Starting /dee2/code/volunteer_pipeline.sh SRR8618244 current disk space = 1544043802624 free memory = 1597559536 SRR8618244 SRAfilesize 15aad0f11d78f1979d1b0e0c2363dd28 SRR8618244.sra SRR8618244.sra file validated SRR8618244 is paired end SRR8618244 is conventional basespace SRR8618244 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618244_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9875 34.0 31.0 34.0 31.0 34.0 2 33.186 34.0 33.0 34.0 31.0 34.0 3 33.25325 34.0 34.0 34.0 31.0 34.0 4 29.60975 37.0 35.0 37.0 2.0 37.0 5 32.9895 37.0 35.0 37.0 19.0 37.0 6 35.48625 37.0 35.0 37.0 32.0 37.0 7 36.091 37.0 35.0 37.0 35.0 37.0 8 36.22325 37.0 35.0 37.0 35.0 37.0 9 38.28825 39.0 39.0 39.0 37.0 39.0 10-11 38.312625 39.0 39.0 39.0 37.0 39.0 12-13 38.336625 39.0 39.0 39.0 37.0 39.0 14-15 39.860375000000005 41.0 40.0 41.0 38.0 41.0 16-17 39.782250000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.798874999999995 41.0 40.0 41.0 38.0 41.0 20-21 39.684 41.0 40.0 41.0 37.0 41.0 22-23 39.514875 41.0 39.0 41.0 37.0 41.0 24-25 39.431375 40.0 39.0 41.0 36.5 41.0 26-27 39.332375 40.0 39.0 41.0 36.0 41.0 28-29 39.194125 40.0 38.5 41.0 36.0 41.0 30-31 38.802375 40.0 38.0 41.0 34.5 41.0 32-33 38.88075 40.0 38.0 41.0 35.0 41.0 34-35 39.139875 40.0 38.5 41.0 35.0 41.0 36-37 39.139625 40.0 38.0 41.0 35.0 41.0 38-39 38.907 40.0 38.0 41.0 35.0 41.0 40-41 38.76475 40.0 38.0 41.0 35.0 41.0 42-43 38.573 40.0 37.0 41.0 35.0 41.0 44-45 38.3545 40.0 36.5 41.0 34.0 41.0 46-47 38.1785 40.0 35.5 41.0 34.0 41.0 48-49 37.899125 39.0 35.0 41.0 34.0 41.0 50-51 37.61175 39.0 35.0 41.0 33.0 41.0 52-53 37.403875 38.5 35.0 41.0 33.0 41.0 54-55 37.083 38.0 35.0 41.0 33.0 41.0 56-57 36.830625 37.0 35.0 40.5 33.0 41.0 58-59 36.604625 36.5 35.0 40.0 33.0 41.0 60-61 36.253375 36.0 35.0 40.0 32.0 41.0 62-63 36.00625 35.5 35.0 39.5 32.0 41.0 64-65 35.720124999999996 35.0 34.5 39.0 31.5 41.0 66-67 35.42375 35.0 34.0 38.5 31.0 40.5 68-69 35.032624999999996 35.0 34.0 37.5 31.0 40.0 70-71 34.709625 35.0 34.0 37.0 30.5 39.5 72-73 34.452375 35.0 34.0 36.5 30.0 39.0 74-75 34.1455 35.0 33.5 36.0 29.5 39.0 76-77 33.286249999999995 34.5 32.5 35.0 28.5 37.0 78-79 33.695750000000004 35.0 33.0 35.0 29.0 37.0 80-81 33.66975 35.0 33.0 35.0 30.0 36.5 82-83 33.498999999999995 35.0 33.0 35.0 29.5 36.0 84-85 33.288624999999996 35.0 33.0 35.0 29.0 36.0 86-87 33.01975 35.0 33.0 35.0 29.0 35.5 88-89 32.732124999999996 35.0 33.0 35.0 28.0 35.0 90-91 32.349999999999994 35.0 32.5 35.0 27.0 35.0 92-93 32.1325 34.0 32.0 35.0 27.0 35.0 94-95 32.042125 34.5 32.0 35.0 27.0 35.0 96-97 31.633625000000002 34.0 32.0 35.0 25.0 35.0 98-99 31.163125 34.0 32.0 35.0 24.5 35.0 100 30.7615 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.1480368589743577 1101 2 0.1726762820512846 1101 3 0.1618589743589709 1101 4 -1.13701923076923 1101 5 -0.4853766025641022 1101 6 -0.0709134615384599 1101 7 0.0442708333333357 1101 8 0.2365785256410291 1101 9 0.0316506410256423 1101 10-11 0.1959134615384599 1101 12-13 0.2231570512820511 1101 14-15 0.2588141025641022 1101 16-17 0.1014623397435912 1101 18-19 0.0867387820512775 1101 20-21 0.2473958333333357 1101 22-23 0.32421875 1101 24-25 0.1239983974358978 1101 26-27 0.1776842948717956 1101 28-29 0.182491987179489 1101 30-31 0.021834935897430796 1101 32-33 0.1426282051282044 1101 34-35 0.1036658653846132 1101 36-37 0.0302483974358978 1101 38-39 0.005008012820510999 1101 40-41 -0.1370192307692335 1101 42-43 0.0391626602564088 1101 44-45 0.0771233974358978 1101 46-47 0.1429286858974379 1101 48-49 -0.017828525641029103 1101 50-51 -0.1154847756410291 1101 52-53 -0.0364583333333357 1101 54-55 -0.028545673076919797 1101 56-57 -0.0389623397435912 1101 58-59 -0.0756209935897374 1101 60-61 0.1254006410256423 1101 62-63 0.0712139423076934 1101 64-65 -0.0912459935897445 1101 66-67 -0.1491386217948687 1101 68-69 -0.1284054487179489 1101 70-71 -0.3935296474358978 1101 72-73 -0.0332532051282044 1101 74-75 -0.2871594551282044 1101 76-77 -0.0018028846153868017 1101 78-79 0.002604166666664298 1101 80-81 0.1286057692307665 1101 82-83 -0.032652243589737395 1101 84-85 -0.0392628205128176 1101 86-87 -0.2110376602564088 1101 88-89 -0.2660256410256423 1101 90-91 -0.3341346153846132 1101 92-93 -0.3480568910256423 1101 94-95 -0.1858974358974308 1101 96-97 -0.34685496794871895 1101 98-99 -0.5951522435897445 1101 100 -0.73076923076923 1104 1 -0.1480368589743648 1104 2 -0.1726762820512846 1104 3 -0.161858974358978 1104 4 1.13701923076923 1104 5 0.4853766025641022 1104 6 0.0709134615384599 1104 7 -0.044270833333328596 1104 8 -0.236578525641022 1104 9 -0.031650641025635196 1104 10-11 -0.1959134615384599 1104 12-13 -0.2231570512820511 1104 14-15 -0.2588141025641093 1104 16-17 -0.1014623397435912 1104 18-19 -0.0867387820512846 1104 20-21 -0.2473958333333357 1104 22-23 -0.32421875 1104 24-25 -0.1239983974358978 1104 26-27 -0.1776842948717956 1104 28-29 -0.182491987179489 1104 30-31 -0.0218349358974379 1104 32-33 -0.1426282051282044 1104 34-35 -0.1036658653846132 1104 36-37 -0.030248397435890695 1104 38-39 -0.005008012820510999 1104 40-41 0.1370192307692335 1104 42-43 -0.039162660256415904 1104 44-45 -0.0771233974358978 1104 46-47 -0.1429286858974379 1104 48-49 0.017828525641029103 1104 50-51 0.1154847756410291 1104 52-53 0.036458333333328596 1104 54-55 0.028545673076926903 1104 56-57 0.0389623397435912 1104 58-59 0.0756209935897445 1104 60-61 -0.1254006410256423 1104 62-63 -0.0712139423076934 1104 64-65 0.0912459935897516 1104 66-67 0.1491386217948758 1104 68-69 0.1284054487179418 1104 70-71 0.3935296474358907 1104 72-73 0.0332532051282044 1104 74-75 0.2871594551282044 1104 76-77 0.0018028846153868017 1104 78-79 -0.0026041666666714036 1104 80-81 -0.1286057692307665 1104 82-83 0.0326522435897445 1104 84-85 0.0392628205128176 1104 86-87 0.2110376602564088 1104 88-89 0.2660256410256423 1104 90-91 0.3341346153846203 1104 92-93 0.3480568910256352 1104 94-95 0.1858974358974379 1104 96-97 0.34685496794871895 1104 98-99 0.5951522435897445 1104 100 0.73076923076923 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 3.0 27 11.0 28 32.0 29 50.0 30 79.0 31 109.0 32 149.0 33 199.0 34 299.0 35 511.0 36 755.0 37 917.0 38 764.0 39 121.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.700000000000003 10.299999999999999 14.274999999999999 47.725 2 24.925 17.95 32.824999999999996 24.3 3 27.175 20.974999999999998 23.45 28.4 4 28.450704225352112 26.134585289514867 17.30829420970266 28.106416275430362 5 30.925000000000004 29.349999999999998 17.424999999999997 22.3 6 23.95 32.125 19.175 24.75 7 21.349999999999998 14.524999999999999 38.7 25.424999999999997 8 23.1 19.125 25.374999999999996 32.4 9 23.075000000000003 18.55 28.075 30.3 10-11 26.25 27.55 18.3625 27.8375 12-13 24.6 21.3875 25.687500000000004 28.325 14-15 25.424999999999997 23.3875 23.75 27.437499999999996 16-17 26.125 22.3875 22.662499999999998 28.825 18-19 26.737499999999997 23.549999999999997 22.4875 27.224999999999998 20-21 26.787499999999998 23.8625 22.6125 26.737499999999997 22-23 26.437500000000004 23.674999999999997 22.400000000000002 27.487499999999997 24-25 26.0625 23.325000000000003 22.9375 27.675 26-27 26.5125 22.725 23.45 27.3125 28-29 26.7625 22.8875 22.675 27.675 30-31 25.924999999999997 22.225 24.2375 27.6125 32-33 25.8625 23.7375 23.7625 26.637499999999996 34-35 27.1625 23.1375 22.75 26.950000000000003 36-37 26.087500000000002 23.1625 22.8875 27.8625 38-39 25.4625 23.9 22.6875 27.950000000000003 40-41 26.2875 22.675 22.175 28.8625 42-43 26.6125 22.6875 23.474999999999998 27.224999999999998 44-45 26.337500000000002 23.25 23.1 27.3125 46-47 26.5 23.625 22.4625 27.4125 48-49 26.9625 22.925 23.025000000000002 27.0875 50-51 26.075 22.7125 23.4875 27.725 52-53 25.974999999999998 21.987499999999997 23.4625 28.575 54-55 26.4625 23.125 23.0375 27.375 56-57 27.287499999999998 23.2625 23.0875 26.3625 58-59 26.674999999999997 23.6125 22.075 27.6375 60-61 26.5 23.45 22.912499999999998 27.1375 62-63 25.374999999999996 24.5375 22.575 27.5125 64-65 26.5 22.287499999999998 23.7125 27.500000000000004 66-67 26.087500000000002 22.925 23.8125 27.175 68-69 26.825 22.6875 23.075000000000003 27.4125 70-71 26.7125 24.325 22.825 26.137500000000003 72-73 26.7125 22.675 22.925 27.6875 74-75 27.250000000000004 22.912499999999998 23.8625 25.974999999999998 76-77 27.1125 22.8875 22.7625 27.237499999999997 78-79 26.987499999999997 23.2875 22.725 27.0 80-81 25.7625 24.224999999999998 23.3 26.7125 82-83 26.987499999999997 23.7125 22.5 26.8 84-85 27.35 22.8625 22.662499999999998 27.125 86-87 26.650000000000002 22.925 22.9875 27.437499999999996 88-89 27.575 22.912499999999998 22.5875 26.924999999999997 90-91 26.450000000000003 24.0625 22.2 27.287499999999998 92-93 26.881720430107524 23.943485871467868 22.53063265816454 26.644161040260066 94-95 27.575 22.95 22.037499999999998 27.437499999999996 96-97 27.175 22.5875 23.75 26.487500000000004 98-99 26.6125 23.25 22.975 27.1625 100 28.075 22.625 22.125 27.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 0.0 27 0.5 28 1.5 29 4.0 30 5.5 31 6.5 32 9.0 33 13.5 34 16.0 35 21.5 36 34.5 37 44.5 38 56.5 39 77.5 40 91.5 41 96.5 42 105.0 43 119.5 44 141.5 45 150.5 46 147.0 47 145.0 48 133.5 49 123.0 50 126.5 51 122.0 52 109.0 53 101.5 54 88.5 55 81.5 56 91.0 57 97.5 58 106.5 59 122.5 60 133.0 61 123.5 62 106.0 63 106.5 64 119.5 65 100.5 66 80.5 67 89.0 68 92.0 69 86.0 70 71.0 71 64.5 72 59.0 73 46.0 74 37.0 75 27.0 76 17.0 77 15.5 78 12.0 79 7.5 80 5.0 81 3.0 82 3.0 83 2.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 20.125 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618244 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618244_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0715 33.0 31.0 34.0 31.0 34.0 2 32.82875 34.0 31.0 34.0 31.0 34.0 3 32.9925 34.0 31.0 34.0 31.0 34.0 4 36.50425 37.0 37.0 37.0 35.0 37.0 5 36.4595 37.0 37.0 37.0 35.0 37.0 6 36.501 37.0 37.0 37.0 35.0 37.0 7 36.48675 37.0 37.0 37.0 35.0 37.0 8 36.504 37.0 37.0 37.0 35.0 37.0 9 38.32925 39.0 39.0 39.0 37.0 39.0 10-11 38.315625 39.0 39.0 39.0 37.0 39.0 12-13 38.272999999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.843875 41.0 40.0 41.0 38.0 41.0 16-17 39.7355 41.0 40.0 41.0 37.5 41.0 18-19 39.766625 41.0 40.0 41.0 37.5 41.0 20-21 39.72375 41.0 40.0 41.0 37.0 41.0 22-23 39.611625000000004 41.0 39.5 41.0 37.0 41.0 24-25 39.552499999999995 41.0 39.0 41.0 37.0 41.0 26-27 39.444 41.0 39.0 41.0 36.0 41.0 28-29 39.30525 40.0 39.0 41.0 36.0 41.0 30-31 39.175250000000005 40.0 38.5 41.0 35.5 41.0 32-33 39.147625 40.0 38.0 41.0 35.0 41.0 34-35 38.974125 40.0 38.0 41.0 35.0 41.0 36-37 38.82075 40.0 38.0 41.0 35.0 41.0 38-39 38.574 40.0 37.5 41.0 34.5 41.0 40-41 38.411375 40.0 37.0 41.0 34.5 41.0 42-43 38.078374999999994 40.0 36.5 41.0 33.5 41.0 44-45 37.809625 39.0 35.5 41.0 33.0 41.0 46-47 37.448875 39.0 35.0 41.0 33.0 41.0 48-49 37.420874999999995 39.0 35.0 41.0 33.0 41.0 50-51 37.003 38.5 34.5 40.0 32.5 40.5 52-53 37.005375 38.0 35.0 40.0 33.0 41.0 54-55 37.132374999999996 38.0 35.0 41.0 33.0 41.0 56-57 37.074749999999995 37.5 35.0 41.0 33.0 41.0 58-59 36.759375000000006 37.0 35.0 40.0 33.0 41.0 60-61 36.474125 36.0 35.0 40.0 33.0 41.0 62-63 36.153125 36.0 35.0 39.5 32.5 41.0 64-65 35.78125 35.0 35.0 39.0 31.5 41.0 66-67 35.550875000000005 35.0 34.5 39.0 31.0 41.0 68-69 35.296 35.0 34.0 37.5 31.0 40.5 70-71 35.064125000000004 35.0 34.0 37.0 31.0 39.5 72-73 34.70025 35.0 34.0 36.5 30.5 39.0 74-75 34.2795 35.0 34.0 36.0 30.0 39.0 76-77 34.059625 35.0 33.5 35.5 29.5 37.5 78-79 33.790375 35.0 33.0 35.0 29.0 37.0 80-81 33.643625 35.0 33.0 35.0 29.0 36.5 82-83 33.479 35.0 33.0 35.0 29.5 36.0 84-85 33.074375 35.0 33.0 35.0 28.5 36.0 86-87 32.8965 35.0 33.0 35.0 29.0 35.5 88-89 32.650875 35.0 32.5 35.0 27.0 35.0 90-91 32.432125 35.0 32.0 35.0 27.0 35.0 92-93 32.121125 34.5 32.0 35.0 27.0 35.0 94-95 31.766125000000002 34.0 32.0 35.0 24.5 35.0 96-97 31.438625000000002 34.0 31.0 35.0 24.5 35.0 98-99 30.971375000000002 34.0 31.0 35.0 23.5 35.0 100 30.692 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.2105368589743577 1101 2 0.2618189102564088 1101 3 0.1099759615384599 1101 4 0.0392628205128247 1101 5 0.0402644230769198 1101 6 0.1005608974358978 1101 7 0.1233974358974379 1101 8 0.1163862179487154 1101 9 0.1570512820512846 1101 10-11 0.2493990384615401 1101 12-13 0.28125 1101 14-15 0.1609575320512775 1101 16-17 0.009615384615386802 1101 18-19 0.1953125 1101 20-21 0.2072315705128247 1101 22-23 0.1046674679487225 1101 24-25 0.1653645833333357 1101 26-27 0.1373197115384599 1101 28-29 0.2623197115384599 1101 30-31 0.1782852564102555 1101 32-33 0.1682692307692264 1101 34-35 0.4146634615384599 1101 36-37 0.1477363782051242 1101 38-39 0.1020633012820511 1101 40-41 0.1477363782051242 1101 42-43 0.2264623397435912 1101 44-45 0.1368189102564088 1101 46-47 0.0199318910256423 1101 48-49 -0.1915064102564159 1101 50-51 0.1533453525641022 1101 52-53 0.0647035256410291 1101 54-55 -0.0733173076923066 1101 56-57 0.0047075320512774965 1101 58-59 -0.0704126602564088 1101 60-61 -0.1126802884615401 1101 62-63 0.0318509615384599 1101 64-65 -0.2132411858974308 1101 66-67 -0.2027243589743577 1101 68-69 -0.1410256410256423 1101 70-71 -0.0698116987179489 1101 72-73 0.0419671474358978 1101 74-75 -0.037960737179489 1101 76-77 0.0832331730769198 1101 78-79 -0.1172876602564088 1101 80-81 0.0360576923076934 1101 82-83 0.0047075320512774965 1101 84-85 -0.1758814102564088 1101 86-87 -0.030548878205124197 1101 88-89 -0.2437900641025692 1101 90-91 -0.1243990384615401 1101 92-93 -0.0289463141025621 1101 94-95 -0.42768429487179205 1101 96-97 -0.2911658653846132 1101 98-99 -0.600761217948719 1101 100 -0.4951923076923066 1104 1 -0.21053685897436125 1104 2 -0.2618189102564088 1104 3 -0.1099759615384599 1104 4 -0.0392628205128176 1104 5 -0.0402644230769269 1104 6 -0.1005608974358978 1104 7 -0.1233974358974379 1104 8 -0.1163862179487154 1104 9 -0.1570512820512846 1104 10-11 -0.2493990384615401 1104 12-13 -0.28125 1104 14-15 -0.1609575320512775 1104 16-17 -0.009615384615386802 1104 18-19 -0.1953125 1104 20-21 -0.2072315705128176 1104 22-23 -0.1046674679487154 1104 24-25 -0.1653645833333286 1104 26-27 -0.1373197115384599 1104 28-29 -0.2623197115384599 1104 30-31 -0.1782852564102555 1104 32-33 -0.1682692307692335 1104 34-35 -0.4146634615384599 1104 36-37 -0.1477363782051242 1104 38-39 -0.1020633012820511 1104 40-41 -0.1477363782051242 1104 42-43 -0.2264623397435841 1104 44-45 -0.1368189102564088 1104 46-47 -0.0199318910256423 1104 48-49 0.1915064102564159 1104 50-51 -0.1533453525641022 1104 52-53 -0.0647035256410291 1104 54-55 0.0733173076923066 1104 56-57 -0.0047075320512774965 1104 58-59 0.0704126602564088 1104 60-61 0.1126802884615401 1104 62-63 -0.0318509615384599 1104 64-65 0.2132411858974379 1104 66-67 0.2027243589743577 1104 68-69 0.1410256410256423 1104 70-71 0.0698116987179489 1104 72-73 -0.041967147435890695 1104 74-75 0.037960737179489 1104 76-77 -0.0832331730769269 1104 78-79 0.1172876602564159 1104 80-81 -0.0360576923076934 1104 82-83 -0.0047075320512774965 1104 84-85 0.1758814102564159 1104 86-87 0.030548878205124197 1104 88-89 0.2437900641025692 1104 90-91 0.1243990384615401 1104 92-93 0.028946314102569204 1104 94-95 0.42768429487179205 1104 96-97 0.29116586538461675 1104 98-99 0.600761217948719 1104 100 0.49519230769231015 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 13.0 28 41.0 29 62.0 30 74.0 31 105.0 32 120.0 33 177.0 34 296.0 35 479.0 36 766.0 37 878.0 38 843.0 39 143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.650000000000002 9.175 14.025000000000002 49.15 2 26.3 17.724999999999998 32.2 23.775 3 25.924999999999997 21.725 23.400000000000002 28.95 4 29.299999999999997 26.724999999999998 17.0 26.974999999999998 5 30.349999999999998 29.4 18.8 21.45 6 22.05 32.625 19.25 26.075 7 21.125 13.725000000000001 37.95 27.200000000000003 8 22.900000000000002 18.775 24.6 33.725 9 22.975 19.475 27.800000000000004 29.75 10-11 27.120340255191394 26.957718288716535 18.663997998498875 27.257943457593193 12-13 25.415676959619955 21.102637829728714 25.353169146143266 28.128516064508062 14-15 26.6625 22.1875 23.175 27.975 16-17 26.4625 22.725 23.2625 27.55 18-19 26.4125 23.025000000000002 22.8 27.762500000000003 20-21 27.287499999999998 23.0 23.1875 26.525 22-23 26.6 24.1125 22.725 26.5625 24-25 26.8125 23.925 22.475 26.787499999999998 26-27 26.0 23.8625 23.175 26.9625 28-29 26.2875 23.0375 23.0125 27.6625 30-31 25.25 23.4625 23.4125 27.875 32-33 26.650000000000002 23.474999999999998 23.674999999999997 26.200000000000003 34-35 26.4625 22.0625 23.625 27.85 36-37 25.85 22.662499999999998 23.125 28.3625 38-39 26.787499999999998 23.6375 23.1875 26.387500000000003 40-41 26.174999999999997 23.1 22.9875 27.737499999999997 42-43 26.6625 23.7 22.3 27.3375 44-45 26.487500000000004 22.8875 22.725 27.900000000000002 46-47 27.2625 22.4625 23.7625 26.5125 48-49 25.900000000000002 22.975 23.05 28.075 50-51 27.287499999999998 23.325000000000003 23.2125 26.174999999999997 52-53 26.9125 23.2625 22.475 27.35 54-55 25.4625 23.775 23.2875 27.474999999999998 56-57 26.1125 22.8125 23.962500000000002 27.1125 58-59 27.525 22.9625 23.175 26.337500000000002 60-61 26.0 23.825 22.287499999999998 27.8875 62-63 26.5875 23.375 22.95 27.0875 64-65 26.9625 22.9625 22.95 27.125 66-67 25.775 23.3375 22.575 28.3125 68-69 26.337500000000002 23.1875 23.75 26.724999999999998 70-71 26.637499999999996 23.05 23.425 26.887499999999996 72-73 27.0125 23.1 23.125 26.7625 74-75 26.974999999999998 23.1875 23.1 26.737499999999997 76-77 27.450000000000003 23.3375 22.775000000000002 26.437500000000004 78-79 26.525 23.925 22.975 26.575 80-81 26.1625 23.8625 22.925 27.05 82-83 27.150000000000002 23.2125 22.6875 26.950000000000003 84-85 26.974999999999998 23.4375 23.1 26.487500000000004 86-87 27.1 22.9875 22.900000000000002 27.0125 88-89 27.150000000000002 22.1875 24.05 26.6125 90-91 27.1125 23.962500000000002 22.2 26.724999999999998 92-93 27.287499999999998 23.925 22.45 26.337500000000002 94-95 27.3125 22.662499999999998 22.912499999999998 27.1125 96-97 27.1625 22.6125 23.400000000000002 26.825 98-99 27.537499999999998 22.7 24.099999999999998 25.662499999999998 100 28.65 22.475 22.2 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.5 27 1.0 28 0.5 29 2.5 30 5.0 31 7.5 32 10.0 33 11.5 34 12.0 35 18.0 36 32.5 37 46.0 38 54.0 39 74.5 40 94.5 41 101.0 42 112.0 43 127.5 44 139.0 45 146.5 46 144.0 47 139.0 48 140.0 49 132.5 50 120.5 51 112.0 52 112.0 53 104.5 54 99.0 55 101.0 56 102.0 57 106.5 58 93.5 59 104.0 60 124.5 61 111.5 62 104.5 63 105.5 64 104.0 65 97.5 66 89.0 67 85.5 68 86.5 69 83.0 70 70.0 71 66.5 72 67.0 73 53.0 74 36.5 75 28.0 76 24.5 77 19.5 78 12.0 79 8.5 80 5.5 81 2.5 82 2.0 83 2.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.075 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93805309734513 97.82499999999999 2 0.9860935524652339 1.95 3 0.07585335018963338 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557223 spots for SRR8618244.sra Written 557223 spots for SRR8618244.sra Read 557237 spots for SRR8618244.sra Written 557237 spots for SRR8618244.sra SRR ids: ['SRR8618244.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sa5adf8d SRR8618244.sra spots: 11144474 blocks: [[1, 557223], [557224, 1114446], [1114447, 1671669], [1671670, 2228892], [2228893, 2786115], [2786116, 3343338], [3343339, 3900561], [3900562, 4457784], [4457785, 5015007], [5015008, 5572230], [5572231, 6129453], [6129454, 6686676], [6686677, 7243899], [7243900, 7801122], [7801123, 8358345], [8358346, 8915568], [8915569, 9472791], [9472792, 10030014], [10030015, 10587237], [10587238, 11144474]] SRR8618244 file size 2900245 SRR8618244 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618244 SRR8618244_1.fastq SRR8618244_2.fastq Input file: SRR8618244_1.fastq Paired file: SRR8618244_2.fastq trimmed: SRR8618244-trimmed-pair1.fastq, SRR8618244-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:54:09 2024 >> started Sat Dec 7 09:54:18 2024 >> done (9.774s) 11144474 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11144474 (100.00%) read pairs available; of these: 1477204 (13.26%) trimmed read pairs available after processing 9667270 (86.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 2 0.00% 81 8 0.00% 82 24 0.00% 83 98 0.00% 84 5092 0.05% 85 5398 0.05% 86 5947 0.05% 87 6722 0.06% 88 8036 0.07% 89 10252 0.09% 90 17032 0.15% 91 32200 0.29% 92 46491 0.42% 93 65291 0.59% 94 89081 0.80% 95 113672 1.02% 96 151793 1.36% 97 213058 1.91% 98 301650 2.71% 99 405357 3.64% 100 9667270 86.74% 11144474 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.22 fanout-score-rank=13 prefix-density=0.44 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.15 sequence-density-rank=28 fanout-score=18.84 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=6.3 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=29 prefix-density=0.41 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=29 fanout-score=18.73 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=6.3 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR8618244 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:54:46 Started mapping on | Dec 07 09:54:46 Finished on | Dec 07 09:55:10 Mapping speed, Million of reads per hour | 1671.67 Number of input reads | 11144474 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10945540 Uniquely mapped reads % | 98.21% Average mapped length | 198.37 Number of splices: Total | 6624012 Number of splices: Annotated (sjdb) | 6314725 Number of splices: GT/AG | 6536554 Number of splices: GC/AG | 75879 Number of splices: AT/AC | 2110 Number of splices: Non-canonical | 9469 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.12 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 93405 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 6602 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105529 105529 105529 N_multimapping 93405 93405 93405 N_noFeature 233822 5470094 5521021 N_ambiguous 227062 19391 20375 UnstrandedReadsAssigned:10484656 PositiveStrandReadsAssigned:5456055 NegativeStrandReadsAssigned:5404144 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618244 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618244-trimmed-pair1.fastq SRR8618244-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,144,474 reads, 10,726,782 reads pseudoaligned [quant] estimated average fragment length: 166.912 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52973 SRR8618244.ke.tsv 35125 SRR8618244.se.tsv 88098 total ==> SRR8618244.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.169 0 0 PNS24247 1044 878.088 15.739 2.26285 PNS24249 1928 1762.09 62.6117 4.48584 PNS24246 1044 878.088 15.739 2.26285 PNS24248 1044 878.088 15.739 2.26285 PNS24244 1471 1305.09 21.1712 2.04797 PNS24243 293 134.596 13 12.1935 KQK14069 1603 1437.09 2986.8 262.385 KQK14071 474 309.597 154.399 62.9598 ==> SRR8618244.se.tsv <== BRADI_1g14170v3 3285 BRADI_1g53295v3 22 BRADI_1g59795v3 217 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 568 BRADI_1g74790v3 77 BRADI_1g09890v3 0 BRADI_1g77505v3 110 BRADI_1g48960v3 0 SRR8618244 completed mapping pipeline successfully