Starting /dee2/code/volunteer_pipeline.sh SRR8618242 current disk space = 1544142123008 free memory = 1597573720 SRR8618242 SRAfilesize b92eebaddb1e32d5df0d47d72534a7f1 SRR8618242.sra SRR8618242.sra file validated SRR8618242 is paired end SRR8618242 is conventional basespace SRR8618242 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618242_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8495 34.0 31.0 34.0 31.0 34.0 2 33.031 34.0 31.0 34.0 31.0 34.0 3 33.152 34.0 33.0 34.0 31.0 34.0 4 32.0775 37.0 35.0 37.0 2.0 37.0 5 34.22275 37.0 35.0 37.0 19.0 37.0 6 35.79 37.0 35.0 37.0 32.0 37.0 7 36.1805 37.0 35.0 37.0 35.0 37.0 8 36.2835 37.0 36.0 37.0 35.0 37.0 9 38.2875 39.0 39.0 39.0 37.0 39.0 10-11 38.35 39.0 39.0 39.0 37.0 39.0 12-13 38.31337499999999 39.0 39.0 39.0 37.0 39.0 14-15 39.814375 41.0 40.0 41.0 38.0 41.0 16-17 39.69525 41.0 40.0 41.0 37.0 41.0 18-19 39.716 41.0 40.0 41.0 37.5 41.0 20-21 39.707875 41.0 39.5 41.0 37.0 41.0 22-23 39.527874999999995 41.0 39.0 41.0 36.5 41.0 24-25 39.365375 40.0 39.0 41.0 36.5 41.0 26-27 39.184 40.0 39.0 41.0 36.0 41.0 28-29 39.04425 40.0 38.0 41.0 35.0 41.0 30-31 38.73225 40.0 38.0 41.0 34.5 41.0 32-33 38.725875 40.0 38.0 41.0 35.0 41.0 34-35 38.9265 40.0 38.0 41.0 35.0 41.0 36-37 38.994625 40.0 38.0 41.0 35.0 41.0 38-39 38.7805 40.0 38.0 41.0 35.0 41.0 40-41 38.72575 40.0 37.5 41.0 35.0 41.0 42-43 38.437749999999994 40.0 37.0 41.0 35.0 41.0 44-45 38.276625 40.0 36.5 41.0 34.0 41.0 46-47 38.066125 40.0 35.5 41.0 34.0 41.0 48-49 37.848375000000004 39.0 35.0 41.0 33.5 41.0 50-51 37.55175 39.0 35.0 41.0 33.0 41.0 52-53 37.30225 38.5 35.0 41.0 33.0 41.0 54-55 37.026125 38.0 35.0 40.5 33.0 41.0 56-57 36.67875 37.0 35.0 40.0 32.5 41.0 58-59 36.416875 36.5 35.0 40.0 32.0 41.0 60-61 36.286 36.0 35.0 40.0 32.0 41.0 62-63 35.908249999999995 35.5 35.0 39.0 31.0 41.0 64-65 35.653375 35.0 34.0 39.0 31.0 41.0 66-67 35.32025 35.0 34.0 38.5 31.0 40.5 68-69 35.014250000000004 35.0 34.0 37.5 31.0 40.0 70-71 34.558499999999995 35.0 33.0 37.0 30.0 39.0 72-73 34.214 35.0 33.0 36.0 29.5 39.0 74-75 34.066125 35.0 33.0 36.0 29.5 39.0 76-77 33.326750000000004 34.5 32.5 35.0 29.0 37.0 78-79 33.6295 35.0 33.0 35.0 29.0 37.0 80-81 33.518375000000006 35.0 33.0 35.0 29.0 36.5 82-83 33.355875 35.0 33.0 35.0 29.0 36.0 84-85 33.124375 35.0 33.0 35.0 29.0 36.0 86-87 32.82125 35.0 33.0 35.0 28.0 35.5 88-89 32.450874999999996 35.0 32.0 35.0 27.0 35.0 90-91 32.2175 34.5 32.0 35.0 26.5 35.0 92-93 31.825125 34.0 32.0 35.0 25.0 35.0 94-95 31.522 34.0 31.0 35.0 25.0 35.0 96-97 31.19325 34.0 31.0 35.0 24.0 35.0 98-99 30.80775 34.0 31.0 35.0 23.5 35.0 100 30.29225 34.0 31.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.15625 1101 2 0.13229166666666714 1101 3 0.0677083333333357 1101 4 -3.3645833333333286 1101 5 -1.6875 1101 6 -0.39270833333333854 1101 7 -0.1145833333333357 1101 8 -0.1041666666666643 1101 9 -0.0729166666666643 1101 10-11 0.04791666666666572 1101 12-13 0.06041666666666856 1101 14-15 0.05781249999999716 1101 16-17 0.03958333333333286 1101 18-19 0.11145833333333144 1101 20-21 -0.0546875 1101 22-23 0.22083333333333854 1101 24-25 0.1380208333333286 1101 26-27 0.25572916666666856 1101 28-29 -0.02187500000000142 1101 30-31 -0.028125000000002842 1101 32-33 0.09479166666666572 1101 34-35 -0.06927083333333428 1101 36-37 0.0625 1101 38-39 -0.21197916666666572 1101 40-41 0.06093750000000142 1101 42-43 -0.044791666666661456 1101 44-45 -0.2770833333333371 1101 46-47 -0.20520833333333144 1101 48-49 -0.04322916666666998 1101 50-51 -0.04791666666666572 1101 52-53 0.0989583333333357 1101 54-55 0.09427083333333997 1101 56-57 0.30416666666666714 1101 58-59 0.33385416666666146 1101 60-61 0.16614583333333854 1101 62-63 0.16874999999999574 1101 64-65 0.2812500000000071 1101 66-67 0.5036458333333371 1101 68-69 0.3135416666666657 1101 70-71 0.18385416666666998 1101 72-73 0.06197916666666714 1101 74-75 -0.018750000000004263 1101 76-77 -0.04218749999999716 1101 78-79 0.16354166666666714 1101 80-81 0.16979166666666856 1101 82-83 -0.21197916666666572 1101 84-85 0.14999999999999858 1101 86-87 0.2880208333333343 1101 88-89 0.3369791666666657 1101 90-91 0.19427083333333428 1101 92-93 0.15677083333333286 1101 94-95 0.2562500000000014 1101 96-97 0.10624999999999929 1101 98-99 0.1296874999999993 1101 100 0.3874999999999993 1103 1 -0.15625 1103 2 -0.13229166666666003 1103 3 -0.0677083333333286 1103 4 3.3645833333333357 1103 5 1.6875 1103 6 0.39270833333333144 1103 7 0.1145833333333357 1103 8 0.1041666666666643 1103 9 0.0729166666666643 1103 10-11 -0.04791666666666572 1103 12-13 -0.060416666666661456 1103 14-15 -0.05781250000000426 1103 16-17 -0.03958333333333286 1103 18-19 -0.11145833333333144 1103 20-21 0.0546875 1103 22-23 -0.22083333333333144 1103 24-25 -0.1380208333333357 1103 26-27 -0.25572916666666856 1103 28-29 0.02187500000000142 1103 30-31 0.028125000000002842 1103 32-33 -0.09479166666666572 1103 34-35 0.06927083333333428 1103 36-37 -0.0625 1103 38-39 0.21197916666666572 1103 40-41 -0.06093750000000142 1103 42-43 0.04479166666666856 1103 44-45 0.2770833333333371 1103 46-47 0.20520833333333144 1103 48-49 0.04322916666666998 1103 50-51 0.04791666666666572 1103 52-53 -0.0989583333333357 1103 54-55 -0.09427083333333286 1103 56-57 -0.30416666666666714 1103 58-59 -0.33385416666666856 1103 60-61 -0.16614583333333144 1103 62-63 -0.16874999999999574 1103 64-65 -0.28125 1103 66-67 -0.50364583333333 1103 68-69 -0.3135416666666657 1103 70-71 -0.18385416666666998 1103 72-73 -0.06197916666666714 1103 74-75 0.018749999999997158 1103 76-77 0.04218749999999716 1103 78-79 -0.16354166666666714 1103 80-81 -0.16979166666666856 1103 82-83 0.21197916666666572 1103 84-85 -0.14999999999999858 1103 86-87 -0.2880208333333343 1103 88-89 -0.3369791666666657 1103 90-91 -0.19427083333333428 1103 92-93 -0.15677083333333286 1103 94-95 -0.25624999999999787 1103 96-97 -0.10624999999999929 1103 98-99 -0.1296874999999993 1103 100 -0.3874999999999993 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 13.0 28 43.0 29 52.0 30 90.0 31 114.0 32 139.0 33 219.0 34 310.0 35 509.0 36 751.0 37 884.0 38 767.0 39 107.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.925 10.725 13.275 48.075 2 27.0 18.025 30.675 24.3 3 27.525 22.35 21.775 28.349999999999998 4 29.773184036749928 27.533735285673274 16.738443870226817 25.954636807349985 5 29.299999999999997 29.799999999999997 19.075 21.825 6 22.005501375343837 33.633408352088026 19.829957489372344 24.5311327831958 7 21.075 13.900000000000002 38.7 26.325 8 23.599999999999998 19.375 23.425 33.6 9 23.849999999999998 18.15 28.000000000000004 30.0 10-11 26.875 27.6 18.025 27.500000000000004 12-13 23.8125 21.3 25.650000000000002 29.2375 14-15 25.637500000000003 23.075000000000003 24.125 27.1625 16-17 27.075 22.900000000000002 23.1125 26.9125 18-19 26.950000000000003 23.05 22.675 27.325 20-21 26.3625 22.725 23.25 27.6625 22-23 26.5625 23.2375 23.4625 26.737499999999997 24-25 27.537499999999998 22.425 23.2625 26.775 26-27 26.8125 23.4625 22.875 26.85 28-29 26.650000000000002 22.537499999999998 23.7125 27.1 30-31 26.3 23.150000000000002 22.475 28.075 32-33 26.637499999999996 23.025000000000002 23.45 26.887499999999996 34-35 26.887499999999996 23.0875 22.3625 27.6625 36-37 25.7375 23.525 22.900000000000002 27.8375 38-39 26.2875 24.212500000000002 22.625 26.875 40-41 27.150000000000002 22.8375 23.400000000000002 26.6125 42-43 27.6375 22.6 23.325000000000003 26.437500000000004 44-45 26.3625 22.75 23.3125 27.575 46-47 26.875 23.1 22.325 27.700000000000003 48-49 26.637499999999996 22.775000000000002 23.4875 27.1 50-51 26.025 23.3125 22.825 27.8375 52-53 26.237500000000004 23.125 22.325 28.3125 54-55 26.937499999999996 23.150000000000002 22.5625 27.35 56-57 26.474999999999998 23.7125 23.5 26.3125 58-59 26.3625 23.45 22.75 27.437499999999996 60-61 27.1 22.95 23.25 26.700000000000003 62-63 27.800000000000004 22.225 23.375 26.6 64-65 26.887499999999996 22.8875 22.162499999999998 28.0625 66-67 25.7 23.5625 23.0375 27.700000000000003 68-69 27.975 21.85 22.45 27.725 70-71 27.987499999999997 23.05 22.3875 26.575 72-73 27.05 23.4625 22.5875 26.900000000000002 74-75 27.3125 23.674999999999997 22.5625 26.450000000000003 76-77 26.55 22.75 23.525 27.175 78-79 26.9625 23.3 22.412499999999998 27.325 80-81 27.3875 22.8375 22.825 26.950000000000003 82-83 27.0875 22.2125 23.05 27.650000000000002 84-85 26.525 22.6375 23.05 27.787499999999998 86-87 27.400000000000002 22.0875 23.8375 26.674999999999997 88-89 27.375 22.225 23.2125 27.187499999999996 90-91 26.75 22.8125 22.7125 27.725 92-93 27.82847855981998 23.052881610201275 22.765345668208525 26.35329416177022 94-95 28.1875 22.7125 23.0 26.1 96-97 27.737499999999997 22.8 23.1375 26.325 98-99 27.975 22.075 23.0875 26.8625 100 28.050000000000004 22.325 22.575 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 1.5 28 0.5 29 1.5 30 3.5 31 3.5 32 6.0 33 12.5 34 17.5 35 21.5 36 33.5 37 49.5 38 56.0 39 65.5 40 81.0 41 96.0 42 120.0 43 126.5 44 129.0 45 143.5 46 132.5 47 122.0 48 131.5 49 143.5 50 132.5 51 112.5 52 109.5 53 104.5 54 98.5 55 90.5 56 89.5 57 111.5 58 121.0 59 122.5 60 125.0 61 113.0 62 109.5 63 107.0 64 100.0 65 95.5 66 97.0 67 104.5 68 101.5 69 77.5 70 62.5 71 65.5 72 56.0 73 49.5 74 39.0 75 26.5 76 24.0 77 15.0 78 10.0 79 10.5 80 8.0 81 3.5 82 3.5 83 3.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 12.925 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.7832238504295099 1.55 3 0.1010611419909045 0.3 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618242 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618242_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05525 33.0 31.0 34.0 31.0 34.0 2 32.803 34.0 31.0 34.0 31.0 34.0 3 32.9325 34.0 31.0 34.0 31.0 34.0 4 36.46225 37.0 37.0 37.0 35.0 37.0 5 36.49325 37.0 37.0 37.0 35.0 37.0 6 36.453 37.0 37.0 37.0 35.0 37.0 7 36.45475 37.0 37.0 37.0 35.0 37.0 8 36.4805 37.0 37.0 37.0 35.0 37.0 9 38.336 39.0 39.0 39.0 37.0 39.0 10-11 38.2645 39.0 39.0 39.0 37.0 39.0 12-13 38.27175 39.0 39.0 39.0 37.0 39.0 14-15 39.813125 41.0 40.0 41.0 38.0 41.0 16-17 39.652125 41.0 40.0 41.0 37.0 41.0 18-19 39.775375 41.0 40.0 41.0 38.0 41.0 20-21 39.737625 41.0 40.0 41.0 37.5 41.0 22-23 39.681 41.0 39.0 41.0 37.0 41.0 24-25 39.601 41.0 39.0 41.0 37.0 41.0 26-27 39.378125 40.5 39.0 41.0 36.0 41.0 28-29 39.219750000000005 40.0 38.5 41.0 36.0 41.0 30-31 39.0865 40.0 38.0 41.0 35.5 41.0 32-33 39.060875 40.0 38.0 41.0 35.0 41.0 34-35 38.8865 40.0 38.0 41.0 35.0 41.0 36-37 38.717 40.0 38.0 41.0 35.0 41.0 38-39 38.475750000000005 40.0 37.5 41.0 34.5 41.0 40-41 38.253625 40.0 37.0 41.0 34.0 41.0 42-43 38.010875 40.0 36.0 41.0 33.0 41.0 44-45 37.582 39.0 35.0 41.0 33.0 41.0 46-47 37.350125 39.0 35.0 41.0 33.0 41.0 48-49 37.19225 38.5 35.0 40.5 32.5 41.0 50-51 36.836375000000004 38.0 34.5 40.0 32.0 40.5 52-53 36.842124999999996 38.0 35.0 40.0 32.5 41.0 54-55 37.00125 38.0 35.0 40.0 33.0 41.0 56-57 36.829499999999996 37.0 35.0 40.0 33.0 41.0 58-59 36.50425 36.5 35.0 40.0 32.5 41.0 60-61 36.169375 36.0 35.0 40.0 31.5 41.0 62-63 35.932625 35.0 35.0 39.0 32.0 41.0 64-65 35.742375 35.0 35.0 39.0 31.5 41.0 66-67 35.425250000000005 35.0 34.0 38.5 31.0 41.0 68-69 35.191375 35.0 34.0 37.5 31.0 40.0 70-71 34.855125 35.0 34.0 37.0 31.0 39.5 72-73 34.54375 35.0 34.0 36.5 30.0 39.0 74-75 34.215125 35.0 34.0 36.0 30.0 39.0 76-77 33.883625 35.0 33.0 35.5 29.0 37.5 78-79 33.702625 35.0 33.0 35.0 29.0 37.0 80-81 33.481875 35.0 33.0 35.0 29.0 36.5 82-83 33.333 35.0 33.0 35.0 29.0 36.0 84-85 33.08975 35.0 33.0 35.0 29.0 36.0 86-87 32.701 35.0 33.0 35.0 27.0 35.0 88-89 32.5075 35.0 32.0 35.0 27.0 35.0 90-91 32.341499999999996 34.5 32.0 35.0 27.0 35.0 92-93 31.960250000000002 34.0 32.0 35.0 26.0 35.0 94-95 31.523375 34.0 31.0 35.0 24.5 35.0 96-97 31.163375000000002 34.0 31.0 35.0 24.0 35.0 98-99 30.69425 34.0 31.0 35.0 23.5 35.0 100 30.176 34.0 30.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.04479166666666856 1101 2 0.15625 1101 3 0.12187499999999574 1101 4 0.19895833333333002 1101 5 0.1614583333333286 1101 6 0.1197916666666714 1101 7 0.08645833333333286 1101 8 0.140625 1101 9 0.11250000000000426 1101 10-11 0.08125000000000426 1101 12-13 0.20989583333333428 1101 14-15 0.18177083333333854 1101 16-17 -0.0598958333333357 1101 18-19 -0.03437499999999716 1101 20-21 0.0833333333333357 1101 22-23 0.1614583333333286 1101 24-25 0.22864583333333144 1101 26-27 0.08489583333333428 1101 28-29 0.03281249999999858 1101 30-31 0.24166666666666714 1101 32-33 0.22187500000000426 1101 34-35 0.5921874999999943 1101 36-37 0.25572916666666856 1101 38-39 0.14739583333332718 1101 40-41 0.1380208333333286 1101 42-43 0.11249999999999716 1101 44-45 0.1848958333333286 1101 46-47 -0.14166666666666572 1101 48-49 0.03020833333333428 1101 50-51 0.21510416666666998 1101 52-53 0.18541666666666856 1101 54-55 0.08229166666666998 1101 56-57 0.37135416666667 1101 58-59 0.18177083333333144 1101 60-61 0.2083333333333286 1101 62-63 0.05520833333333286 1101 64-65 -0.0755208333333357 1101 66-67 0.05104166666666998 1101 68-69 0.10468749999999716 1101 70-71 0.14531250000000284 1101 72-73 0.17291666666666572 1101 74-75 -0.06718750000000284 1101 76-77 0.17135416666666003 1101 78-79 0.14010416666666714 1101 80-81 0.2526041666666643 1101 82-83 0.20624999999999716 1101 84-85 0.23593749999999858 1101 86-87 0.013541666666668561 1101 88-89 0.18645833333333428 1101 90-91 0.16197916666666146 1101 92-93 0.2624999999999993 1101 94-95 -0.4359375000000014 1101 96-97 -0.267708333333335 1101 98-99 -0.35468749999999716 1101 100 -0.5968750000000007 1103 1 0.04479166666666856 1103 2 -0.15625 1103 3 -0.12187500000000284 1103 4 -0.19895833333333712 1103 5 -0.1614583333333357 1103 6 -0.1197916666666643 1103 7 -0.08645833333333286 1103 8 -0.140625 1103 9 -0.11249999999999716 1103 10-11 -0.08125000000000426 1103 12-13 -0.20989583333333428 1103 14-15 -0.18177083333333854 1103 16-17 0.0598958333333357 1103 18-19 0.03437500000000426 1103 20-21 -0.0833333333333286 1103 22-23 -0.1614583333333357 1103 24-25 -0.22864583333333144 1103 26-27 -0.08489583333333428 1103 28-29 -0.03281249999999858 1103 30-31 -0.24166666666666003 1103 32-33 -0.22187500000000426 1103 34-35 -0.5921875000000014 1103 36-37 -0.25572916666666146 1103 38-39 -0.14739583333333428 1103 40-41 -0.1380208333333286 1103 42-43 -0.11249999999999716 1103 44-45 -0.1848958333333286 1103 46-47 0.14166666666666572 1103 48-49 -0.03020833333333428 1103 50-51 -0.21510416666666998 1103 52-53 -0.18541666666666856 1103 54-55 -0.08229166666666998 1103 56-57 -0.3713541666666629 1103 58-59 -0.18177083333333144 1103 60-61 -0.2083333333333357 1103 62-63 -0.05520833333333286 1103 64-65 0.0755208333333286 1103 66-67 -0.05104166666666998 1103 68-69 -0.10468749999999716 1103 70-71 -0.14531249999999574 1103 72-73 -0.17291666666666572 1103 74-75 0.06718750000000284 1103 76-77 -0.17135416666666714 1103 78-79 -0.14010416666666714 1103 80-81 -0.2526041666666714 1103 82-83 -0.20625000000000426 1103 84-85 -0.23593749999999858 1103 86-87 -0.013541666666661456 1103 88-89 -0.18645833333333428 1103 90-91 -0.16197916666666856 1103 92-93 -0.2624999999999993 1103 94-95 0.4359375000000014 1103 96-97 0.267708333333335 1103 98-99 0.3546875000000007 1103 100 0.5968750000000007 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 15.0 28 41.0 29 62.0 30 85.0 31 107.0 32 134.0 33 236.0 34 304.0 35 478.0 36 737.0 37 895.0 38 775.0 39 128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.225 8.725 12.825000000000001 49.225 2 26.275 17.724999999999998 30.625000000000004 25.374999999999996 3 27.425 21.9 21.7 28.975 4 30.4 27.925 15.775 25.900000000000002 5 31.275 28.525 18.725 21.475 6 23.1 31.0 19.85 26.05 7 21.275 14.875 37.35 26.5 8 22.675 18.6 24.15 34.575 9 22.95 17.875 28.299999999999997 30.875000000000004 10-11 26.682511883912934 26.8951713785339 18.901676257192896 27.52064048036027 12-13 24.928116014501814 20.452556569571197 24.86560820102513 29.753719214901864 14-15 26.2875 22.675 23.925 27.1125 16-17 26.150000000000002 23.175 21.5625 29.1125 18-19 26.237500000000004 23.1125 22.6875 27.962500000000002 20-21 25.412499999999998 22.8375 22.912499999999998 28.8375 22-23 26.0625 24.075 23.325000000000003 26.5375 24-25 26.0375 23.3 22.5125 28.15 26-27 26.337500000000002 23.125 22.650000000000002 27.8875 28-29 27.05 23.9 21.837500000000002 27.212500000000002 30-31 25.85 23.1625 23.25 27.737499999999997 32-33 27.6625 23.825 22.075 26.437500000000004 34-35 26.900000000000002 23.775 22.1875 27.1375 36-37 26.5625 23.7625 22.112499999999997 27.5625 38-39 27.487499999999997 23.7375 21.5625 27.212500000000002 40-41 26.700000000000003 22.675 23.3875 27.237499999999997 42-43 26.400000000000002 23.0 22.625 27.975 44-45 27.3125 23.6625 21.5375 27.487499999999997 46-47 27.3125 23.5 22.3375 26.85 48-49 27.0 23.45 22.287499999999998 27.2625 50-51 26.387500000000003 23.225 23.025000000000002 27.3625 52-53 28.000000000000004 22.7 22.3125 26.987499999999997 54-55 26.737499999999997 22.725 23.1 27.437499999999996 56-57 26.637499999999996 23.1125 22.237499999999997 28.012500000000003 58-59 27.287499999999998 22.375 22.475 27.8625 60-61 26.724999999999998 22.4875 22.875 27.9125 62-63 26.6625 23.1875 23.4375 26.7125 64-65 26.525 23.875 22.5625 27.037499999999998 66-67 27.175 22.575 22.912499999999998 27.3375 68-69 27.275 22.662499999999998 22.525000000000002 27.537499999999998 70-71 26.85 23.5 22.7125 26.937499999999996 72-73 26.9125 23.05 22.15 27.8875 74-75 27.200000000000003 23.35 22.662499999999998 26.787499999999998 76-77 27.150000000000002 22.725 22.537499999999998 27.5875 78-79 26.237500000000004 23.674999999999997 22.4625 27.625 80-81 27.224999999999998 22.9375 22.875 26.9625 82-83 26.55 22.662499999999998 23.0625 27.725 84-85 26.0125 22.85 23.2375 27.900000000000002 86-87 27.6375 22.787499999999998 23.35 26.224999999999998 88-89 27.85 22.5875 22.1875 27.375 90-91 27.2625 23.7 22.412499999999998 26.625 92-93 26.474999999999998 23.9125 23.225 26.387500000000003 94-95 27.250000000000004 22.650000000000002 22.775000000000002 27.325 96-97 27.3 23.1375 22.6125 26.950000000000003 98-99 27.3625 22.3375 22.7375 27.5625 100 27.625 22.475 23.075000000000003 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 2.0 28 4.0 29 4.5 30 3.5 31 6.0 32 10.0 33 13.0 34 17.5 35 25.0 36 31.0 37 37.0 38 49.5 39 66.0 40 80.0 41 92.0 42 101.0 43 122.5 44 142.5 45 142.5 46 133.0 47 137.5 48 138.0 49 141.5 50 134.0 51 105.0 52 92.5 53 94.5 54 88.0 55 87.5 56 94.0 57 98.5 58 119.0 59 118.5 60 109.0 61 102.0 62 108.0 63 120.0 64 115.5 65 105.5 66 104.0 67 101.5 68 95.0 69 89.0 70 74.5 71 55.5 72 56.0 73 56.0 74 44.0 75 35.5 76 28.0 77 20.5 78 13.5 79 12.0 80 9.0 81 7.0 82 4.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.075 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11705348133198 98.225 2 0.8577194752774974 1.7000000000000002 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551232 spots for SRR8618242.sra Written 551232 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra Read 551227 spots for SRR8618242.sra Written 551227 spots for SRR8618242.sra SRR ids: ['SRR8618242.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2qo2uwd4 SRR8618242.sra spots: 11024545 blocks: [[1, 551227], [551228, 1102454], [1102455, 1653681], [1653682, 2204908], [2204909, 2756135], [2756136, 3307362], [3307363, 3858589], [3858590, 4409816], [4409817, 4961043], [4961044, 5512270], [5512271, 6063497], [6063498, 6614724], [6614725, 7165951], [7165952, 7717178], [7717179, 8268405], [8268406, 8819632], [8819633, 9370859], [9370860, 9922086], [9922087, 10473313], [10473314, 11024545]] SRR8618242 file size 2868924 SRR8618242 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618242 SRR8618242_1.fastq SRR8618242_2.fastq Input file: SRR8618242_1.fastq Paired file: SRR8618242_2.fastq trimmed: SRR8618242-trimmed-pair1.fastq, SRR8618242-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:41:37 2024 >> started Sat Dec 7 09:41:47 2024 >> done (9.601s) 11024545 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11024545 (100.00%) read pairs available; of these: 1516869 (13.76%) trimmed read pairs available after processing 9507676 (86.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 11 0.00% 82 30 0.00% 83 99 0.00% 84 3689 0.03% 85 4147 0.04% 86 4923 0.04% 87 5497 0.05% 88 7029 0.06% 89 8994 0.08% 90 15715 0.14% 91 30480 0.28% 92 45342 0.41% 93 65232 0.59% 94 88851 0.81% 95 116833 1.06% 96 157122 1.43% 97 223367 2.03% 98 315714 2.86% 99 423794 3.84% 100 9507676 86.24% 11024545 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.31 fanout-score-rank=15 prefix-density=0.47 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=33 fanout-score=40.46 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.4 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=19 prefix-density=0.43 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=35 fanout-score=38.66 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618242 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:42:25 Started mapping on | Dec 07 09:42:26 Finished on | Dec 07 09:42:59 Mapping speed, Million of reads per hour | 1202.68 Number of input reads | 11024545 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10700265 Uniquely mapped reads % | 97.06% Average mapped length | 198.18 Number of splices: Total | 6653117 Number of splices: Annotated (sjdb) | 6339593 Number of splices: GT/AG | 6558061 Number of splices: GC/AG | 77020 Number of splices: AT/AC | 2016 Number of splices: Non-canonical | 16020 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 134665 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 11721 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 189615 189615 189615 N_multimapping 134665 134665 134665 N_noFeature 250600 5361589 5394026 N_ambiguous 234918 19996 20943 UnstrandedReadsAssigned:10214747 PositiveStrandReadsAssigned:5318680 NegativeStrandReadsAssigned:5285296 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618242 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618242-trimmed-pair1.fastq SRR8618242-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,024,545 reads, 10,421,175 reads pseudoaligned [quant] estimated average fragment length: 167.956 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52973 SRR8618242.ke.tsv 35125 SRR8618242.se.tsv 88098 total ==> SRR8618242.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.125 0 0 PNS24247 1044 877.044 12.4079 1.85538 PNS24249 1928 1761.04 49.153 3.66045 PNS24246 1044 877.044 12.4079 1.85538 PNS24248 1044 877.044 12.4079 1.85538 PNS24244 1471 1304.04 23.6232 2.37575 PNS24243 293 133.734 1 0.980648 KQK14069 1603 1436.04 2777.51 253.654 KQK14071 474 308.49 289.18 122.937 ==> SRR8618242.se.tsv <== BRADI_1g14170v3 3361 BRADI_1g53295v3 169 BRADI_1g59795v3 157 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 554 BRADI_1g74790v3 26 BRADI_1g09890v3 4 BRADI_1g77505v3 108 BRADI_1g48960v3 0 SRR8618242 completed mapping pipeline successfully