Starting /dee2/code/volunteer_pipeline.sh SRR8618241 current disk space = 1544192974848 free memory = 1600105080 SRR8618241 SRAfilesize b7e41710b0f2a42c2a2158f63603023e SRR8618241.sra SRR8618241.sra file validated SRR8618241 is paired end SRR8618241 is conventional basespace SRR8618241 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618241_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98475 34.0 31.0 34.0 31.0 34.0 2 33.13775 34.0 33.0 34.0 31.0 34.0 3 33.2115 34.0 34.0 34.0 31.0 34.0 4 32.81 37.0 37.0 37.0 2.0 37.0 5 34.60225 37.0 35.0 37.0 19.0 37.0 6 35.90575 37.0 36.0 37.0 32.0 37.0 7 36.26825 37.0 35.0 37.0 35.0 37.0 8 36.3975 37.0 37.0 37.0 35.0 37.0 9 38.31025 39.0 39.0 39.0 37.0 39.0 10-11 38.3515 39.0 39.0 39.0 37.0 39.0 12-13 38.3575 39.0 39.0 39.0 37.0 39.0 14-15 39.869625 41.0 40.0 41.0 38.0 41.0 16-17 39.7155 41.0 40.0 41.0 37.5 41.0 18-19 39.74575 41.0 40.0 41.0 38.0 41.0 20-21 39.652625 41.0 40.0 41.0 37.0 41.0 22-23 39.582625 41.0 39.5 41.0 37.0 41.0 24-25 39.449125 40.5 39.0 41.0 36.5 41.0 26-27 39.251875 40.0 39.0 41.0 36.0 41.0 28-29 39.11125 40.0 38.0 41.0 35.5 41.0 30-31 38.68625 40.0 38.0 41.0 34.5 41.0 32-33 38.684 40.0 38.0 41.0 34.5 41.0 34-35 39.003125 40.0 38.0 41.0 35.0 41.0 36-37 38.98675 40.0 38.0 41.0 35.0 41.0 38-39 38.8525 40.0 38.0 41.0 35.0 41.0 40-41 38.739625000000004 40.0 37.5 41.0 35.0 41.0 42-43 38.48525 40.0 37.0 41.0 34.0 41.0 44-45 38.249125 40.0 36.5 41.0 34.5 41.0 46-47 38.06175 39.5 35.5 41.0 34.0 41.0 48-49 37.827 39.0 35.0 41.0 33.5 41.0 50-51 37.498374999999996 39.0 35.0 41.0 33.0 41.0 52-53 37.213 38.0 35.0 41.0 33.0 41.0 54-55 36.967749999999995 37.5 35.0 40.0 33.0 41.0 56-57 36.711749999999995 37.0 35.0 40.0 33.0 41.0 58-59 36.478375 36.5 35.0 40.0 32.5 41.0 60-61 36.177375 36.0 35.0 40.0 32.0 41.0 62-63 35.87625 35.0 35.0 39.0 31.5 41.0 64-65 35.55800000000001 35.0 34.0 39.0 31.0 41.0 66-67 35.370625 35.0 34.0 38.5 31.0 40.5 68-69 35.002624999999995 35.0 34.0 37.0 30.5 40.0 70-71 34.47475 35.0 33.5 37.0 29.5 39.5 72-73 34.260875 35.0 33.0 36.0 29.5 39.0 74-75 34.004125 35.0 33.0 36.0 29.5 38.5 76-77 33.1665 34.0 32.0 35.0 28.0 37.0 78-79 33.681875000000005 35.0 33.0 35.0 29.0 37.0 80-81 33.585125 35.0 33.0 35.0 29.0 36.5 82-83 33.356625 35.0 33.0 35.0 29.0 36.0 84-85 33.21575 35.0 33.0 35.0 29.0 36.0 86-87 32.936 35.0 33.0 35.0 29.0 35.5 88-89 32.634249999999994 35.0 33.0 35.0 27.0 35.0 90-91 32.329375 34.5 32.0 35.0 27.0 35.0 92-93 32.046875 34.0 32.0 35.0 27.0 35.0 94-95 31.850875000000002 34.0 32.0 35.0 25.0 35.0 96-97 31.415625 34.0 31.0 35.0 24.5 35.0 98-99 31.000999999999998 34.0 31.0 35.0 23.5 35.0 100 30.35425 34.0 31.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.004531887510609067 1101 2 0.022495139516415463 1101 3 0.05172649853501099 1101 4 -2.575823543908651 1101 5 -1.3824995207973956 1101 6 -0.4142090418686166 1101 7 -0.04086913661382141 1101 8 -0.06869027081793178 1101 9 0.08635230975657038 1101 10-11 0.01950354609928695 1101 12-13 0.06550699635806012 1101 14-15 0.02683534598428139 1101 16-17 0.021742106848492426 1101 18-19 0.04161532353021613 1101 20-21 -0.0921643528026479 1101 22-23 -0.03926723075659311 1101 24-25 -0.08894000383362055 1101 26-27 -0.042717489525998076 1101 28-29 0.10009857882198503 1101 30-31 -0.11927352884799802 1101 32-33 -0.035002327555517354 1101 34-35 0.18045401024124175 1101 36-37 0.14282291409951142 1101 38-39 0.08171773597305787 1101 40-41 0.09785317232125834 1101 42-43 0.10793011856841872 1101 44-45 0.3671102713655898 1101 46-47 0.43330868862783944 1101 48-49 0.3721282072345886 1101 50-51 0.22664229579122974 1101 52-53 0.10845039568444292 1101 54-55 0.24463977655467062 1101 56-57 0.2036405706618467 1101 58-59 0.3080588186971127 1101 60-61 0.0805608039650636 1101 62-63 0.18785426764150515 1101 64-65 0.3914263807880829 1101 66-67 0.17794846518251006 1101 68-69 -0.1984857197623171 1101 70-71 -0.008119061310551956 1101 72-73 -0.16127906021522875 1101 74-75 -0.12833045811769495 1101 76-77 -0.1462731728689164 1101 78-79 0.09119225608586845 1101 80-81 -0.05068594430296969 1101 82-83 0.003977381636957489 1101 84-85 0.018777896437470076 1101 86-87 -0.21910512336044263 1101 88-89 -0.30521098606205044 1101 90-91 -0.42534707960240326 1101 92-93 -0.29335414441797525 1101 94-95 -0.08581149538596833 1101 96-97 -0.36084640871874996 1101 98-99 -0.05046688025411328 1101 100 0.21803718612229517 1103 1 0.004531887510609067 1103 2 -0.022495139516415463 1103 3 -0.05172649853501099 1103 4 2.5758235439086477 1103 5 1.3824995207973885 1103 6 0.4142090418686166 1103 7 0.040869136613814305 1103 8 0.06869027081793178 1103 9 -0.08635230975656327 1103 10-11 -0.019503546099294056 1103 12-13 -0.06550699635806012 1103 14-15 -0.02683534598428139 1103 16-17 -0.021742106848492426 1103 18-19 -0.041615323530223236 1103 20-21 0.092164352802655 1103 22-23 0.039267230756586 1103 24-25 0.08894000383362055 1103 26-27 0.042717489525998076 1103 28-29 -0.10009857882197792 1103 30-31 0.11927352884799802 1103 32-33 0.035002327555517354 1103 34-35 -0.18045401024124175 1103 36-37 -0.14282291409951142 1103 38-39 -0.08171773597305076 1103 40-41 -0.09785317232125834 1103 42-43 -0.10793011856841161 1103 44-45 -0.3671102713655898 1103 46-47 -0.43330868862783234 1103 48-49 -0.3721282072345886 1103 50-51 -0.22664229579122974 1103 52-53 -0.10845039568444292 1103 54-55 -0.2446397765546635 1103 56-57 -0.20364057066185381 1103 58-59 -0.3080588186971198 1103 60-61 -0.0805608039650636 1103 62-63 -0.18785426764150515 1103 64-65 -0.3914263807880829 1103 66-67 -0.17794846518250296 1103 68-69 0.1984857197623171 1103 70-71 0.008119061310551956 1103 72-73 0.16127906021522875 1103 74-75 0.12833045811768784 1103 76-77 0.1462731728689164 1103 78-79 -0.09119225608587556 1103 80-81 0.05068594430296258 1103 82-83 -0.003977381636957489 1103 84-85 -0.018777896437470076 1103 86-87 0.21910512336043553 1103 88-89 0.30521098606205044 1103 90-91 0.42534707960239615 1103 92-93 0.29335414441797525 1103 94-95 0.08581149538596833 1103 96-97 0.36084640871874996 1103 98-99 0.05046688025411328 1103 100 -0.21803718612229162 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 16.0 28 31.0 29 58.0 30 89.0 31 124.0 32 130.0 33 208.0 34 294.0 35 530.0 36 715.0 37 915.0 38 772.0 39 118.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.15 10.45 13.600000000000001 46.800000000000004 2 26.0 18.175 30.599999999999998 25.224999999999998 3 27.700000000000003 22.225 22.3 27.775 4 28.972487366647954 27.484559236384055 16.704098820887143 26.838854576080855 5 29.825000000000003 28.999999999999996 18.425 22.75 6 23.3 33.25 18.725 24.725 7 20.575 14.774999999999999 37.775 26.875 8 24.025 18.3 24.575 33.1 9 23.400000000000002 18.875 27.125 30.599999999999998 10-11 27.1125 27.0125 18.4125 27.462500000000002 12-13 24.4125 21.212500000000002 25.45 28.925 14-15 26.137500000000003 22.6125 23.3625 27.8875 16-17 26.4625 23.0 22.6125 27.925 18-19 26.700000000000003 22.725 23.3875 27.187499999999996 20-21 25.912499999999998 23.8875 22.7625 27.437499999999996 22-23 26.637499999999996 22.625 22.8875 27.85 24-25 26.0625 23.1 23.150000000000002 27.6875 26-27 26.437500000000004 23.7875 22.25 27.525 28-29 26.5 22.575 22.625 28.299999999999997 30-31 26.487500000000004 22.7125 22.412499999999998 28.3875 32-33 26.687499999999996 23.3 22.3125 27.700000000000003 34-35 27.037499999999998 23.75 21.525 27.6875 36-37 25.674999999999997 23.3 22.925 28.1 38-39 27.075 23.8125 22.8375 26.275 40-41 26.75 23.925 22.425 26.900000000000002 42-43 26.8125 23.05 23.200000000000003 26.937499999999996 44-45 27.1375 22.4875 22.9875 27.3875 46-47 26.087500000000002 23.125 22.175 28.6125 48-49 27.037499999999998 23.4125 21.5 28.050000000000004 50-51 26.137500000000003 23.425 23.075000000000003 27.3625 52-53 26.75 22.3375 23.0375 27.875 54-55 25.900000000000002 24.1625 23.0 26.937499999999996 56-57 26.35 23.3375 23.025000000000002 27.287499999999998 58-59 26.987499999999997 22.3 22.8125 27.900000000000002 60-61 26.6625 22.35 23.0875 27.900000000000002 62-63 27.5625 22.85 23.3 26.2875 64-65 26.575 22.6375 22.95 27.8375 66-67 25.5 23.3125 22.7 28.487499999999997 68-69 27.8375 22.7125 22.5875 26.8625 70-71 26.687499999999996 22.2125 23.400000000000002 27.700000000000003 72-73 25.912499999999998 23.2625 23.1875 27.6375 74-75 27.275 23.075000000000003 22.875 26.775 76-77 27.1 21.55 22.675 28.675 78-79 26.950000000000003 22.8 23.1 27.150000000000002 80-81 27.737499999999997 22.5875 23.175 26.5 82-83 27.5125 22.3875 22.8625 27.237499999999997 84-85 27.500000000000004 22.15 23.150000000000002 27.200000000000003 86-87 27.325 22.9875 22.575 27.1125 88-89 27.8625 21.8125 22.112499999999997 28.212500000000002 90-91 27.500000000000004 22.3875 23.400000000000002 26.7125 92-93 27.678459807475935 22.840355044380548 22.82785348168521 26.653331666458307 94-95 28.4125 22.775000000000002 21.9375 26.875 96-97 27.762500000000003 22.575 22.1875 27.474999999999998 98-99 27.900000000000002 22.35 22.2625 27.487499999999997 100 28.175 22.175 22.7 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 2.0 29 1.0 30 1.5 31 3.5 32 6.0 33 11.5 34 14.0 35 16.5 36 27.5 37 37.0 38 49.0 39 59.5 40 70.0 41 90.5 42 125.5 43 137.5 44 129.0 45 144.0 46 158.5 47 148.5 48 129.5 49 130.0 50 129.5 51 114.5 52 103.0 53 96.0 54 94.0 55 96.5 56 100.0 57 103.5 58 115.5 59 118.5 60 117.0 61 123.5 62 105.5 63 102.0 64 109.5 65 96.0 66 94.5 67 95.5 68 85.5 69 80.5 70 76.5 71 68.5 72 58.0 73 52.0 74 46.0 75 37.0 76 26.0 77 16.5 78 16.0 79 12.0 80 8.0 81 4.5 82 1.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 10.95 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09136799596163 98.15 2 0.8581524482584554 1.7000000000000002 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618241 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618241_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1705 33.0 31.0 34.0 31.0 34.0 2 32.78825 34.0 31.0 34.0 31.0 34.0 3 32.94875 34.0 31.0 34.0 31.0 34.0 4 36.42375 37.0 37.0 37.0 35.0 37.0 5 36.41375 37.0 37.0 37.0 35.0 37.0 6 36.42225 37.0 37.0 37.0 35.0 37.0 7 36.37625 37.0 37.0 37.0 35.0 37.0 8 36.37725 37.0 37.0 37.0 35.0 37.0 9 38.221 39.0 39.0 39.0 37.0 39.0 10-11 38.254374999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.222375 39.0 39.0 39.0 37.0 39.0 14-15 39.738375000000005 41.0 40.0 41.0 37.5 41.0 16-17 39.632875 41.0 39.5 41.0 37.0 41.0 18-19 39.640125 41.0 40.0 41.0 37.0 41.0 20-21 39.64925 41.0 39.5 41.0 37.0 41.0 22-23 39.6165 41.0 39.5 41.0 37.0 41.0 24-25 39.526624999999996 41.0 39.0 41.0 36.5 41.0 26-27 39.3685 41.0 39.0 41.0 36.0 41.0 28-29 39.228625 40.0 39.0 41.0 36.0 41.0 30-31 39.0415 40.0 38.0 41.0 35.0 41.0 32-33 39.05325 40.0 38.0 41.0 35.0 41.0 34-35 38.93925 40.0 38.0 41.0 35.0 41.0 36-37 38.712 40.0 38.0 41.0 35.0 41.0 38-39 38.595124999999996 40.0 37.5 41.0 34.5 41.0 40-41 38.285875000000004 40.0 37.0 41.0 34.0 41.0 42-43 37.919124999999994 39.5 36.0 41.0 33.0 41.0 44-45 37.668 39.0 35.0 41.0 33.0 41.0 46-47 37.303125 39.0 35.0 41.0 32.5 41.0 48-49 37.171499999999995 38.5 35.0 41.0 32.5 41.0 50-51 36.821875 38.0 34.5 40.0 32.0 40.5 52-53 36.842 38.0 35.0 40.0 32.5 41.0 54-55 37.031875 37.5 35.0 41.0 33.0 41.0 56-57 36.869249999999994 37.0 35.0 40.5 33.0 41.0 58-59 36.61 36.5 35.0 40.0 33.0 41.0 60-61 36.297375 36.0 35.0 40.0 32.5 41.0 62-63 36.031625000000005 35.0 35.0 39.0 32.0 41.0 64-65 35.750375000000005 35.0 35.0 39.0 31.5 41.0 66-67 35.542 35.0 35.0 38.5 31.5 41.0 68-69 35.16725 35.0 34.0 37.0 31.0 40.0 70-71 34.924625000000006 35.0 34.0 37.0 31.0 39.5 72-73 34.51175 35.0 34.0 36.0 30.0 39.0 74-75 34.263000000000005 35.0 34.0 36.0 30.0 39.0 76-77 34.030125 35.0 33.5 35.5 30.0 37.0 78-79 33.769875 35.0 33.0 35.0 29.5 37.0 80-81 33.47625 35.0 33.0 35.0 29.0 36.5 82-83 33.337 35.0 33.0 35.0 29.0 36.0 84-85 33.16575 35.0 33.0 35.0 29.0 36.0 86-87 32.8675 35.0 33.0 35.0 28.0 35.5 88-89 32.45575 35.0 32.5 35.0 27.0 35.0 90-91 32.204875 34.0 32.0 35.0 27.0 35.0 92-93 31.947875 34.0 31.5 35.0 25.0 35.0 94-95 31.744625 34.0 31.5 35.0 25.0 35.0 96-97 31.446625 34.0 31.0 35.0 24.0 35.0 98-99 30.94075 34.0 31.0 35.0 24.0 35.0 100 30.43525 34.0 31.0 35.0 22.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.10869684273939839 1101 2 0.09299268873736821 1101 3 0.0425121169801983 1101 4 0.04828993126865555 1101 5 0.1568361674744665 1101 6 0.011843150141018555 1101 7 0.047386292067145064 1101 8 -0.04512719406336885 1101 9 0.016854240258496134 1101 10-11 -0.0011090117473102623 1101 12-13 0.061810290533699686 1101 14-15 0.26473890303677194 1101 16-17 -0.043381527424074307 1101 18-19 0.21236890385826257 1101 20-21 0.11504285440455675 1101 22-23 0.1088748322790849 1101 24-25 0.10886114077603537 1101 26-27 0.024220268901125053 1101 28-29 0.09997535529450374 1101 30-31 0.20165530271913212 1101 32-33 0.18582792518962776 1101 34-35 0.011110654727673364 1101 36-37 -0.021461431035895373 1101 38-39 -0.016197048111941115 1101 40-41 -0.11742517593581425 1101 42-43 -0.07953394123607183 1101 44-45 0.024220268901125053 1101 46-47 -0.10313124674826923 1101 48-49 -0.22335633505846175 1101 50-51 0.017511432405044047 1101 52-53 -0.04945370902817814 1101 54-55 0.03323612366165918 1101 56-57 0.2463580601878519 1101 58-59 0.16919274897998093 1101 60-61 0.03379062953531076 1101 62-63 0.06402146827678479 1101 64-65 0.06672554012979504 1101 66-67 0.12957638489553602 1101 68-69 0.3198266655713482 1101 70-71 -0.06563706563706972 1101 72-73 0.25387469536405405 1101 74-75 0.13549111421451698 1101 76-77 -0.19867740080506024 1101 78-79 -0.17691475670198997 1101 80-81 0.20084065828746844 1101 82-83 -0.0758851556723883 1101 84-85 -0.20215504258057848 1101 86-87 -0.33750239601303633 1101 88-89 -0.005572441742657475 1101 90-91 0.03888386867109972 1101 92-93 -0.15250280675812178 1101 94-95 0.05080232207891555 1101 96-97 0.039664284345136025 1101 98-99 -0.2226786056573289 1101 100 -0.19363892768148006 1103 1 -0.10869684273939129 1103 2 -0.09299268873737532 1103 3 -0.042512116980205406 1103 4 -0.048289931268648445 1103 5 -0.1568361674744665 1103 6 -0.01184315014102566 1103 7 -0.047386292067145064 1103 8 0.04512719406336174 1103 9 -0.016854240258496134 1103 10-11 0.0011090117473102623 1103 12-13 -0.06181029053369258 1103 14-15 -0.26473890303677905 1103 16-17 0.04338152742408141 1103 18-19 -0.21236890385826257 1103 20-21 -0.11504285440455675 1103 22-23 -0.108874832279092 1103 24-25 -0.10886114077603537 1103 26-27 -0.024220268901125053 1103 28-29 -0.09997535529450374 1103 30-31 -0.20165530271913212 1103 32-33 -0.18582792518962776 1103 34-35 -0.011110654727680469 1103 36-37 0.021461431035895373 1103 38-39 0.016197048111941115 1103 40-41 0.11742517593581425 1103 42-43 0.07953394123607183 1103 44-45 -0.024220268901117947 1103 46-47 0.10313124674826923 1103 48-49 0.22335633505846175 1103 50-51 -0.017511432405044047 1103 52-53 0.04945370902817103 1103 54-55 -0.03323612366165207 1103 56-57 -0.2463580601878519 1103 58-59 -0.16919274897998093 1103 60-61 -0.03379062953531786 1103 62-63 -0.06402146827678479 1103 64-65 -0.06672554012979504 1103 66-67 -0.12957638489553602 1103 68-69 -0.3198266655713411 1103 70-71 0.06563706563706262 1103 72-73 -0.25387469536405405 1103 74-75 -0.13549111421451698 1103 76-77 0.19867740080506024 1103 78-79 0.17691475670198997 1103 80-81 -0.20084065828746844 1103 82-83 0.0758851556723883 1103 84-85 0.20215504258057138 1103 86-87 0.33750239601303633 1103 88-89 0.005572441742650369 1103 90-91 -0.038883868671106825 1103 92-93 0.15250280675812888 1103 94-95 -0.05080232207891555 1103 96-97 -0.03966428434513247 1103 98-99 0.2226786056573289 1103 100 0.1936389276814836 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 16.0 28 28.0 29 63.0 30 77.0 31 97.0 32 162.0 33 212.0 34 296.0 35 508.0 36 743.0 37 885.0 38 785.0 39 126.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.925 8.75 13.8 47.525 2 27.375 17.775 28.775000000000002 26.075 3 28.449999999999996 22.475 21.224999999999998 27.85 4 29.275000000000002 26.924999999999997 16.225 27.575 5 30.55 28.199999999999996 18.725 22.525000000000002 6 23.474999999999998 31.775 18.8 25.95 7 21.625 13.675 37.925 26.775 8 23.599999999999998 18.825 24.4 33.175 9 22.55 18.125 28.775000000000002 30.55 10-11 27.715964495561945 26.26578322290286 18.464808101012625 27.55344418052256 12-13 25.687500000000004 20.8875 24.3125 29.1125 14-15 25.5 23.150000000000002 23.275000000000002 28.075 16-17 26.7125 22.8 22.537499999999998 27.950000000000003 18-19 25.974999999999998 22.6125 22.3875 29.025000000000002 20-21 25.9625 23.325000000000003 22.95 27.762500000000003 22-23 25.525 23.425 23.325000000000003 27.725 24-25 27.0125 22.5625 22.650000000000002 27.775 26-27 27.287499999999998 23.1875 21.8125 27.712500000000002 28-29 27.3375 22.45 22.05 28.1625 30-31 26.4125 23.25 22.625 27.712500000000002 32-33 26.687499999999996 23.8875 21.762500000000003 27.6625 34-35 27.224999999999998 22.037499999999998 23.1375 27.6 36-37 26.125 22.787499999999998 23.0125 28.075 38-39 27.187499999999996 22.225 22.375 28.212500000000002 40-41 27.474999999999998 22.8375 22.4375 27.250000000000004 42-43 26.5625 23.05 23.65 26.737499999999997 44-45 26.674999999999997 23.575 22.2625 27.487499999999997 46-47 27.525 22.7125 21.725 28.037499999999998 48-49 26.8625 22.225 23.1125 27.800000000000004 50-51 26.950000000000003 23.4375 21.925 27.6875 52-53 27.925 21.95 22.25 27.875 54-55 26.200000000000003 22.9375 22.725 28.1375 56-57 27.3125 22.8125 23.075000000000003 26.8 58-59 27.375 23.1625 22.0 27.462500000000002 60-61 26.487500000000004 22.975 22.975 27.5625 62-63 27.187499999999996 22.75 23.200000000000003 26.8625 64-65 26.900000000000002 23.2125 22.2125 27.675 66-67 26.237500000000004 23.674999999999997 22.8875 27.200000000000003 68-69 26.4125 23.025000000000002 22.912499999999998 27.650000000000002 70-71 27.287499999999998 22.1375 22.525000000000002 28.050000000000004 72-73 26.787499999999998 22.825 23.125 27.2625 74-75 27.0125 23.4125 22.275 27.3 76-77 27.212500000000002 22.5875 22.162499999999998 28.037499999999998 78-79 26.8625 23.425 22.85 26.8625 80-81 27.762500000000003 23.3875 22.925 25.924999999999997 82-83 27.3625 22.45 23.1125 27.075 84-85 26.625 22.375 24.0125 26.987499999999997 86-87 28.125 21.762500000000003 22.925 27.187499999999996 88-89 27.725 22.8 22.412499999999998 27.0625 90-91 27.474999999999998 22.7125 22.975 26.8375 92-93 27.3875 22.8875 22.650000000000002 27.075 94-95 28.487499999999997 22.7 22.75 26.0625 96-97 27.725 22.412499999999998 23.5625 26.3 98-99 28.075 22.075 23.2875 26.5625 100 28.025 22.45 22.725 26.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 1.0 29 1.5 30 3.0 31 2.5 32 6.0 33 7.5 34 11.0 35 21.0 36 25.0 37 31.0 38 47.0 39 59.0 40 67.5 41 97.0 42 118.5 43 120.0 44 128.0 45 132.5 46 136.5 47 141.5 48 140.5 49 134.5 50 126.5 51 125.5 52 112.0 53 98.5 54 102.5 55 103.0 56 105.0 57 109.0 58 116.5 59 119.0 60 114.0 61 117.5 62 119.0 63 109.5 64 96.5 65 90.5 66 99.0 67 99.0 68 82.0 69 72.5 70 76.5 71 74.0 72 66.0 73 54.5 74 44.5 75 39.0 76 25.5 77 18.0 78 17.5 79 12.5 80 7.0 81 5.5 82 5.0 83 3.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98913318170331 97.925 2 0.9350518069244376 1.8499999999999999 3 0.0758150113722517 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542135 spots for SRR8618241.sra Written 542135 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra Read 542124 spots for SRR8618241.sra Written 542124 spots for SRR8618241.sra SRR ids: ['SRR8618241.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nka_ygpm SRR8618241.sra spots: 10842491 blocks: [[1, 542124], [542125, 1084248], [1084249, 1626372], [1626373, 2168496], [2168497, 2710620], [2710621, 3252744], [3252745, 3794868], [3794869, 4336992], [4336993, 4879116], [4879117, 5421240], [5421241, 5963364], [5963365, 6505488], [6505489, 7047612], [7047613, 7589736], [7589737, 8131860], [8131861, 8673984], [8673985, 9216108], [9216109, 9758232], [9758233, 10300356], [10300357, 10842491]] SRR8618241 file size 2821361 SRR8618241 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618241 SRR8618241_1.fastq SRR8618241_2.fastq Input file: SRR8618241_1.fastq Paired file: SRR8618241_2.fastq trimmed: SRR8618241-trimmed-pair1.fastq, SRR8618241-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:31:22 2024 >> started Sat Dec 7 09:31:33 2024 >> done (11.058s) 10842491 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 10842491 (100.00%) read pairs available; of these: 1474774 (13.60%) trimmed read pairs available after processing 9367717 (86.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 6 0.00% 82 31 0.00% 83 109 0.00% 84 4754 0.04% 85 5127 0.05% 86 5607 0.05% 87 6342 0.06% 88 7497 0.07% 89 9512 0.09% 90 16406 0.15% 91 31831 0.29% 92 46640 0.43% 93 65666 0.61% 94 89512 0.83% 95 114956 1.06% 96 152385 1.41% 97 214067 1.97% 98 301642 2.78% 99 402683 3.71% 100 9367717 86.40% 10842491 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.25 fanout-score-rank=14 prefix-density=0.42 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=35 fanout-score=40.93 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=9.2 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=23 prefix-density=0.39 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=32 fanout-score=44.66 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=9.7 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618241 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:32:02 Started mapping on | Dec 07 09:32:02 Finished on | Dec 07 09:32:40 Mapping speed, Million of reads per hour | 1027.18 Number of input reads | 10842491 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10604620 Uniquely mapped reads % | 97.81% Average mapped length | 198.19 Number of splices: Total | 6626040 Number of splices: Annotated (sjdb) | 6322641 Number of splices: GT/AG | 6532691 Number of splices: GC/AG | 76213 Number of splices: AT/AC | 1938 Number of splices: Non-canonical | 15198 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 100891 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 5814 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.00% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 136980 136980 136980 N_multimapping 100891 100891 100891 N_noFeature 211891 5284210 5330962 N_ambiguous 241815 20317 21353 UnstrandedReadsAssigned:10150914 PositiveStrandReadsAssigned:5300093 NegativeStrandReadsAssigned:5252305 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618241 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618241-trimmed-pair1.fastq SRR8618241-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,842,491 reads, 10,348,987 reads pseudoaligned [quant] estimated average fragment length: 169.161 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR8618241.ke.tsv 35125 SRR8618241.se.tsv 88098 total ==> SRR8618241.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 767.959 0 0 PNS24247 1044 875.839 12.9849 1.9514 PNS24249 1928 1759.84 59.3688 4.44036 PNS24246 1044 875.839 12.9849 1.9514 PNS24248 1044 875.839 12.9849 1.9514 PNS24244 1471 1302.84 6.67662 0.674525 PNS24243 293 133.167 3 2.96522 KQK14069 1603 1434.84 3646.76 334.531 KQK14071 474 307.197 301.201 129.054 ==> SRR8618241.se.tsv <== BRADI_1g14170v3 4113 BRADI_1g53295v3 124 BRADI_1g59795v3 146 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 211 BRADI_1g74790v3 27 BRADI_1g09890v3 0 BRADI_1g77505v3 150 BRADI_1g48960v3 0 SRR8618241 completed mapping pipeline successfully