Starting /dee2/code/volunteer_pipeline.sh SRR8618245 current disk space = 1543988842496 free memory = 1605864148 SRR8618245 SRAfilesize 3369d1ed2b82201da427e30f75d854d8 SRR8618245.sra SRR8618245.sra file validated SRR8618245 is paired end SRR8618245 is conventional basespace SRR8618245 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618245_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93525 34.0 31.0 34.0 31.0 34.0 2 33.11625 34.0 31.0 34.0 31.0 34.0 3 33.1825 34.0 33.0 34.0 31.0 34.0 4 32.843 37.0 35.0 37.0 2.0 37.0 5 34.62625 37.0 35.0 37.0 19.0 37.0 6 35.895 37.0 35.0 37.0 32.0 37.0 7 36.24075 37.0 35.0 37.0 35.0 37.0 8 36.3955 37.0 37.0 37.0 35.0 37.0 9 38.2705 39.0 39.0 39.0 37.0 39.0 10-11 38.32825 39.0 39.0 39.0 37.0 39.0 12-13 38.299625 39.0 39.0 39.0 37.0 39.0 14-15 39.798375 41.0 40.0 41.0 37.5 41.0 16-17 39.690375 41.0 40.0 41.0 37.0 41.0 18-19 39.711875 41.0 40.0 41.0 38.0 41.0 20-21 39.653999999999996 41.0 39.5 41.0 37.0 41.0 22-23 39.5565 41.0 39.0 41.0 37.0 41.0 24-25 39.435125 40.0 39.0 41.0 36.5 41.0 26-27 39.275 40.0 38.5 41.0 36.0 41.0 28-29 39.094375 40.0 38.0 41.0 35.5 41.0 30-31 38.807625 40.0 38.0 41.0 35.0 41.0 32-33 38.78275 40.0 38.0 41.0 35.0 41.0 34-35 38.9975 40.0 38.0 41.0 35.0 41.0 36-37 39.043000000000006 40.0 38.0 41.0 35.0 41.0 38-39 38.86875 40.0 38.0 41.0 35.0 41.0 40-41 38.764250000000004 40.0 37.5 41.0 35.0 41.0 42-43 38.473124999999996 40.0 37.0 41.0 35.0 41.0 44-45 38.2765 40.0 36.0 41.0 34.0 41.0 46-47 38.058625 39.5 35.5 41.0 34.0 41.0 48-49 37.810874999999996 39.0 35.0 41.0 33.5 41.0 50-51 37.452625 39.0 35.0 41.0 33.0 41.0 52-53 37.213499999999996 38.0 35.0 41.0 33.0 41.0 54-55 37.099000000000004 38.0 35.0 40.5 33.0 41.0 56-57 36.829875 37.0 35.0 40.0 33.0 41.0 58-59 36.53 36.5 35.0 40.0 32.5 41.0 60-61 36.230875 36.0 35.0 40.0 32.0 41.0 62-63 35.911875 35.0 34.5 39.0 31.5 41.0 64-65 35.57525 35.0 34.0 39.0 31.0 41.0 66-67 35.360625 35.0 34.0 38.5 31.0 41.0 68-69 35.001000000000005 35.0 34.0 37.5 30.5 40.0 70-71 34.630125 35.0 34.0 37.0 30.0 39.0 72-73 34.35875 35.0 33.5 36.0 30.0 39.0 74-75 34.070875 35.0 33.0 36.0 29.5 38.5 76-77 33.16925 34.0 32.5 35.0 28.0 37.0 78-79 33.657 35.0 33.0 35.0 29.0 37.0 80-81 33.6345 35.0 33.0 35.0 30.0 36.5 82-83 33.4835 35.0 33.0 35.0 29.0 36.0 84-85 33.31375 35.0 33.0 35.0 29.0 36.0 86-87 32.97575 35.0 33.0 35.0 29.0 36.0 88-89 32.7425 35.0 33.0 35.0 27.0 35.0 90-91 32.448 35.0 32.5 35.0 27.0 35.0 92-93 32.081625 34.0 32.0 35.0 27.0 35.0 94-95 31.857875 34.0 32.0 35.0 25.0 35.0 96-97 31.594375 34.0 32.0 35.0 25.0 35.0 98-99 31.18925 34.0 31.0 35.0 24.5 35.0 100 30.85475 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.2177899499880951 1101 2 0.11096557381387129 1101 3 0.2756344103093298 1101 4 -3.715474583895638 1101 5 -1.8081950729009577 1101 6 -0.46401259559154084 1101 7 -0.07587785451562468 1101 8 0.13546876240374672 1101 9 0.19243999894154484 1101 10-11 0.2632769707073166 1101 12-13 0.22952554841099726 1101 14-15 0.09278002699055321 1101 16-17 0.20096716149348026 1101 18-19 0.09490354846391824 1101 20-21 0.15053187266809687 1101 22-23 0.034657722738224095 1101 24-25 0.19880394802995482 1101 26-27 0.1706160196872304 1101 28-29 0.2143367468444879 1101 30-31 0.2461234156280625 1101 32-33 0.12362070334206265 1101 34-35 0.1990222539758122 1101 36-37 0.3229604932391297 1101 38-39 0.2388730120928244 1101 40-41 0.13934534677569133 1101 42-43 0.16080548278690543 1101 44-45 0.1644042232277485 1101 46-47 0.08396178984413893 1101 48-49 0.23047154084305532 1101 50-51 0.26215236431954736 1101 52-53 0.309915059141062 1101 54-55 0.40773596888148234 1101 56-57 0.40397184514831963 1101 58-59 0.39430684554523054 1101 60-61 0.6090537429546714 1101 62-63 0.6320949432404532 1101 64-65 0.5930644862533399 1101 66-67 0.11318832526262668 1101 68-69 0.10157180281019151 1101 70-71 0.13462861527876413 1101 72-73 0.12110026196713619 1101 74-75 0.3198115953533929 1101 76-77 0.1991744066047474 1101 78-79 0.04980683231457306 1101 80-81 0.1317707919875062 1101 82-83 0.0059802598502258775 1101 84-85 -0.24153237543330874 1101 86-87 -0.07764414807758158 1101 88-89 0.10290809981211879 1101 90-91 -0.11606599454896838 1101 92-93 0.051057130004501516 1101 94-95 0.2033222195760871 1101 96-97 0.05918075732317263 1101 98-99 -0.12498346167076946 1101 100 -0.3966817496229247 1104 1 -0.2177899499880951 1104 2 -0.11096557381387129 1104 3 -0.2756344103093369 1104 4 3.7154745838956345 1104 5 1.8081950729009577 1104 6 0.46401259559154795 1104 7 0.07587785451562468 1104 8 -0.13546876240374672 1104 9 -0.19243999894154484 1104 10-11 -0.2632769707073095 1104 12-13 -0.22952554841099726 1104 14-15 -0.09278002699055321 1104 16-17 -0.20096716149347316 1104 18-19 -0.09490354846391824 1104 20-21 -0.15053187266808976 1104 22-23 -0.03465772273821699 1104 24-25 -0.19880394802995482 1104 26-27 -0.1706160196872304 1104 28-29 -0.2143367468444879 1104 30-31 -0.2461234156280554 1104 32-33 -0.12362070334206976 1104 34-35 -0.1990222539758193 1104 36-37 -0.3229604932391297 1104 38-39 -0.2388730120928244 1104 40-41 -0.13934534677568422 1104 42-43 -0.16080548278690543 1104 44-45 -0.1644042232277556 1104 46-47 -0.08396178984414604 1104 48-49 -0.23047154084305532 1104 50-51 -0.26215236431954736 1104 52-53 -0.309915059141062 1104 54-55 -0.40773596888148234 1104 56-57 -0.40397184514831963 1104 58-59 -0.39430684554523765 1104 60-61 -0.6090537429546714 1104 62-63 -0.6320949432404532 1104 64-65 -0.5930644862533399 1104 66-67 -0.11318832526262668 1104 68-69 -0.10157180281019862 1104 70-71 -0.13462861527877124 1104 72-73 -0.12110026196713619 1104 74-75 -0.3198115953533929 1104 76-77 -0.1991744066047474 1104 78-79 -0.04980683231457306 1104 80-81 -0.1317707919875133 1104 82-83 -0.005980259850232983 1104 84-85 0.24153237543330164 1104 86-87 0.07764414807758158 1104 88-89 -0.1029080998121259 1104 90-91 0.11606599454896127 1104 92-93 -0.051057130004501516 1104 94-95 -0.2033222195760942 1104 96-97 -0.05918075732317618 1104 98-99 0.1249834616707659 1104 100 0.39668174962292824 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 13.0 28 32.0 29 49.0 30 74.0 31 108.0 32 134.0 33 228.0 34 336.0 35 467.0 36 740.0 37 918.0 38 778.0 39 121.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.575000000000003 10.45 13.925 45.050000000000004 2 26.150000000000002 19.35 30.675 23.825 3 28.999999999999996 21.9 22.5 26.6 4 30.394626364399663 26.812202630842428 15.897005317660229 26.896165687097678 5 29.575000000000003 29.5 19.15 21.775 6 23.011505752876438 31.94097048524262 18.8344172086043 26.21310655327664 7 21.375 14.475 37.85 26.3 8 23.0 18.15 24.5 34.35 9 22.825 19.2 27.375 30.599999999999998 10-11 27.500000000000004 26.8 19.375 26.325 12-13 25.95 20.349999999999998 25.1 28.599999999999998 14-15 26.025 22.525000000000002 24.474999999999998 26.974999999999998 16-17 26.85 22.4375 22.9375 27.775 18-19 26.875 22.237499999999997 23.5625 27.325 20-21 26.775 22.8125 23.4375 26.974999999999998 22-23 26.737499999999997 23.525 22.6125 27.125 24-25 27.075 23.7625 21.4875 27.675 26-27 26.200000000000003 24.1625 22.875 26.7625 28-29 26.125 23.95 22.875 27.05 30-31 26.337500000000002 24.05 22.425 27.187499999999996 32-33 26.737499999999997 23.5875 23.3375 26.337500000000002 34-35 26.650000000000002 24.3 21.85 27.200000000000003 36-37 26.737499999999997 23.0875 22.6875 27.487499999999997 38-39 27.125 24.224999999999998 22.175 26.474999999999998 40-41 26.974999999999998 23.474999999999998 22.475 27.075 42-43 25.837500000000002 22.425 23.7875 27.950000000000003 44-45 27.125 23.3625 22.35 27.1625 46-47 27.05 23.1125 23.275000000000002 26.5625 48-49 26.887499999999996 23.9875 22.825 26.3 50-51 27.150000000000002 23.799999999999997 22.7 26.35 52-53 27.275 22.075 22.7375 27.9125 54-55 25.724999999999998 22.7625 23.0125 28.499999999999996 56-57 27.0875 23.4625 22.775000000000002 26.674999999999997 58-59 27.750000000000004 23.325000000000003 22.35 26.575 60-61 26.6125 22.7375 22.7125 27.9375 62-63 27.6625 23.9 22.675 25.7625 64-65 27.425 22.6125 22.675 27.287499999999998 66-67 26.637499999999996 23.275000000000002 22.6375 27.450000000000003 68-69 27.4125 22.3125 24.1875 26.087500000000002 70-71 26.5875 23.674999999999997 22.075 27.6625 72-73 25.85 23.3625 23.5625 27.224999999999998 74-75 27.0 23.525 22.662499999999998 26.8125 76-77 26.8625 22.900000000000002 23.7 26.5375 78-79 27.200000000000003 22.3625 23.5 26.937499999999996 80-81 27.675 23.1625 22.3875 26.775 82-83 28.1 22.825 22.537499999999998 26.5375 84-85 26.3625 22.412499999999998 23.599999999999998 27.625 86-87 26.9625 23.275000000000002 22.9625 26.8 88-89 27.187499999999996 23.2875 22.3875 27.1375 90-91 27.4125 23.5625 22.7125 26.3125 92-93 27.7569392348087 22.643160790197552 23.543385846461614 26.056514128532132 94-95 27.9375 23.3625 21.8 26.900000000000002 96-97 27.6125 22.85 22.537499999999998 27.0 98-99 27.787499999999998 24.0625 21.8875 26.2625 100 28.725 23.125 21.75 26.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.0 28 1.0 29 2.5 30 5.0 31 6.0 32 6.5 33 11.5 34 18.5 35 25.5 36 33.5 37 42.0 38 56.5 39 67.5 40 79.0 41 96.5 42 114.5 43 128.5 44 138.0 45 147.0 46 134.5 47 132.5 48 135.0 49 124.0 50 129.0 51 122.5 52 117.0 53 110.0 54 88.5 55 88.0 56 88.5 57 100.5 58 108.0 59 117.5 60 129.0 61 119.5 62 101.5 63 95.5 64 108.5 65 113.5 66 108.5 67 90.5 68 90.5 69 94.0 70 77.5 71 66.5 72 51.0 73 41.5 74 37.5 75 22.5 76 18.0 77 18.5 78 12.5 79 6.5 80 5.0 81 4.5 82 6.0 83 4.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 10.674999999999999 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14228052472251 98.25 2 0.8072653884964682 1.6 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618245 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618245_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.96725 33.0 31.0 34.0 31.0 34.0 2 32.746 34.0 31.0 34.0 31.0 34.0 3 32.8895 34.0 31.0 34.0 31.0 34.0 4 36.43425 37.0 37.0 37.0 35.0 37.0 5 36.45 37.0 37.0 37.0 35.0 37.0 6 36.47525 37.0 37.0 37.0 35.0 37.0 7 36.47075 37.0 37.0 37.0 35.0 37.0 8 36.48575 37.0 37.0 37.0 35.0 37.0 9 38.32625 39.0 39.0 39.0 37.0 39.0 10-11 38.263999999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.267624999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.8185 41.0 40.0 41.0 38.0 41.0 16-17 39.72 41.0 40.0 41.0 37.0 41.0 18-19 39.751625000000004 41.0 40.0 41.0 37.5 41.0 20-21 39.743375 41.0 40.0 41.0 37.5 41.0 22-23 39.664875 41.0 39.5 41.0 37.0 41.0 24-25 39.540375 41.0 39.0 41.0 37.0 41.0 26-27 39.438500000000005 41.0 39.0 41.0 36.5 41.0 28-29 39.236875 40.0 39.0 41.0 36.0 41.0 30-31 39.12 40.0 38.0 41.0 35.5 41.0 32-33 39.11825 40.0 38.0 41.0 35.0 41.0 34-35 38.98625 40.0 38.0 41.0 35.0 41.0 36-37 38.748374999999996 40.0 38.0 41.0 35.0 41.0 38-39 38.55825 40.0 37.5 41.0 34.5 41.0 40-41 38.41075 40.0 37.0 41.0 34.0 41.0 42-43 38.12 40.0 36.5 41.0 33.5 41.0 44-45 37.761625 39.0 35.5 41.0 33.0 41.0 46-47 37.528875 39.0 35.0 41.0 33.0 41.0 48-49 37.40575 39.0 35.0 41.0 33.0 41.0 50-51 36.847 38.0 34.5 40.0 32.0 40.5 52-53 36.88275 38.0 35.0 40.0 32.5 41.0 54-55 37.1205 38.0 35.0 41.0 33.0 41.0 56-57 36.9525 37.0 35.0 41.0 33.0 41.0 58-59 36.638999999999996 37.0 35.0 40.0 33.0 41.0 60-61 36.415625 36.0 35.0 40.0 32.5 41.0 62-63 36.114625 35.5 35.0 39.5 32.0 41.0 64-65 35.85025 35.0 35.0 39.0 32.0 41.0 66-67 35.633 35.0 34.0 39.0 31.0 41.0 68-69 35.324749999999995 35.0 34.0 38.0 31.0 40.5 70-71 34.98025 35.0 34.0 37.0 31.0 39.5 72-73 34.722750000000005 35.0 34.0 37.0 31.0 39.0 74-75 34.37975 35.0 34.0 36.0 30.0 39.0 76-77 34.10375 35.0 33.5 36.0 30.0 38.0 78-79 33.781625000000005 35.0 33.0 35.0 29.5 37.0 80-81 33.522125 35.0 33.0 35.0 29.0 37.0 82-83 33.40025 35.0 33.0 35.0 29.0 36.0 84-85 33.24575 35.0 33.0 35.0 29.0 36.0 86-87 32.90975 35.0 33.0 35.0 27.5 35.5 88-89 32.762249999999995 35.0 33.0 35.0 27.0 35.0 90-91 32.536874999999995 35.0 32.0 35.0 27.0 35.0 92-93 32.063375 34.0 32.0 35.0 27.0 35.0 94-95 31.839750000000002 34.0 32.0 35.0 25.0 35.0 96-97 31.415625 34.0 31.5 35.0 24.5 35.0 98-99 30.7915 34.0 31.0 35.0 23.5 35.0 100 30.2315 34.0 31.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.5365695535974169 1101 2 0.277791008441163 1101 3 0.1870154269535078 1101 4 0.1807573231721804 1101 5 0.1804133259241567 1101 6 0.28955306819083404 1101 7 0.1581461194464282 1101 8 0.1472440528168093 1101 9 0.17459183403455825 1101 10-11 0.09843613558783915 1101 12-13 0.11870551189436185 1101 14-15 0.21435659283956454 1101 16-17 0.2879256965944279 1101 18-19 0.40036648937577723 1101 20-21 0.18849064592098586 1101 22-23 0.48178799184991306 1101 24-25 0.17347384297848123 1101 26-27 0.04969437167579116 1101 28-29 0.09872059485062579 1101 30-31 0.27294197031039147 1101 32-33 0.31888544891641146 1101 34-35 0.17567674843216707 1101 36-37 0.2189873250244787 1101 38-39 0.2582493186208339 1101 40-41 0.17355322695880204 1101 42-43 0.03242174062607717 1101 44-45 0.16431160858405747 1101 46-47 -0.0327789685374853 1101 48-49 0.128668201423622 1101 50-51 0.49545526712709176 1101 52-53 0.2513362970019273 1101 54-55 0.16019025693948663 1101 56-57 0.06979836469000134 1101 58-59 0.1083591331269389 1101 60-61 0.17187293270884396 1101 62-63 0.24793601651186492 1101 64-65 0.14514699267021314 1101 66-67 -0.23436797121007658 1101 68-69 -0.05924029530840613 1101 70-71 -0.22626418988647856 1101 72-73 -0.10456854806700022 1101 74-75 0.1910375486226883 1101 76-77 0.07390648567118774 1101 78-79 0.23059723214522165 1101 80-81 -0.20431451933000488 1101 82-83 0.04552009737768259 1101 84-85 -0.20513482045990372 1101 86-87 0.18700219629011627 1101 88-89 0.09614061549045516 1101 90-91 -0.08722976370035695 1101 92-93 0.17309015374031134 1101 94-95 0.33715699505172836 1101 96-97 0.4748551242359298 1101 98-99 0.406829668439574 1101 100 0.7455743430975623 1104 1 -0.5365695535974169 1104 2 -0.277791008441163 1104 3 -0.1870154269535007 1104 4 -0.1807573231721875 1104 5 -0.18041332592416381 1104 6 -0.28955306819084115 1104 7 -0.1581461194464282 1104 8 -0.1472440528168093 1104 9 -0.17459183403455825 1104 10-11 -0.09843613558783915 1104 12-13 -0.11870551189436185 1104 14-15 -0.21435659283956454 1104 16-17 -0.2879256965944279 1104 18-19 -0.40036648937577723 1104 20-21 -0.18849064592098586 1104 22-23 -0.48178799184991306 1104 24-25 -0.17347384297848834 1104 26-27 -0.049694371675798266 1104 28-29 -0.09872059485062579 1104 30-31 -0.27294197031039147 1104 32-33 -0.31888544891641146 1104 34-35 -0.17567674843216707 1104 36-37 -0.2189873250244787 1104 38-39 -0.2582493186208339 1104 40-41 -0.17355322695879494 1104 42-43 -0.03242174062607717 1104 44-45 -0.16431160858405747 1104 46-47 0.03277896853747819 1104 48-49 -0.128668201423622 1104 50-51 -0.49545526712709176 1104 52-53 -0.2513362970019344 1104 54-55 -0.16019025693948663 1104 56-57 -0.06979836469000134 1104 58-59 -0.1083591331269389 1104 60-61 -0.17187293270884396 1104 62-63 -0.24793601651186492 1104 64-65 -0.14514699267021314 1104 66-67 0.23436797121007658 1104 68-69 0.05924029530840613 1104 70-71 0.22626418988648567 1104 72-73 0.10456854806700022 1104 74-75 -0.1910375486226883 1104 76-77 -0.07390648567119484 1104 78-79 -0.23059723214522165 1104 80-81 0.20431451932999778 1104 82-83 -0.04552009737768259 1104 84-85 0.20513482045990372 1104 86-87 -0.18700219629012338 1104 88-89 -0.09614061549045516 1104 90-91 0.08722976370035695 1104 92-93 -0.17309015374031134 1104 94-95 -0.3371569950517319 1104 96-97 -0.4748551242359298 1104 98-99 -0.406829668439574 1104 100 -0.7455743430975623 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 0.0 27 12.0 28 31.0 29 48.0 30 84.0 31 95.0 32 146.0 33 209.0 34 307.0 35 488.0 36 727.0 37 885.0 38 816.0 39 151.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.7 9.625 13.25 47.425 2 27.725 17.675 30.2 24.4 3 27.0 21.675 22.775000000000002 28.549999999999997 4 28.925 26.674999999999997 17.45 26.950000000000003 5 30.175 28.849999999999998 19.05 21.925 6 23.724999999999998 30.075000000000003 19.950000000000003 26.25 7 21.975 13.55 38.4 26.075 8 23.1 19.8 23.674999999999997 33.425 9 22.3 17.9 27.750000000000004 32.05 10-11 25.88883324987481 27.078117175763644 19.11617426139209 27.916875312969452 12-13 24.656164041010253 21.05526381595399 25.98149537384346 28.307076769192296 14-15 25.7125 23.3375 23.25 27.700000000000003 16-17 26.525 22.1375 23.0875 28.249999999999996 18-19 25.05 23.962500000000002 22.537499999999998 28.449999999999996 20-21 25.9625 24.075 22.925 27.037499999999998 22-23 27.075 22.925 22.6125 27.3875 24-25 25.7625 23.2625 22.75 28.225 26-27 26.487500000000004 23.849999999999998 22.9625 26.700000000000003 28-29 26.487500000000004 23.35 22.5125 27.650000000000002 30-31 26.0125 23.5125 22.625 27.85 32-33 26.4625 23.4875 22.662499999999998 27.3875 34-35 26.674999999999997 22.575 23.6125 27.1375 36-37 26.4125 22.825 22.925 27.8375 38-39 25.5 24.1625 22.975 27.3625 40-41 25.5625 23.1875 22.775000000000002 28.475 42-43 26.05 23.549999999999997 23.35 27.05 44-45 26.2125 23.075000000000003 23.8125 26.900000000000002 46-47 27.0625 23.1125 22.3625 27.462500000000002 48-49 26.125 22.6125 23.1625 28.1 50-51 26.875 22.537499999999998 22.8375 27.750000000000004 52-53 26.775 23.45 22.3875 27.3875 54-55 26.375 23.525 22.912499999999998 27.187499999999996 56-57 26.35 23.775 23.35 26.525 58-59 27.775 23.775 22.425 26.025 60-61 25.912499999999998 23.4875 23.1 27.500000000000004 62-63 26.637499999999996 23.325000000000003 22.85 27.187499999999996 64-65 26.5875 22.8875 22.4625 28.0625 66-67 26.174999999999997 22.7375 22.6375 28.449999999999996 68-69 27.0875 23.125 23.125 26.6625 70-71 27.4125 22.8375 22.8625 26.887499999999996 72-73 26.087500000000002 23.375 23.0125 27.525 74-75 26.237500000000004 23.425 23.849999999999998 26.487500000000004 76-77 27.200000000000003 21.8125 23.5875 27.400000000000002 78-79 25.662499999999998 22.375 24.0625 27.900000000000002 80-81 26.187500000000004 23.35 23.3125 27.150000000000002 82-83 26.7125 23.275000000000002 22.975 27.037499999999998 84-85 25.974999999999998 22.7375 23.0125 28.275 86-87 26.55 22.6 23.525 27.325 88-89 27.55 22.825 22.55 27.075 90-91 26.937499999999996 23.3875 22.5875 27.0875 92-93 26.724999999999998 23.9875 22.1375 27.150000000000002 94-95 26.2875 22.787499999999998 23.5875 27.3375 96-97 28.0875 22.6 22.6375 26.674999999999997 98-99 27.6625 22.9625 24.125 25.25 100 27.0 22.925 23.025000000000002 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 0.0 28 0.0 29 2.5 30 5.5 31 6.0 32 9.0 33 12.0 34 17.5 35 24.5 36 35.5 37 49.0 38 63.0 39 75.5 40 92.0 41 104.0 42 99.0 43 120.5 44 145.0 45 138.0 46 140.5 47 141.0 48 124.0 49 122.0 50 120.0 51 111.5 52 111.5 53 110.0 54 98.0 55 96.0 56 96.5 57 97.0 58 100.0 59 106.5 60 113.0 61 112.0 62 112.0 63 105.5 64 99.0 65 93.5 66 99.5 67 106.0 68 99.0 69 91.0 70 81.5 71 66.5 72 52.0 73 45.5 74 39.0 75 32.0 76 26.0 77 14.5 78 10.5 79 12.0 80 8.5 81 3.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.15 12-13 0.025 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98887765419616 97.89999999999999 2 0.935288169868554 1.8499999999999999 3 0.05055611729019212 0.15 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551951 spots for SRR8618245.sra Written 551951 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra Read 551932 spots for SRR8618245.sra Written 551932 spots for SRR8618245.sra SRR ids: ['SRR8618245.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9eu0w3ab SRR8618245.sra spots: 11038659 blocks: [[1, 551932], [551933, 1103864], [1103865, 1655796], [1655797, 2207728], [2207729, 2759660], [2759661, 3311592], [3311593, 3863524], [3863525, 4415456], [4415457, 4967388], [4967389, 5519320], [5519321, 6071252], [6071253, 6623184], [6623185, 7175116], [7175117, 7727048], [7727049, 8278980], [8278981, 8830912], [8830913, 9382844], [9382845, 9934776], [9934777, 10486708], [10486709, 11038659]] SRR8618245 file size 2872603 SRR8618245 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618245 SRR8618245_1.fastq SRR8618245_2.fastq Input file: SRR8618245_1.fastq Paired file: SRR8618245_2.fastq trimmed: SRR8618245-trimmed-pair1.fastq, SRR8618245-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:56:15 2024 >> started Sat Dec 7 09:56:26 2024 >> done (11.732s) 11038659 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11038659 (100.00%) read pairs available; of these: 1500586 (13.59%) trimmed read pairs available after processing 9538073 (86.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 16 0.00% 82 30 0.00% 83 104 0.00% 84 6635 0.06% 85 6711 0.06% 86 7181 0.07% 87 8191 0.07% 88 9622 0.09% 89 11600 0.11% 90 18195 0.16% 91 33701 0.31% 92 47538 0.43% 93 66546 0.60% 94 89774 0.81% 95 116147 1.05% 96 153751 1.39% 97 214538 1.94% 98 303774 2.75% 99 406531 3.68% 100 9538073 86.41% 11038659 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=31 fanout-score=20.37 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=6.4 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=18 prefix-density=0.41 prefix-fanout=3.0 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTATGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.17 sequence-density-rank=26 fanout-score=17.67 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=6.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR8618245 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:56:54 Started mapping on | Dec 07 09:56:54 Finished on | Dec 07 09:57:22 Mapping speed, Million of reads per hour | 1419.26 Number of input reads | 11038659 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10808413 Uniquely mapped reads % | 97.91% Average mapped length | 197.95 Number of splices: Total | 6411223 Number of splices: Annotated (sjdb) | 6105883 Number of splices: GT/AG | 6323606 Number of splices: GC/AG | 74486 Number of splices: AT/AC | 1887 Number of splices: Non-canonical | 11244 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 90722 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 5995 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.99% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 139524 139524 139524 N_multimapping 90722 90722 90722 N_noFeature 249858 5416232 5452337 N_ambiguous 228474 19451 20385 UnstrandedReadsAssigned:10330081 PositiveStrandReadsAssigned:5372730 NegativeStrandReadsAssigned:5335691 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618245 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618245-trimmed-pair1.fastq SRR8618245-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,038,659 reads, 10,602,550 reads pseudoaligned [quant] estimated average fragment length: 163.316 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52973 SRR8618245.ke.tsv 35125 SRR8618245.se.tsv 88098 total ==> SRR8618245.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.763 0 0 PNS24247 1044 881.684 15.335 2.23811 PNS24249 1928 1765.68 76.1494 5.54963 PNS24246 1044 881.684 15.335 2.23811 PNS24248 1044 881.684 15.335 2.23811 PNS24244 1471 1308.68 40.8456 4.01625 PNS24243 293 136.431 14 13.2046 KQK14069 1603 1440.68 2426.9 216.767 KQK14071 474 312.948 186.078 76.5129 ==> SRR8618245.se.tsv <== BRADI_1g14170v3 2782 BRADI_1g53295v3 19 BRADI_1g59795v3 238 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 192 BRADI_1g74790v3 90 BRADI_1g09890v3 1 BRADI_1g77505v3 141 BRADI_1g48960v3 0 SRR8618245 completed mapping pipeline successfully