Starting /dee2/code/volunteer_pipeline.sh SRR8618243 current disk space = 1544108949504 free memory = 1605655016 SRR8618243 SRAfilesize 8409aa5ee87574b9b524e66a58fde82d SRR8618243.sra SRR8618243.sra file validated SRR8618243 is paired end SRR8618243 is conventional basespace SRR8618243 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618243_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93275 34.0 31.0 34.0 31.0 34.0 2 33.09875 34.0 33.0 34.0 31.0 34.0 3 33.2005 34.0 34.0 34.0 31.0 34.0 4 32.4585 37.0 35.0 37.0 2.0 37.0 5 34.419 37.0 35.0 37.0 19.0 37.0 6 35.83725 37.0 35.0 37.0 32.0 37.0 7 36.191 37.0 35.0 37.0 35.0 37.0 8 36.34125 37.0 37.0 37.0 35.0 37.0 9 38.27675 39.0 39.0 39.0 37.0 39.0 10-11 38.370000000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.30525 39.0 39.0 39.0 37.0 39.0 14-15 39.836625 41.0 40.0 41.0 38.0 41.0 16-17 39.727625 41.0 40.0 41.0 37.0 41.0 18-19 39.760000000000005 41.0 40.0 41.0 37.0 41.0 20-21 39.715625 41.0 40.0 41.0 37.5 41.0 22-23 39.6145 41.0 39.0 41.0 37.0 41.0 24-25 39.466375 40.5 39.0 41.0 36.0 41.0 26-27 39.32425 40.0 39.0 41.0 36.0 41.0 28-29 39.135875 40.0 38.5 41.0 36.0 41.0 30-31 38.815124999999995 40.0 38.0 41.0 35.0 41.0 32-33 38.864625000000004 40.0 38.0 41.0 35.0 41.0 34-35 39.09075 40.0 38.5 41.0 35.0 41.0 36-37 39.097 40.0 38.0 41.0 35.0 41.0 38-39 38.985125 40.0 38.0 41.0 35.0 41.0 40-41 38.831500000000005 40.0 38.0 41.0 35.0 41.0 42-43 38.5955 40.0 37.0 41.0 35.0 41.0 44-45 38.388625000000005 40.0 36.5 41.0 34.5 41.0 46-47 38.199375 40.0 36.0 41.0 34.0 41.0 48-49 37.911874999999995 39.0 35.0 41.0 34.0 41.0 50-51 37.633625 39.0 35.0 41.0 33.0 41.0 52-53 37.3795 38.5 35.0 41.0 33.0 41.0 54-55 37.022375 38.0 35.0 41.0 33.0 41.0 56-57 36.763999999999996 37.0 35.0 40.0 33.0 41.0 58-59 36.46925 36.5 35.0 40.0 32.0 41.0 60-61 36.261875 36.0 35.0 40.0 32.0 41.0 62-63 36.01375 35.5 35.0 39.5 32.0 41.0 64-65 35.657875000000004 35.0 34.0 39.0 31.0 41.0 66-67 35.343374999999995 35.0 34.0 38.5 31.0 41.0 68-69 35.006 35.0 34.0 37.5 30.5 40.0 70-71 34.58925 35.0 33.0 37.0 30.0 39.5 72-73 34.37525 35.0 33.0 36.5 30.0 39.0 74-75 34.040499999999994 35.0 33.0 36.0 29.5 39.0 76-77 33.16175 34.5 32.5 35.0 28.0 37.0 78-79 33.633375 35.0 33.0 35.0 29.0 37.0 80-81 33.59625 35.0 33.0 35.0 29.0 37.0 82-83 33.37875 35.0 33.0 35.0 29.0 36.0 84-85 33.198625 35.0 33.0 35.0 29.0 36.0 86-87 33.008125 35.0 33.0 35.0 29.0 36.0 88-89 32.659499999999994 35.0 33.0 35.0 27.0 35.0 90-91 32.343500000000006 34.5 32.0 35.0 27.0 35.0 92-93 31.987625 34.0 32.0 35.0 26.5 35.0 94-95 31.766125 34.0 32.0 35.0 25.0 35.0 96-97 31.362625 34.0 31.5 35.0 24.5 35.0 98-99 30.956625 34.0 31.0 35.0 24.0 35.0 100 30.39925 34.0 31.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.14696519524617457 1101 2 0.035229202037349694 1101 3 0.08234295415959281 1101 4 -3.377865025466896 1101 5 -1.6902589134125634 1101 6 -0.5421264855687582 1101 7 -0.16171477079795693 1101 8 0.015598471986422169 1101 9 0.0718378607809882 1101 10-11 0.06101443123938566 1101 12-13 -0.011672325976235243 1101 14-15 -0.03979202037351115 1101 16-17 -0.16394312393887844 1101 18-19 -0.01931239388795092 1101 20-21 0.07173174872665555 1101 22-23 0.06743421052631504 1101 24-25 0.06053692699490654 1101 26-27 0.11942911714770332 1101 28-29 0.09321943972835811 1101 30-31 -0.13890067911714965 1101 32-33 -0.04127758913412549 1101 34-35 0.13752122241086795 1101 36-37 0.1486629881154542 1101 38-39 -0.06154499151103465 1101 40-41 0.24161714770797715 1101 42-43 0.09178692699490654 1101 44-45 0.2870861629881105 1101 46-47 0.006685059422750328 1101 48-49 -0.027058573853985024 1101 50-51 -0.04668930390492676 1101 52-53 -0.15237691001697584 1101 54-55 -0.20766129032258362 1101 56-57 -0.06154499151103465 1101 58-59 -0.19901315789473983 1101 60-61 -0.22835314091680914 1101 62-63 -0.4295415959253006 1101 64-65 -0.2598153650254673 1101 66-67 -0.23318123938879864 1101 68-69 -0.23795628183361828 1101 70-71 -0.19620118845500656 1101 72-73 -0.16855899830220977 1101 74-75 -0.10637733446519348 1101 76-77 -0.34417444821732346 1101 78-79 -0.13996179966044053 1101 80-81 -0.1629881154499131 1101 82-83 -0.10616511035653531 1101 84-85 -0.1279180814940588 1101 86-87 -0.361205432937183 1101 88-89 -0.572156196943979 1101 90-91 -0.21742359932088107 1101 92-93 -0.26321095076400525 1101 94-95 -0.3311226655348065 1101 96-97 -0.14309210526315752 1101 98-99 0.11953522920203952 1101 100 0.13868845500848792 1103 1 -0.14696519524618168 1103 2 -0.035229202037349694 1103 3 -0.08234295415959281 1103 4 3.377865025466889 1103 5 1.6902589134125705 1103 6 0.5421264855687582 1103 7 0.16171477079796404 1103 8 -0.015598471986415063 1103 9 -0.07183786078098109 1103 10-11 -0.061014431239392763 1103 12-13 0.011672325976228137 1103 14-15 0.039792020373518255 1103 16-17 0.16394312393887844 1103 18-19 0.019312393887943813 1103 20-21 -0.07173174872665555 1103 22-23 -0.06743421052631504 1103 24-25 -0.06053692699490654 1103 26-27 -0.11942911714771043 1103 28-29 -0.09321943972835811 1103 30-31 0.13890067911714254 1103 32-33 0.04127758913412549 1103 34-35 -0.13752122241086795 1103 36-37 -0.1486629881154542 1103 38-39 0.06154499151103465 1103 40-41 -0.24161714770797715 1103 42-43 -0.09178692699490654 1103 44-45 -0.2870861629881176 1103 46-47 -0.006685059422750328 1103 48-49 0.02705857385399213 1103 50-51 0.04668930390492676 1103 52-53 0.15237691001698295 1103 54-55 0.20766129032258362 1103 56-57 0.06154499151103465 1103 58-59 0.19901315789473983 1103 60-61 0.22835314091680914 1103 62-63 0.4295415959253006 1103 64-65 0.2598153650254673 1103 66-67 0.23318123938879864 1103 68-69 0.23795628183361828 1103 70-71 0.19620118845501366 1103 72-73 0.16855899830220977 1103 74-75 0.10637733446520059 1103 76-77 0.34417444821731635 1103 78-79 0.13996179966044053 1103 80-81 0.1629881154499131 1103 82-83 0.10616511035653531 1103 84-85 0.1279180814940588 1103 86-87 0.361205432937183 1103 88-89 0.5721561969439719 1103 90-91 0.21742359932088107 1103 92-93 0.26321095076400525 1103 94-95 0.3311226655347994 1103 96-97 0.14309210526315752 1103 98-99 -0.11953522920203596 1103 100 -0.13868845500849147 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 6.0 27 11.0 28 32.0 29 52.0 30 71.0 31 116.0 32 167.0 33 205.0 34 294.0 35 455.0 36 765.0 37 888.0 38 806.0 39 132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.7 10.825 12.625 47.85 2 26.55 17.525 32.25 23.674999999999997 3 26.474999999999998 23.275000000000002 22.925 27.325 4 28.936170212765955 28.141843971631204 16.595744680851062 26.326241134751772 5 29.875 29.849999999999998 18.85 21.425 6 22.436218109054526 32.2911455727864 20.185092546273136 25.087543771885944 7 19.375 14.2 39.550000000000004 26.875 8 22.650000000000002 19.5 24.224999999999998 33.625 9 22.3 18.975 28.975 29.75 10-11 27.025 26.8625 18.65 27.462500000000002 12-13 25.0375 20.7625 25.5 28.7 14-15 24.85 23.05 24.337500000000002 27.762500000000003 16-17 26.1125 23.0625 23.1375 27.6875 18-19 26.237500000000004 23.225 23.4875 27.05 20-21 26.8 22.1 23.175 27.925 22-23 25.924999999999997 23.375 22.575 28.125 24-25 26.150000000000002 23.4875 22.537499999999998 27.825 26-27 26.2125 23.849999999999998 22.9375 27.0 28-29 25.837500000000002 23.200000000000003 23.724999999999998 27.237499999999997 30-31 26.05 23.425 23.0 27.525 32-33 26.700000000000003 23.175 23.0875 27.037499999999998 34-35 26.05 23.175 23.724999999999998 27.05 36-37 25.2 24.325 22.7625 27.712500000000002 38-39 27.375 23.674999999999997 22.4375 26.5125 40-41 26.924999999999997 23.7 22.2 27.175 42-43 26.474999999999998 22.975 23.0875 27.462500000000002 44-45 26.400000000000002 23.474999999999998 23.125 27.0 46-47 26.1 23.4375 21.9625 28.499999999999996 48-49 25.8625 23.4875 23.5625 27.0875 50-51 26.1125 23.8625 23.35 26.674999999999997 52-53 27.200000000000003 22.8625 22.825 27.1125 54-55 26.087500000000002 23.65 23.4125 26.85 56-57 26.05 23.8625 23.549999999999997 26.5375 58-59 26.5875 23.2125 23.1375 27.0625 60-61 26.150000000000002 23.9125 22.537499999999998 27.400000000000002 62-63 27.150000000000002 23.3875 23.4375 26.025 64-65 26.887499999999996 23.525 22.287499999999998 27.3 66-67 26.325 22.625 23.974999999999998 27.075 68-69 27.125 23.3375 23.1875 26.35 70-71 27.025 23.1375 23.474999999999998 26.3625 72-73 26.625 22.85 23.3125 27.212500000000002 74-75 26.787499999999998 23.775 22.85 26.5875 76-77 26.875 23.7 22.525000000000002 26.900000000000002 78-79 26.525 22.825 24.325 26.325 80-81 27.5875 21.975 23.674999999999997 26.7625 82-83 27.2625 22.7625 22.95 27.025 84-85 26.3 22.9375 23.65 27.1125 86-87 26.924999999999997 23.925 23.35 25.8 88-89 27.125 23.1375 23.0875 26.650000000000002 90-91 27.237499999999997 23.4375 23.1375 26.187500000000004 92-93 27.11588948618577 23.6029503687961 23.32791598949869 25.95324415551944 94-95 27.3625 23.45 22.925 26.2625 96-97 27.212500000000002 23.375 23.7 25.7125 98-99 27.962500000000002 22.8125 22.8125 26.4125 100 26.875 22.85 22.85 27.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 2.0 29 4.0 30 4.5 31 4.5 32 8.5 33 15.0 34 21.0 35 22.5 36 29.0 37 43.5 38 56.0 39 73.5 40 95.0 41 119.0 42 125.0 43 131.0 44 146.5 45 140.0 46 135.5 47 134.0 48 125.0 49 132.5 50 132.5 51 113.0 52 100.5 53 91.5 54 88.5 55 87.5 56 96.5 57 121.0 58 122.5 59 123.0 60 128.0 61 114.5 62 110.5 63 115.5 64 109.5 65 89.0 66 90.5 67 93.0 68 73.0 69 72.5 70 69.5 71 63.0 72 60.5 73 46.0 74 32.5 75 23.5 76 18.5 77 16.0 78 11.0 79 6.0 80 5.0 81 3.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 11.875 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618243 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618243_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2155 33.0 31.0 34.0 31.0 34.0 2 32.879 34.0 31.0 34.0 31.0 34.0 3 33.02625 34.0 33.0 34.0 31.0 34.0 4 36.4535 37.0 37.0 37.0 35.0 37.0 5 36.46825 37.0 37.0 37.0 35.0 37.0 6 36.485 37.0 37.0 37.0 35.0 37.0 7 36.48275 37.0 37.0 37.0 35.0 37.0 8 36.4895 37.0 37.0 37.0 35.0 37.0 9 38.337 39.0 39.0 39.0 37.0 39.0 10-11 38.3335 39.0 39.0 39.0 37.0 39.0 12-13 38.247125 39.0 39.0 39.0 37.0 39.0 14-15 39.912625 41.0 40.0 41.0 38.0 41.0 16-17 39.739374999999995 41.0 40.0 41.0 37.5 41.0 18-19 39.784875 41.0 40.0 41.0 38.0 41.0 20-21 39.70975 41.0 40.0 41.0 37.5 41.0 22-23 39.687375 41.0 40.0 41.0 37.0 41.0 24-25 39.608999999999995 41.0 39.0 41.0 37.0 41.0 26-27 39.470375000000004 41.0 39.0 41.0 36.0 41.0 28-29 39.365125 40.0 39.0 41.0 36.0 41.0 30-31 39.223375000000004 40.0 39.0 41.0 36.0 41.0 32-33 39.151250000000005 40.0 38.0 41.0 35.0 41.0 34-35 39.019875 40.0 38.0 41.0 35.0 41.0 36-37 38.86825 40.0 38.0 41.0 35.0 41.0 38-39 38.632000000000005 40.0 38.0 41.0 35.0 41.0 40-41 38.427125000000004 40.0 37.0 41.0 34.0 41.0 42-43 38.19325 40.0 37.0 41.0 34.0 41.0 44-45 37.884375 39.5 36.0 41.0 33.0 41.0 46-47 37.607875 39.0 35.0 41.0 33.0 41.0 48-49 37.453 39.0 35.0 41.0 33.0 41.0 50-51 36.945625 38.0 34.5 40.0 32.0 40.5 52-53 36.9805 38.0 35.0 40.0 33.0 41.0 54-55 37.164625 38.0 35.0 41.0 33.0 41.0 56-57 37.053375 37.5 35.0 41.0 33.0 41.0 58-59 36.807 37.0 35.0 40.0 33.0 41.0 60-61 36.506375000000006 36.5 35.0 40.0 32.5 41.0 62-63 36.2435 36.0 35.0 40.0 32.5 41.0 64-65 35.938 35.0 35.0 39.0 32.0 41.0 66-67 35.65175 35.0 35.0 39.0 31.5 41.0 68-69 35.36475 35.0 34.0 38.0 31.0 40.5 70-71 35.073750000000004 35.0 34.0 37.0 31.0 40.0 72-73 34.70375 35.0 34.0 37.0 31.0 39.0 74-75 34.390125 35.0 34.0 36.0 30.0 39.0 76-77 34.1255 35.0 33.0 36.0 30.0 37.5 78-79 33.876625000000004 35.0 33.5 35.0 29.5 37.0 80-81 33.550875 35.0 33.0 35.0 29.0 37.0 82-83 33.4045 35.0 33.0 35.0 29.0 36.0 84-85 33.120999999999995 35.0 33.0 35.0 29.0 36.0 86-87 32.782875000000004 35.0 33.0 35.0 27.0 36.0 88-89 32.605000000000004 35.0 32.5 35.0 27.0 35.0 90-91 32.328500000000005 35.0 32.0 35.0 27.0 35.0 92-93 31.98375 34.5 32.0 35.0 26.0 35.0 94-95 31.54825 34.0 31.0 35.0 24.5 35.0 96-97 31.127625000000002 34.0 31.0 35.0 24.0 35.0 98-99 30.651625 34.0 31.0 35.0 23.0 35.0 100 30.26025 34.0 31.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.4363327674023765 1101 2 0.07523344651952613 1101 3 0.11311544991510658 1101 4 0.05475382003395168 1101 5 0.05878607809847125 1101 6 0.06016553480475295 1101 7 0.032364176570460756 1101 8 -0.011672325976235243 1101 9 0.10430814940576738 1101 10-11 6.366723259816354E-4 1101 12-13 -0.06976867572156209 1101 14-15 0.07974320882852481 1101 16-17 -0.06085526315789025 1101 18-19 0.11497241086587451 1101 20-21 0.18521859083191572 1101 22-23 0.07539261460102153 1101 24-25 -0.00817062818336467 1101 26-27 -0.061598047538204526 1101 28-29 0.009125636672330018 1101 30-31 0.07470288624787713 1101 32-33 0.007746179966041211 1101 34-35 0.04117147707979285 1101 36-37 -0.05581494057724967 1101 38-39 0.03209889643463271 1101 40-41 0.03581281833616856 1101 42-43 -0.12181663837012024 1101 44-45 0.03846561969439932 1101 46-47 -0.1547113752122229 1101 48-49 -0.1030878607809882 1101 50-51 0.07687818336163588 1101 52-53 0.09629668930390523 1101 54-55 -0.047432088285226826 1101 56-57 -0.023928268251275142 1101 58-59 0.12616723259762352 1101 60-61 -0.24092741935483986 1101 62-63 -0.30480687606112156 1101 64-65 -0.08653438030560068 1101 66-67 0.04117147707979285 1101 68-69 -0.029923599320881067 1101 70-71 -0.08759550084889867 1101 72-73 -0.28666171477080127 1101 74-75 -0.2717529711375164 1101 76-77 -0.2316956706281843 1101 78-79 -0.10680178268250984 1101 80-81 -0.32464983022071436 1101 82-83 -0.19004668930390523 1101 84-85 -0.15715195246179547 1101 86-87 -0.30772495755518037 1101 88-89 -0.21301994906621502 1101 90-91 -0.3196095076400667 1101 92-93 -0.5293930390492356 1101 94-95 -0.3693230050933778 1101 96-97 -0.5032364176570461 1101 98-99 -0.421105687606115 1101 100 -0.06303056027164544 1103 1 -0.43633276740238003 1103 2 -0.07523344651952613 1103 3 -0.11311544991511369 1103 4 -0.05475382003395879 1103 5 -0.05878607809847125 1103 6 -0.06016553480476006 1103 7 -0.032364176570460756 1103 8 0.011672325976228137 1103 9 -0.10430814940577449 1103 10-11 -6.366723259745299E-4 1103 12-13 0.06976867572156209 1103 14-15 -0.07974320882852481 1103 16-17 0.060855263157897355 1103 18-19 -0.11497241086587451 1103 20-21 -0.18521859083191572 1103 22-23 -0.07539261460101443 1103 24-25 0.00817062818336467 1103 26-27 0.06159804753819742 1103 28-29 -0.009125636672322912 1103 30-31 -0.07470288624787713 1103 32-33 -0.007746179966041211 1103 34-35 -0.041171477079799956 1103 36-37 0.05581494057724257 1103 38-39 -0.03209889643463271 1103 40-41 -0.035812818336161456 1103 42-43 0.12181663837012024 1103 44-45 -0.03846561969439932 1103 46-47 0.1547113752122229 1103 48-49 0.1030878607809882 1103 50-51 -0.07687818336162877 1103 52-53 -0.09629668930390523 1103 54-55 0.04743208828523393 1103 56-57 0.023928268251268037 1103 58-59 -0.12616723259762352 1103 60-61 0.24092741935483986 1103 62-63 0.30480687606111445 1103 64-65 0.08653438030560068 1103 66-67 -0.04117147707979285 1103 68-69 0.029923599320888172 1103 70-71 0.08759550084889156 1103 72-73 0.28666171477080127 1103 74-75 0.2717529711375235 1103 76-77 0.2316956706281843 1103 78-79 0.10680178268250984 1103 80-81 0.32464983022071436 1103 82-83 0.19004668930389812 1103 84-85 0.15715195246180258 1103 86-87 0.30772495755518037 1103 88-89 0.21301994906621502 1103 90-91 0.3196095076400667 1103 92-93 0.5293930390492356 1103 94-95 0.3693230050933778 1103 96-97 0.5032364176570496 1103 98-99 0.42110568760611145 1103 100 0.063030560271649 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 2.0 26 3.0 27 14.0 28 28.0 29 50.0 30 75.0 31 115.0 32 117.0 33 216.0 34 289.0 35 513.0 36 708.0 37 856.0 38 869.0 39 145.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.9 9.950000000000001 11.975 49.175000000000004 2 26.825 18.775 31.45 22.95 3 27.075 22.2 22.15 28.575 4 28.7 27.400000000000002 16.5 27.400000000000002 5 29.549999999999997 28.875 19.8 21.775 6 22.25 31.924999999999997 20.200000000000003 25.624999999999996 7 22.175 14.6 38.05 25.174999999999997 8 22.85 19.075 24.175 33.900000000000006 9 22.675 17.8 27.700000000000003 31.825 10-11 27.161266107844362 26.873514325034403 18.966595771299886 26.99862379582134 12-13 25.13442540952857 20.520195073152433 25.909716143553833 28.435663373765163 14-15 25.7375 23.325000000000003 23.974999999999998 26.9625 16-17 26.224999999999998 22.8 22.95 28.025 18-19 26.9125 23.5875 22.912499999999998 26.5875 20-21 26.174999999999997 23.775 23.4375 26.6125 22-23 26.187500000000004 23.474999999999998 23.3625 26.974999999999998 24-25 25.825 24.8 22.1 27.275 26-27 26.575 23.9375 22.537499999999998 26.950000000000003 28-29 26.35 23.400000000000002 22.5875 27.6625 30-31 25.5375 23.5875 22.9625 27.9125 32-33 25.874999999999996 24.0125 22.7375 27.375 34-35 26.687499999999996 22.75 23.1625 27.400000000000002 36-37 26.650000000000002 23.7125 23.025000000000002 26.6125 38-39 26.087500000000002 23.575 23.4625 26.875 40-41 26.6125 23.799999999999997 22.7375 26.85 42-43 25.0625 22.975 23.75 28.212500000000002 44-45 25.2625 24.45 23.2625 27.025 46-47 26.987499999999997 22.8125 22.325 27.875 48-49 26.0 23.075000000000003 22.975 27.950000000000003 50-51 26.0375 23.7875 23.225 26.950000000000003 52-53 26.325 24.0625 22.625 26.987499999999997 54-55 26.474999999999998 23.4625 23.1125 26.950000000000003 56-57 25.587500000000002 23.9125 23.3125 27.187499999999996 58-59 27.037499999999998 23.974999999999998 23.0125 25.974999999999998 60-61 25.35 23.9 23.3875 27.3625 62-63 26.4125 23.5875 23.7125 26.2875 64-65 26.7625 23.6625 22.3875 27.187499999999996 66-67 25.7 23.0375 23.4125 27.85 68-69 26.0 24.025 22.8125 27.1625 70-71 26.2125 23.2625 23.575 26.950000000000003 72-73 25.7875 23.4625 23.6875 27.0625 74-75 26.6 24.0 23.724999999999998 25.674999999999997 76-77 26.737499999999997 22.912499999999998 23.575 26.775 78-79 26.2125 23.45 23.0875 27.250000000000004 80-81 26.4125 23.45 23.7625 26.375 82-83 27.375 23.425 23.0 26.200000000000003 84-85 26.450000000000003 22.05 23.9375 27.5625 86-87 26.9625 22.9875 23.7 26.35 88-89 27.525 23.1875 22.287499999999998 27.0 90-91 26.900000000000002 23.674999999999997 22.5625 26.8625 92-93 26.2875 23.25 23.3375 27.125 94-95 27.737499999999997 23.1125 22.412499999999998 26.737499999999997 96-97 27.125 23.2875 23.8375 25.75 98-99 26.937499999999996 22.7375 23.674999999999997 26.650000000000002 100 27.525 24.15 22.6 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 2.0 29 1.5 30 4.0 31 5.0 32 8.5 33 15.0 34 22.5 35 28.0 36 36.5 37 56.0 38 64.0 39 68.5 40 81.5 41 106.0 42 122.5 43 125.5 44 134.0 45 138.0 46 146.0 47 149.0 48 140.5 49 133.0 50 136.0 51 127.5 52 108.0 53 93.0 54 87.0 55 89.5 56 93.5 57 103.5 58 110.5 59 110.0 60 110.5 61 112.0 62 109.5 63 99.5 64 97.5 65 105.5 66 103.5 67 87.0 68 79.0 69 71.0 70 59.5 71 59.0 72 53.0 73 54.0 74 48.5 75 29.0 76 21.0 77 22.5 78 17.5 79 6.5 80 1.0 81 1.0 82 1.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.08750000000000001 12-13 0.0375 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24433249370277 98.5 2 0.7556675062972292 1.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554615 spots for SRR8618243.sra Written 554615 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra Read 554606 spots for SRR8618243.sra Written 554606 spots for SRR8618243.sra SRR ids: ['SRR8618243.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m3udj38n SRR8618243.sra spots: 11092129 blocks: [[1, 554606], [554607, 1109212], [1109213, 1663818], [1663819, 2218424], [2218425, 2773030], [2773031, 3327636], [3327637, 3882242], [3882243, 4436848], [4436849, 4991454], [4991455, 5546060], [5546061, 6100666], [6100667, 6655272], [6655273, 7209878], [7209879, 7764484], [7764485, 8319090], [8319091, 8873696], [8873697, 9428302], [9428303, 9982908], [9982909, 10537514], [10537515, 11092129]] SRR8618243 file size 2886580 SRR8618243 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618243 SRR8618243_1.fastq SRR8618243_2.fastq Input file: SRR8618243_1.fastq Paired file: SRR8618243_2.fastq trimmed: SRR8618243-trimmed-pair1.fastq, SRR8618243-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:44:02 2024 >> started Sat Dec 7 09:44:13 2024 >> done (11.160s) 11092129 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11092129 (100.00%) read pairs available; of these: 1504123 (13.56%) trimmed read pairs available after processing 9588006 (86.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 6 0.00% 82 28 0.00% 83 87 0.00% 84 4688 0.04% 85 5033 0.05% 86 5545 0.05% 87 6514 0.06% 88 7855 0.07% 89 10151 0.09% 90 16597 0.15% 91 31711 0.29% 92 46311 0.42% 93 65182 0.59% 94 89522 0.81% 95 115932 1.05% 96 155726 1.40% 97 218537 1.97% 98 309573 2.79% 99 415125 3.74% 100 9588006 86.44% 11092129 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=25 prefix-density=0.51 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=36 fanout-score=43.69 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.3 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.45 fanout-score-rank=12 prefix-density=0.47 prefix-fanout=3.8 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=36 fanout-score=40.94 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=8.9 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618243 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:44:56 Started mapping on | Dec 07 09:44:56 Finished on | Dec 07 09:45:32 Mapping speed, Million of reads per hour | 1109.21 Number of input reads | 11092129 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10810355 Uniquely mapped reads % | 97.46% Average mapped length | 198.15 Number of splices: Total | 6781881 Number of splices: Annotated (sjdb) | 6455067 Number of splices: GT/AG | 6682775 Number of splices: GC/AG | 80268 Number of splices: AT/AC | 2084 Number of splices: Non-canonical | 16754 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 111797 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 9156 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 169977 169977 169977 N_multimapping 111797 111797 111797 N_noFeature 275141 5421712 5459949 N_ambiguous 245454 21266 21816 UnstrandedReadsAssigned:10289760 PositiveStrandReadsAssigned:5367377 NegativeStrandReadsAssigned:5328590 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618243 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618243-trimmed-pair1.fastq SRR8618243-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,092,129 reads, 10,493,668 reads pseudoaligned [quant] estimated average fragment length: 167.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR8618243.ke.tsv 35125 SRR8618243.se.tsv 88098 total ==> SRR8618243.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.887 0 0 PNS24247 1044 877.726 16.7931 2.51364 PNS24249 1928 1761.73 63.9132 4.76632 PNS24246 1044 877.726 16.7931 2.51364 PNS24248 1044 877.726 16.7931 2.51364 PNS24244 1471 1304.73 10.7075 1.07821 PNS24243 293 134.407 4 3.90993 KQK14069 1603 1436.73 2940.58 268.9 KQK14071 474 309.164 347.943 147.86 ==> SRR8618243.se.tsv <== BRADI_1g14170v3 3558 BRADI_1g53295v3 199 BRADI_1g59795v3 225 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 226 BRADI_1g74790v3 22 BRADI_1g09890v3 1 BRADI_1g77505v3 127 BRADI_1g48960v3 0 SRR8618243 completed mapping pipeline successfully