.0875 58-59 27.0 23.525 22.2 27.275 60-61 26.087500000000002 23.9 24.1375 25.874999999999996 62-63 26.3125 23.7 23.599999999999998 26.387500000000003 64-65 26.3 23.075000000000003 23.8125 26.8125 66-67 26.0625 23.3125 23.425 27.200000000000003 68-69 26.4125 23.1875 23.2625 27.1375 70-71 26.9125 22.662499999999998 23.75 26.674999999999997 72-73 26.450000000000003 23.200000000000003 23.3625 26.987499999999997 74-75 26.087500000000002 24.275 23.474999999999998 26.1625 76-77 27.750000000000004 23.724999999999998 22.5625 25.9625 78-79 25.6125 23.65 24.462500000000002 26.275 80-81 26.375 23.549999999999997 23.9875 26.087500000000002 82-83 26.525 22.8625 23.400000000000002 27.212500000000002 84-85 25.4 23.4375 24.1375 27.025 86-87 26.625 23.7375 23.9125 25.724999999999998 88-89 27.474999999999998 22.025 22.875 27.625 90-91 26.7625 22.8125 23.6875 26.737499999999997 92-93 27.3625 23.3125 23.05 26.275 94-95 27.8125 22.175 22.975 27.037499999999998 96-97 27.0125 23.3875 22.9875 26.6125 98-99 26.950000000000003 23.200000000000003 23.1875 26.6625 100 26.05 24.275 23.25 26.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 1.5 29 1.5 30 2.5 31 3.5 32 6.5 33 10.0 34 22.5 35 32.0 36 30.0 37 38.5 38 55.5 39 70.5 40 94.5 41 112.0 42 129.0 43 142.0 44 134.5 45 145.0 46 155.0 47 142.5 48 137.5 49 139.0 50 124.0 51 126.0 52 125.5 53 102.5 54 96.5 55 93.5 56 90.5 57 102.5 58 105.0 59 109.5 60 127.0 61 120.0 62 102.5 63 88.5 64 89.5 65 90.5 66 86.0 67 80.0 68 76.5 69 73.5 70 60.5 71 62.5 72 59.5 73 48.5 74 41.5 75 33.5 76 24.0 77 17.0 78 14.5 79 10.0 80 5.5 81 2.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.125 12-13 0.025 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra Read 559267 spots for SRR8618240.sra Written 559267 spots for SRR8618240.sra Read 559249 spots for SRR8618240.sra Written 559249 spots for SRR8618240.sra SRR ids: ['SRR8618240.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e34k_u7u SRR8618240.sra spots: 11184998 blocks: [[1, 559249], [559250, 1118498], [1118499, 1677747], [1677748, 2236996], [2236997, 2796245], [2796246, 3355494], [3355495, 3914743], [3914744, 4473992], [4473993, 5033241], [5033242, 5592490], [5592491, 6151739], [6151740, 6710988], [6710989, 7270237], [7270238, 7829486], [7829487, 8388735], [8388736, 8947984], [8947985, 9507233], [9507234, 10066482], [10066483, 10625731], [10625732, 11184998]] SRR8618240 file size 2910825 SRR8618240 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618240 SRR8618240_1.fastq SRR8618240_2.fastq Input file: SRR8618240_1.fastq Paired file: SRR8618240_2.fastq trimmed: SRR8618240-trimmed-pair1.fastq, SRR8618240-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:29:15 2024 >> started Sat Dec 7 09:29:25 2024 >> done (10.059s) 11184998 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11184998 (100.00%) read pairs available; of these: 1455591 (13.01%) trimmed read pairs available after processing 9729407 (86.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 79 1 0.00% 80 0 0.00% 81 9 0.00% 82 31 0.00% 83 93 0.00% 84 4913 0.04% 85 5298 0.05% 86 5620 0.05% 87 6369 0.06% 88 7679 0.07% 89 9817 0.09% 90 16504 0.15% 91 31174 0.28% 92 45863 0.41% 93 64237 0.57% 94 87815 0.79% 95 112190 1.00% 96 149409 1.34% 97 210585 1.88% 98 298051 2.66% 99 399933 3.58% 100 9729407 86.99% 11184998 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=26 prefix-density=0.46 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=34 fanout-score=44.60 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=9.4 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=11 prefix-density=0.41 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=34 fanout-score=45.94 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=9.8 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618240 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:29:54 Started mapping on | Dec 07 09:29:54 Finished on | Dec 07 09:30:28 Mapping speed, Million of reads per hour | 1184.29 Number of input reads | 11184998 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10927831 Uniquely mapped reads % | 97.70% Average mapped length | 198.21 Number of splices: Total | 6883761 Number of splices: Annotated (sjdb) | 6557367 Number of splices: GT/AG | 6786653 Number of splices: GC/AG | 78398 Number of splices: AT/AC | 2223 Number of splices: Non-canonical | 16487 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 109521 % of reads mapped to multiple loci | 0.98% Number of reads mapped to too many loci | 5093 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 147646 147646 147646 N_multimapping 109521 109521 109521 N_noFeature 243068 5463699 5509848 N_ambiguous 236846 19988 20797 UnstrandedReadsAssigned:10447917 PositiveStrandReadsAssigned:5444144 NegativeStrandReadsAssigned:5397186 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618240 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618240-trimmed-pair1.fastq SRR8618240-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,184,998 reads, 10,644,895 reads pseudoaligned [quant] estimated average fragment length: 167.544 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR8618240.ke.tsv 35125 SRR8618240.se.tsv 88098 total ==> SRR8618240.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.655 30.2906 5.16913 PNS24247 1044 877.456 0 0 PNS24249 1928 1761.46 70.4961 5.25653 PNS24246 1044 877.456 0 0 PNS24248 1044 877.456 0 0 PNS24244 1471 1304.46 42.2133 4.25036 PNS24243 293 134.2 1 0.978707 KQK14069 1603 1436.46 4405.1 402.781 KQK14071 474 308.95 394.584 167.748 ==> SRR8618240.se.tsv <== BRADI_1g14170v3 5163 BRADI_1g53295v3 165 BRADI_1g59795v3 165 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 239 BRADI_1g74790v3 26 BRADI_1g09890v3 0 BRADI_1g77505v3 154 BRADI_1g48960v3 0 SRR8618240 completed mapping pipeline successfully