Starting /dee2/code/volunteer_pipeline.sh SRR8618246 current disk space = 1543815299072 free memory = 1597263048 SRR8618246 SRAfilesize ee1656483fef7443f670fa38882289d1 SRR8618246.sra SRR8618246.sra file validated SRR8618246 is paired end SRR8618246 is conventional basespace SRR8618246 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618246_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0375 34.0 31.0 34.0 31.0 34.0 2 33.221 34.0 33.0 34.0 31.0 34.0 3 33.24725 34.0 34.0 34.0 31.0 34.0 4 32.97275 37.0 37.0 37.0 2.0 37.0 5 34.703 37.0 35.0 37.0 19.0 37.0 6 35.978 37.0 37.0 37.0 32.0 37.0 7 36.299 37.0 36.0 37.0 35.0 37.0 8 36.416 37.0 37.0 37.0 35.0 37.0 9 38.34725 39.0 39.0 39.0 37.0 39.0 10-11 38.35225 39.0 39.0 39.0 37.0 39.0 12-13 38.3955 39.0 39.0 39.0 37.0 39.0 14-15 39.973 41.0 40.0 41.0 38.0 41.0 16-17 39.769999999999996 41.0 40.0 41.0 37.5 41.0 18-19 39.771249999999995 41.0 40.0 41.0 37.5 41.0 20-21 39.66025 41.0 39.5 41.0 37.5 41.0 22-23 39.592875 41.0 39.0 41.0 37.0 41.0 24-25 39.474125 40.5 39.0 41.0 36.5 41.0 26-27 39.312625 40.0 39.0 41.0 36.0 41.0 28-29 39.158625 40.0 38.5 41.0 35.5 41.0 30-31 38.9325 40.0 38.0 41.0 35.0 41.0 32-33 38.943749999999994 40.0 38.0 41.0 35.0 41.0 34-35 39.154375 40.0 38.0 41.0 35.0 41.0 36-37 39.089 40.0 38.0 41.0 35.0 41.0 38-39 38.95075 40.0 38.0 41.0 35.0 41.0 40-41 38.817875 40.0 38.0 41.0 35.0 41.0 42-43 38.575375 40.0 37.0 41.0 35.0 41.0 44-45 38.387 40.0 36.5 41.0 34.5 41.0 46-47 38.175625 40.0 35.5 41.0 34.0 41.0 48-49 37.88225 39.0 35.0 41.0 33.5 41.0 50-51 37.5465 39.0 35.0 41.0 33.0 41.0 52-53 37.305625000000006 38.5 35.0 41.0 33.0 41.0 54-55 37.073 37.5 35.0 40.5 33.0 41.0 56-57 36.713750000000005 37.0 35.0 40.0 33.0 41.0 58-59 36.458875 36.5 35.0 40.0 33.0 41.0 60-61 36.204125000000005 36.0 35.0 40.0 32.0 41.0 62-63 35.904875000000004 35.0 35.0 39.0 32.0 41.0 64-65 35.602375 35.0 34.5 39.0 31.5 41.0 66-67 35.331625 35.0 34.0 38.5 31.0 40.5 68-69 35.065625 35.0 34.0 37.5 31.0 40.0 70-71 34.67125 35.0 34.0 37.0 30.5 39.0 72-73 34.485 35.0 34.0 36.0 30.0 39.0 74-75 34.100875 35.0 33.5 36.0 29.5 38.5 76-77 33.188874999999996 34.5 32.5 35.0 28.0 37.0 78-79 33.6325 35.0 33.0 35.0 29.0 37.0 80-81 33.518874999999994 35.0 33.0 35.0 29.0 36.0 82-83 33.36 35.0 33.0 35.0 29.0 36.0 84-85 33.136375 35.0 33.0 35.0 29.0 36.0 86-87 32.938625 35.0 33.0 35.0 28.5 35.5 88-89 32.584875 35.0 33.0 35.0 27.0 35.0 90-91 32.297625 35.0 32.5 35.0 27.0 35.0 92-93 31.949875 34.0 32.0 35.0 25.5 35.0 94-95 31.731625 34.0 32.0 35.0 25.0 35.0 96-97 31.396 34.0 31.5 35.0 24.5 35.0 98-99 31.04 34.0 31.0 35.0 24.0 35.0 100 30.5955 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.11338890140422109 1101 2 0.1097219093389441 1101 3 0.15723010688093098 1101 4 -3.5888463367625327 1101 5 -1.8506044905008636 1101 6 -0.5551926109484171 1101 7 0.002177667642861536 1101 8 -0.0329653825936731 1101 9 -0.05166328752721938 1101 10-11 0.15381342144126364 1101 12-13 0.016044654702014327 1101 14-15 0.011952141373178904 1101 16-17 0.07903431703837072 1101 18-19 0.0833583639958917 1101 20-21 0.1798765988335731 1101 22-23 0.12615453931065446 1101 24-25 0.24775349803509528 1101 26-27 0.22222222222222143 1101 28-29 0.10785086731245741 1101 30-31 0.2452942354384149 1101 32-33 0.04013040975195281 1101 34-35 0.01850391729868761 1101 36-37 -0.0023278516182330122 1101 38-39 -0.08256989812520033 1101 40-41 0.08327701434257051 1101 42-43 0.14521538885134788 1101 44-45 -0.015249931165676855 1101 46-47 0.12962128607544088 1101 48-49 0.04093764861955407 1101 50-51 2.1276063177566584E-4 1101 52-53 -0.002490550924882484 1101 54-55 0.05941027759004669 1101 56-57 0.039285624890489146 1101 58-59 0.04210783209431668 1101 60-61 -0.07807689419539088 1101 62-63 -0.07935971565166966 1101 64-65 -0.1391266801832245 1101 66-67 -0.08338965232409379 1101 68-69 -0.10738154238942599 1101 70-71 -0.5087669895622113 1101 72-73 -0.5183787639858863 1101 74-75 -0.4608770744161603 1101 76-77 -0.43927561262546533 1101 78-79 -0.26839753698280333 1101 80-81 -0.0413631698831054 1101 82-83 -0.2031676303471741 1101 84-85 -0.49441190458311723 1101 86-87 -0.24544441941377926 1101 88-89 -0.43908162499061376 1101 90-91 -0.25439288127956416 1101 92-93 -0.19403143851217308 1101 94-95 -0.1532502315336295 1101 96-97 -0.2488423318565225 1101 98-99 -0.3359114915771819 1101 100 -0.16610347675903014 1104 1 -0.11338890140421398 1104 2 -0.109721909338937 1104 3 -0.15723010688093098 1104 4 3.5888463367625363 1104 5 1.8506044905008636 1104 6 0.55519261094841 1104 7 -0.002177667642861536 1104 8 0.032965382593680204 1104 9 0.05166328752721938 1104 10-11 -0.15381342144126364 1104 12-13 -0.01604465470200722 1104 14-15 -0.01195214137318601 1104 16-17 -0.07903431703837072 1104 18-19 -0.0833583639958988 1104 20-21 -0.1798765988335731 1104 22-23 -0.12615453931065446 1104 24-25 -0.24775349803509528 1104 26-27 -0.22222222222222143 1104 28-29 -0.10785086731245741 1104 30-31 -0.2452942354384149 1104 32-33 -0.040130409751945706 1104 34-35 -0.018503917298694716 1104 36-37 0.0023278516182330122 1104 38-39 0.08256989812520033 1104 40-41 -0.08327701434257051 1104 42-43 -0.14521538885134788 1104 44-45 0.015249931165676855 1104 46-47 -0.12962128607544088 1104 48-49 -0.04093764861955407 1104 50-51 -2.1276063177566584E-4 1104 52-53 0.002490550924882484 1104 54-55 -0.05941027759004669 1104 56-57 -0.039285624890489146 1104 58-59 -0.04210783209431668 1104 60-61 0.07807689419539088 1104 62-63 0.07935971565167677 1104 64-65 0.1391266801832245 1104 66-67 0.08338965232409379 1104 68-69 0.10738154238942599 1104 70-71 0.5087669895622113 1104 72-73 0.5183787639858792 1104 74-75 0.4608770744161603 1104 76-77 0.43927561262546533 1104 78-79 0.26839753698280333 1104 80-81 0.0413631698831054 1104 82-83 0.2031676303471741 1104 84-85 0.49441190458311723 1104 86-87 0.24544441941378636 1104 88-89 0.43908162499061376 1104 90-91 0.25439288127957127 1104 92-93 0.19403143851217663 1104 94-95 0.1532502315336295 1104 96-97 0.2488423318565225 1104 98-99 0.3359114915771819 1104 100 0.16610347675903014 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 7.0 28 34.0 29 51.0 30 81.0 31 121.0 32 142.0 33 198.0 34 294.0 35 488.0 36 729.0 37 954.0 38 780.0 39 119.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.825 11.05 14.875 46.25 2 27.224999999999998 17.349999999999998 30.85 24.575 3 27.900000000000002 22.475 22.675 26.950000000000003 4 30.745601787210276 25.85869868751745 16.252443451549848 27.143256073722423 5 30.925000000000004 29.325000000000003 18.224999999999998 21.525 6 23.980995248812203 31.98299574893723 18.00450112528132 26.03150787696924 7 22.900000000000002 13.975000000000001 37.7 25.424999999999997 8 23.325000000000003 18.125 23.599999999999998 34.949999999999996 9 24.025 17.7 27.525 30.75 10-11 26.825 26.787499999999998 18.775 27.6125 12-13 24.4375 20.95 25.525 29.0875 14-15 26.724999999999998 22.85 22.45 27.975 16-17 27.437499999999996 22.4875 22.537499999999998 27.537499999999998 18-19 26.6125 23.4625 22.225 27.700000000000003 20-21 26.5375 22.95 22.287499999999998 28.225 22-23 26.5625 22.650000000000002 23.6375 27.150000000000002 24-25 25.75 23.4875 22.7 28.0625 26-27 26.2125 22.9875 23.05 27.750000000000004 28-29 26.724999999999998 22.9375 23.05 27.287499999999998 30-31 26.387500000000003 22.4875 23.5375 27.5875 32-33 26.7125 23.799999999999997 21.9375 27.55 34-35 27.125 22.112499999999997 22.775000000000002 27.987499999999997 36-37 26.487500000000004 22.275 23.7625 27.474999999999998 38-39 26.787499999999998 22.525000000000002 22.675 28.012500000000003 40-41 27.425 22.162499999999998 22.650000000000002 27.762500000000003 42-43 26.437500000000004 22.8125 23.5 27.250000000000004 44-45 27.125 22.05 22.875 27.950000000000003 46-47 27.675 23.375 21.762500000000003 27.187499999999996 48-49 26.7625 22.325 22.725 28.1875 50-51 26.9625 23.0375 21.9375 28.0625 52-53 27.2625 21.462500000000002 22.9875 28.287499999999998 54-55 26.4125 22.9375 23.2125 27.437499999999996 56-57 27.625 22.15 22.55 27.675 58-59 27.125 22.975 22.162499999999998 27.737499999999997 60-61 26.5875 23.2375 22.0875 28.0875 62-63 27.0875 22.3625 23.799999999999997 26.75 64-65 27.275 22.2625 23.325000000000003 27.1375 66-67 26.8375 22.95 23.0 27.212500000000002 68-69 26.525 22.7375 23.1375 27.6 70-71 26.424999999999997 22.5 22.8875 28.1875 72-73 27.150000000000002 22.35 22.9625 27.537499999999998 74-75 27.625 21.975 22.9875 27.4125 76-77 28.3375 21.837500000000002 22.4375 27.3875 78-79 27.1125 22.537499999999998 22.900000000000002 27.450000000000003 80-81 28.487499999999997 21.9375 22.9375 26.637499999999996 82-83 27.800000000000004 23.2375 21.349999999999998 27.6125 84-85 26.674999999999997 23.575 22.7375 27.0125 86-87 28.999999999999996 21.4 22.9875 26.6125 88-89 28.012500000000003 22.2125 22.1875 27.5875 90-91 26.924999999999997 23.825 22.287499999999998 26.9625 92-93 28.012500000000003 23.1375 21.95 26.900000000000002 94-95 28.012500000000003 22.237499999999997 23.0 26.75 96-97 28.15 22.7375 22.3 26.8125 98-99 26.650000000000002 21.975 23.8625 27.5125 100 27.800000000000004 22.25 23.275000000000002 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 1.5 30 4.0 31 5.5 32 3.5 33 9.5 34 13.5 35 12.5 36 22.5 37 32.0 38 41.0 39 59.5 40 77.0 41 91.0 42 113.5 43 131.0 44 135.0 45 141.0 46 146.0 47 137.0 48 141.5 49 136.0 50 119.0 51 117.0 52 109.0 53 95.5 54 86.5 55 83.5 56 93.0 57 108.0 58 111.0 59 124.0 60 130.0 61 117.5 62 117.5 63 121.5 64 108.5 65 100.5 66 102.5 67 103.5 68 98.5 69 88.5 70 82.0 71 68.5 72 54.5 73 52.0 74 46.0 75 29.0 76 19.5 77 18.0 78 11.0 79 8.0 80 9.0 81 6.0 82 2.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 10.475 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9638615112459 97.89999999999999 2 0.9855951478392722 1.95 3 0.050543340914834464 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618246 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618246_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.21875 34.0 31.0 34.0 31.0 34.0 2 32.893 34.0 31.0 34.0 31.0 34.0 3 33.01625 34.0 31.0 34.0 31.0 34.0 4 36.4955 37.0 37.0 37.0 35.0 37.0 5 36.49825 37.0 37.0 37.0 35.0 37.0 6 36.47575 37.0 37.0 37.0 35.0 37.0 7 36.5075 37.0 37.0 37.0 35.0 37.0 8 36.5135 37.0 37.0 37.0 35.0 37.0 9 38.314 39.0 39.0 39.0 37.0 39.0 10-11 38.314499999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.285624999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.880625 41.0 40.0 41.0 38.0 41.0 16-17 39.790875 41.0 40.0 41.0 38.0 41.0 18-19 39.82225 41.0 40.0 41.0 38.0 41.0 20-21 39.75575 41.0 40.0 41.0 37.5 41.0 22-23 39.754625000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.620625000000004 41.0 39.0 41.0 37.0 41.0 26-27 39.44975 41.0 39.0 41.0 36.0 41.0 28-29 39.265125 40.0 39.0 41.0 36.0 41.0 30-31 39.182875 40.0 38.5 41.0 35.5 41.0 32-33 39.173500000000004 40.0 38.0 41.0 35.0 41.0 34-35 39.034625 40.0 38.0 41.0 35.0 41.0 36-37 38.8805 40.0 38.0 41.0 35.0 41.0 38-39 38.619875 40.0 38.0 41.0 34.5 41.0 40-41 38.377125 40.0 37.0 41.0 34.0 41.0 42-43 38.123875 40.0 36.5 41.0 33.5 41.0 44-45 37.834875 39.5 35.5 41.0 33.0 41.0 46-47 37.56037499999999 39.0 35.0 41.0 33.0 41.0 48-49 37.350375 39.0 35.0 41.0 33.0 41.0 50-51 36.907 38.0 34.5 40.0 32.0 40.5 52-53 36.994 38.0 35.0 40.0 33.0 41.0 54-55 37.139250000000004 38.0 35.0 41.0 33.0 41.0 56-57 36.913125 37.0 35.0 40.5 33.0 41.0 58-59 36.603875 36.5 35.0 40.0 33.0 41.0 60-61 36.29025 36.0 35.0 40.0 32.5 41.0 62-63 36.0055 35.0 35.0 39.0 31.5 41.0 64-65 35.687250000000006 35.0 35.0 39.0 31.0 41.0 66-67 35.536125 35.0 34.5 39.0 31.0 41.0 68-69 35.247625 35.0 34.0 37.5 31.0 40.5 70-71 34.897999999999996 35.0 34.0 37.0 31.0 39.5 72-73 34.588375 35.0 34.0 36.5 31.0 39.0 74-75 34.178 35.0 33.5 36.0 29.5 39.0 76-77 33.979375000000005 35.0 33.0 35.5 29.5 37.5 78-79 33.760875 35.0 33.0 35.0 29.5 37.0 80-81 33.614374999999995 35.0 33.0 35.0 29.0 36.5 82-83 33.3905 35.0 33.0 35.0 29.0 36.0 84-85 33.089875 35.0 33.0 35.0 29.0 36.0 86-87 32.82225 35.0 33.0 35.0 27.5 35.5 88-89 32.528999999999996 35.0 32.0 35.0 27.0 35.0 90-91 32.306749999999994 34.5 32.0 35.0 27.0 35.0 92-93 32.076 34.0 32.0 35.0 26.5 35.0 94-95 31.68375 34.0 31.5 35.0 25.5 35.0 96-97 31.271124999999998 34.0 31.5 35.0 24.5 35.0 98-99 30.72375 34.0 31.0 35.0 23.5 35.0 100 30.1395 34.0 31.0 35.0 19.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.024154589371981672 1101 2 0.12007208830817717 1101 3 0.05884708768240898 1101 4 0.10983454732046738 1101 5 0.07535480964180863 1101 6 0.09285124277239021 1101 7 0.009399013791899336 1101 8 -0.040487096693446745 1101 9 0.028822807939725692 1101 10-11 0.13584140572201164 1101 12-13 0.046169057094935795 1101 14-15 0.10125528772746861 1101 16-17 -0.012965883206923934 1101 18-19 0.1000913619183521 1101 20-21 0.044185377086925826 1101 22-23 -0.026113238717428544 1101 24-25 0.006770794222923371 1101 26-27 -0.042577157017340994 1101 28-29 0.21292333108057448 1101 30-31 0.1552964881980401 1101 32-33 0.11437135490976402 1101 34-35 0.0677580035543528 1101 36-37 -0.03723936822607499 1101 38-39 0.024717779279612273 1101 40-41 0.06188831318364407 1101 42-43 0.003078771495083288 1101 44-45 0.06678180771444886 1101 46-47 -0.08233836449650767 1101 48-49 -0.18793647217841425 1101 50-51 -0.009286375810361847 1101 52-53 0.006313984631169944 1101 54-55 0.025393607168780363 1101 56-57 -0.13114189882606553 1101 58-59 -0.07031113113564658 1101 60-61 0.0022840479587529217 1101 62-63 0.29277114465219967 1101 64-65 -0.06332131861530144 1101 66-67 -0.13214312532853256 1101 68-69 0.2578220820505166 1101 70-71 0.182823959350209 1101 72-73 0.13352606943506373 1101 74-75 0.3340216765537818 1101 76-77 0.32571775424895577 1101 78-79 0.41624740306875907 1101 80-81 0.1984618657855819 1101 82-83 0.14774348577006435 1101 84-85 0.1462979650071361 1101 86-87 0.015906986057920847 1101 88-89 0.34207529223299105 1101 90-91 0.5487785036669877 1101 92-93 -0.24058221321118367 1101 94-95 -0.15932016720482522 1101 96-97 -0.014999624540060097 1101 98-99 -0.17430101874796478 1101 100 0.04651948637080494 1104 1 0.024154589371981672 1104 2 -0.12007208830817717 1104 3 -0.05884708768240898 1104 4 -0.10983454732046738 1104 5 -0.07535480964181573 1104 6 -0.09285124277239731 1104 7 -0.00939901379189223 1104 8 0.04048709669345385 1104 9 -0.028822807939725692 1104 10-11 -0.13584140572200454 1104 12-13 -0.0461690570949429 1104 14-15 -0.10125528772746861 1104 16-17 0.012965883206923934 1104 18-19 -0.1000913619183521 1104 20-21 -0.04418537708693293 1104 22-23 0.026113238717428544 1104 24-25 -0.006770794222923371 1104 26-27 0.0425771570173481 1104 28-29 -0.21292333108057448 1104 30-31 -0.1552964881980472 1104 32-33 -0.11437135490976402 1104 34-35 -0.0677580035543528 1104 36-37 0.03723936822608209 1104 38-39 -0.02471777927961938 1104 40-41 -0.06188831318365118 1104 42-43 -0.003078771495083288 1104 44-45 -0.06678180771444886 1104 46-47 0.08233836449651477 1104 48-49 0.18793647217841425 1104 50-51 0.009286375810368952 1104 52-53 -0.00631398463117705 1104 54-55 -0.025393607168780363 1104 56-57 0.13114189882605842 1104 58-59 0.07031113113563947 1104 60-61 -0.0022840479587529217 1104 62-63 -0.29277114465219967 1104 64-65 0.06332131861530144 1104 66-67 0.13214312532852546 1104 68-69 -0.2578220820505095 1104 70-71 -0.1828239593502019 1104 72-73 -0.13352606943505663 1104 74-75 -0.3340216765537818 1104 76-77 -0.32571775424895577 1104 78-79 -0.41624740306875907 1104 80-81 -0.198461865785589 1104 82-83 -0.14774348577007146 1104 84-85 -0.1462979650071361 1104 86-87 -0.015906986057920847 1104 88-89 -0.34207529223298394 1104 90-91 -0.5487785036669948 1104 92-93 0.24058221321118367 1104 94-95 0.15932016720482522 1104 96-97 0.014999624540060097 1104 98-99 0.17430101874796478 1104 100 -0.04651948637080139 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 1.0 27 16.0 28 36.0 29 52.0 30 73.0 31 115.0 32 134.0 33 208.0 34 287.0 35 487.0 36 755.0 37 869.0 38 834.0 39 132.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.250000000000004 8.975 13.525 50.24999999999999 2 27.6 17.424999999999997 30.275000000000002 24.7 3 27.35 22.125 22.075 28.449999999999996 4 30.875000000000004 25.85 15.575 27.700000000000003 5 29.625 29.475 18.65 22.25 6 23.125 33.45 18.05 25.374999999999996 7 21.675 13.850000000000001 37.375 27.1 8 23.95 20.549999999999997 21.65 33.85 9 23.375 18.825 28.125 29.675 10-11 27.786813461779058 25.972726135368447 18.378581258601276 27.861879144251223 12-13 24.6530816352044 20.715089386173272 25.390673834229275 29.241155144393048 14-15 26.1125 22.3375 23.9125 27.6375 16-17 27.037499999999998 22.400000000000002 22.575 27.987499999999997 18-19 25.974999999999998 23.1875 22.650000000000002 28.1875 20-21 26.337500000000002 23.5375 23.1625 26.9625 22-23 25.85 23.05 22.7125 28.3875 24-25 26.474999999999998 23.200000000000003 22.900000000000002 27.425 26-27 26.6125 23.1875 22.7 27.500000000000004 28-29 26.075 23.425 22.412499999999998 28.0875 30-31 27.1 23.4375 22.35 27.1125 32-33 26.275 23.6875 22.5875 27.450000000000003 34-35 26.5375 23.6875 22.112499999999997 27.6625 36-37 26.974999999999998 23.2625 21.45 28.3125 38-39 27.925 23.7 21.9375 26.437500000000004 40-41 27.025 23.8375 22.025 27.1125 42-43 26.5375 22.662499999999998 23.200000000000003 27.6 44-45 25.887500000000003 23.425 22.6875 28.000000000000004 46-47 26.775 23.375 21.8625 27.987499999999997 48-49 27.0875 23.0875 23.25 26.575 50-51 26.237500000000004 23.4375 22.650000000000002 27.675 52-53 26.924999999999997 22.9625 22.787499999999998 27.325 54-55 26.7625 23.25 22.075 27.9125 56-57 26.787499999999998 24.1375 22.125 26.950000000000003 58-59 27.9125 22.9625 22.125 27.0 60-61 26.6625 22.650000000000002 22.3625 28.325 62-63 27.0875 23.674999999999997 22.3 26.937499999999996 64-65 26.6625 23.1 22.7375 27.500000000000004 66-67 26.6625 23.1125 22.787499999999998 27.437499999999996 68-69 26.8375 22.8875 22.537499999999998 27.737499999999997 70-71 27.4125 22.125 22.6125 27.85 72-73 27.5875 22.8375 22.45 27.125 74-75 26.55 22.725 22.7625 27.962500000000002 76-77 27.3 22.325 22.7375 27.6375 78-79 27.3875 23.025000000000002 22.45 27.1375 80-81 27.1625 22.625 23.1625 27.05 82-83 28.075 21.8625 22.6875 27.375 84-85 27.6125 22.15 22.875 27.3625 86-87 27.712500000000002 23.275000000000002 21.8125 27.200000000000003 88-89 28.249999999999996 22.037499999999998 22.475 27.237499999999997 90-91 26.825 22.8 23.3625 27.0125 92-93 27.725 23.5625 22.025 26.687499999999996 94-95 27.775 22.45 21.912499999999998 27.8625 96-97 27.712500000000002 22.6125 22.3875 27.287499999999998 98-99 27.875 22.7 21.65 27.775 100 27.125 22.85 21.65 28.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 3.0 29 3.0 30 3.5 31 3.0 32 5.0 33 11.5 34 13.0 35 18.5 36 28.0 37 32.5 38 51.0 39 66.5 40 72.0 41 82.5 42 109.5 43 137.5 44 139.0 45 126.5 46 123.0 47 136.5 48 140.0 49 139.0 50 137.0 51 120.5 52 104.5 53 96.0 54 94.0 55 98.0 56 89.5 57 89.5 58 108.0 59 116.5 60 122.0 61 123.5 62 114.5 63 110.5 64 110.0 65 110.0 66 97.5 67 86.0 68 87.5 69 88.0 70 84.0 71 70.0 72 65.0 73 63.0 74 46.0 75 32.5 76 31.5 77 23.0 78 14.0 79 9.5 80 5.5 81 4.5 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.08750000000000001 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01490275322051 98.0 2 0.9345794392523363 1.8499999999999999 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550420 spots for SRR8618246.sra Written 550420 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra Read 550406 spots for SRR8618246.sra Written 550406 spots for SRR8618246.sra SRR ids: ['SRR8618246.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7_9nzcx1 SRR8618246.sra spots: 11008134 blocks: [[1, 550406], [550407, 1100812], [1100813, 1651218], [1651219, 2201624], [2201625, 2752030], [2752031, 3302436], [3302437, 3852842], [3852843, 4403248], [4403249, 4953654], [4953655, 5504060], [5504061, 6054466], [6054467, 6604872], [6604873, 7155278], [7155279, 7705684], [7705685, 8256090], [8256091, 8806496], [8806497, 9356902], [9356903, 9907308], [9907309, 10457714], [10457715, 11008134]] SRR8618246 file size 2864631 SRR8618246 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618246 SRR8618246_1.fastq SRR8618246_2.fastq Input file: SRR8618246_1.fastq Paired file: SRR8618246_2.fastq trimmed: SRR8618246-trimmed-pair1.fastq, SRR8618246-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:06:26 2024 >> started Sat Dec 7 10:06:37 2024 >> done (10.100s) 11008134 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11008134 (100.00%) read pairs available; of these: 1505313 (13.67%) trimmed read pairs available after processing 9502821 (86.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 79 1 0.00% 80 0 0.00% 81 9 0.00% 82 23 0.00% 83 72 0.00% 84 4460 0.04% 85 4673 0.04% 86 5287 0.05% 87 5822 0.05% 88 7314 0.07% 89 9296 0.08% 90 16265 0.15% 91 31918 0.29% 92 46672 0.42% 93 65893 0.60% 94 91542 0.83% 95 117199 1.06% 96 155588 1.41% 97 218593 1.99% 98 311301 2.83% 99 413385 3.76% 100 9502821 86.33% 11008134 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.15 fanout-score-rank=11 prefix-density=0.45 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.17 sequence-density-rank=24 fanout-score=19.12 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=6.3 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=30 prefix-density=0.42 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=27 fanout-score=18.60 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=6.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618246 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:07:13 Started mapping on | Dec 07 10:07:13 Finished on | Dec 07 10:07:37 Mapping speed, Million of reads per hour | 1651.22 Number of input reads | 11008134 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10798013 Uniquely mapped reads % | 98.09% Average mapped length | 198.39 Number of splices: Total | 6304372 Number of splices: Annotated (sjdb) | 6009716 Number of splices: GT/AG | 6222599 Number of splices: GC/AG | 70915 Number of splices: AT/AC | 1898 Number of splices: Non-canonical | 8960 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 95952 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 8531 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 114169 114169 114169 N_multimapping 95952 95952 95952 N_noFeature 225445 5393631 5446045 N_ambiguous 223660 19830 20935 UnstrandedReadsAssigned:10348908 PositiveStrandReadsAssigned:5384552 NegativeStrandReadsAssigned:5331033 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618246 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618246-trimmed-pair1.fastq SRR8618246-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,008,134 reads, 10,588,839 reads pseudoaligned [quant] estimated average fragment length: 167.286 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52973 SRR8618246.ke.tsv 35125 SRR8618246.se.tsv 88098 total ==> SRR8618246.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.914 0 0 PNS24247 1044 877.714 17.9951 2.58794 PNS24249 1928 1761.71 76.7596 5.49985 PNS24246 1044 877.714 17.9951 2.58794 PNS24248 1044 877.714 17.9951 2.58794 PNS24244 1471 1304.71 6.25519 0.605173 PNS24243 293 134.531 8 7.50622 KQK14069 1603 1436.71 2938.74 258.193 KQK14071 474 309.195 277.362 113.232 ==> SRR8618246.se.tsv <== BRADI_1g14170v3 3384 BRADI_1g53295v3 22 BRADI_1g59795v3 222 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 459 BRADI_1g74790v3 112 BRADI_1g09890v3 0 BRADI_1g77505v3 127 BRADI_1g48960v3 0 SRR8618246 completed mapping pipeline successfully