Starting /dee2/code/volunteer_pipeline.sh SRR8618247 current disk space = 1543827771392 free memory = 1605891400 SRR8618247 SRAfilesize 0f30d07c571c156e0f9354b5915ff161 SRR8618247.sra SRR8618247.sra file validated SRR8618247 is paired end SRR8618247 is conventional basespace SRR8618247 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618247_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00325 34.0 31.0 34.0 31.0 34.0 2 33.166 34.0 33.0 34.0 31.0 34.0 3 33.2565 34.0 34.0 34.0 31.0 34.0 4 28.0345 37.0 28.0 37.0 2.0 37.0 5 32.18575 37.0 25.0 37.0 19.0 37.0 6 35.1715 37.0 33.0 37.0 32.0 37.0 7 35.986 37.0 35.0 37.0 35.0 37.0 8 36.18475 37.0 35.0 37.0 35.0 37.0 9 38.31175 39.0 39.0 39.0 37.0 39.0 10-11 38.341499999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.326750000000004 39.0 39.0 39.0 37.0 39.0 14-15 39.897375 41.0 40.0 41.0 38.0 41.0 16-17 39.827124999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.80525 41.0 40.0 41.0 38.0 41.0 20-21 39.6635 41.0 39.5 41.0 37.0 41.0 22-23 39.489625000000004 41.0 39.0 41.0 37.0 41.0 24-25 39.399125 40.5 39.0 41.0 36.0 41.0 26-27 39.309875000000005 40.0 39.0 41.0 36.0 41.0 28-29 39.12375 40.0 38.0 41.0 36.0 41.0 30-31 38.869125 40.0 38.0 41.0 35.0 41.0 32-33 38.836875000000006 40.0 38.0 41.0 35.0 41.0 34-35 39.1095 40.0 38.0 41.0 35.0 41.0 36-37 39.141625 40.0 38.0 41.0 35.0 41.0 38-39 38.961875 40.0 38.0 41.0 35.0 41.0 40-41 38.85225 40.0 38.0 41.0 35.0 41.0 42-43 38.599999999999994 40.0 37.0 41.0 35.0 41.0 44-45 38.26275 40.0 36.5 41.0 34.0 41.0 46-47 38.102125 40.0 35.5 41.0 34.0 41.0 48-49 37.92274999999999 39.5 35.0 41.0 33.5 41.0 50-51 37.638 39.0 35.0 41.0 33.0 41.0 52-53 37.368875 39.0 35.0 41.0 33.0 41.0 54-55 37.114875 38.0 35.0 41.0 33.0 41.0 56-57 36.841750000000005 37.0 35.0 40.0 33.0 41.0 58-59 36.581999999999994 37.0 35.0 40.0 33.0 41.0 60-61 36.2565 36.0 35.0 40.0 32.0 41.0 62-63 35.98225 35.5 35.0 39.0 32.0 41.0 64-65 35.704499999999996 35.0 34.0 39.0 31.5 41.0 66-67 35.5065 35.0 34.0 39.0 31.0 40.5 68-69 35.115375 35.0 34.0 37.5 31.0 40.0 70-71 34.690875000000005 35.0 34.0 37.0 30.0 39.5 72-73 34.4645 35.0 34.0 36.5 30.0 39.0 74-75 34.197874999999996 35.0 33.0 36.0 30.0 39.0 76-77 33.435 34.5 32.5 35.0 29.0 37.0 78-79 33.779875000000004 35.0 33.0 35.0 30.0 37.0 80-81 33.6435 35.0 33.0 35.0 29.5 37.0 82-83 33.505750000000006 35.0 33.0 35.0 29.0 36.0 84-85 33.223124999999996 35.0 33.0 35.0 29.0 36.0 86-87 32.99825 35.0 33.0 35.0 29.0 36.0 88-89 32.775125 35.0 33.0 35.0 28.5 35.0 90-91 32.465625 35.0 32.5 35.0 27.0 35.0 92-93 32.223625 34.0 32.0 35.0 27.0 35.0 94-95 32.047625000000004 34.0 32.0 35.0 27.0 35.0 96-97 31.64525 34.0 32.0 35.0 25.0 35.0 98-99 31.22475 34.0 32.0 35.0 24.5 35.0 100 30.75975 34.0 31.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 0.2564165308459678 1101 2 0.09624322213343106 1101 3 0.16737865304998678 1101 4 -1.8493454270187613 1101 5 -0.863885841388516 1101 6 -0.18138330932956848 1101 7 0.020906906012079673 1101 8 -0.03271766301116941 1101 9 0.14500984982218768 1101 10-11 0.20703588826734887 1101 12-13 0.18027206277398733 1101 14-15 0.19731684522761128 1101 16-17 0.06915387845214127 1101 18-19 0.2887982915938636 1101 20-21 0.2619086532456194 1101 22-23 0.23620595985727277 1101 24-25 0.023763279200700538 1101 26-27 0.08736092487497871 1101 28-29 0.23582927376185125 1101 30-31 0.008285438666987943 1101 32-33 -0.004495552154395455 1101 34-35 -0.10265531341095624 1101 36-37 0.1999473271540566 1101 38-39 -0.04174368189213595 1101 40-41 0.13249583508282115 1101 42-43 0.026728158451959416 1101 44-45 0.3172249235867497 1101 46-47 0.08289110716817305 1101 48-49 0.18608037274315592 1101 50-51 -0.02872716820245813 1101 52-53 0.07670641209127638 1101 54-55 0.268915646694623 1101 56-57 0.15040309776532013 1101 58-59 0.2867777612234548 1101 60-61 8.117638029148111E-4 1101 62-63 -0.015126286910494002 1101 64-65 0.22724164345299158 1101 66-67 0.09903939778382664 1101 68-69 -0.02574889499894084 1101 70-71 0.23754068977349618 1101 72-73 0.062245458471970494 1101 74-75 0.15312944427137865 1101 76-77 0.12545392706164904 1101 78-79 0.40263890958179616 1101 80-81 0.18981909134825514 1101 82-83 0.1259597368765597 1101 84-85 0.22132001161812553 1101 86-87 0.49180229924497354 1101 88-89 0.7732096875898264 1101 90-91 0.37665494319609394 1101 92-93 0.13297711440090865 1101 94-95 0.153077523894666 1101 96-97 0.26757113467844107 1101 98-99 0.4498614704151649 1101 100 0.06854573282225118 1103 1 -0.07544136082555042 1103 2 -0.061706690504891526 1103 3 -0.16704184782362574 1103 4 6.757468783814087 1103 5 3.366166575617889 1103 6 1.0966015479796951 1103 7 0.27606124497538786 1103 8 0.4089829776411307 1103 9 -0.2163762887916718 1103 10-11 -0.1986135002009135 1103 12-13 -0.23571512417999685 1103 14-15 -0.2788334168574238 1103 16-17 -0.13139941217103512 1103 18-19 -0.030537759658315622 1103 20-21 -0.017706955374066524 1103 22-23 0.07339291384678859 1103 24-25 -0.044174985213970785 1103 26-27 -0.1211422783865217 1103 28-29 -0.06568499531211813 1103 30-31 -0.30476057181640925 1103 32-33 -0.1440412714322008 1103 34-35 0.18278440703167576 1103 36-37 -0.12873642357396164 1103 38-39 0.024709434007696984 1103 40-41 -0.04857580149260343 1103 42-43 -0.02021418284098786 1103 44-45 -0.34983972405448327 1103 46-47 -0.144715182872595 1103 48-49 -0.3133372160745509 1103 50-51 -0.053945572395811325 1103 52-53 -0.07172107771652492 1103 54-55 -0.27351300793554145 1103 56-57 -0.20044139844901565 1103 58-59 -0.0928669679553451 1103 60-61 -0.13855923212020116 1103 62-63 0.026923800451179147 1103 64-65 0.0013534663999976715 1103 66-67 -0.02192740477877919 1103 68-69 0.3280367776859734 1103 70-71 -0.0834261127891196 1103 72-73 0.03175623307884479 1103 74-75 -0.10304411426093907 1103 76-77 0.11103925029985362 1103 78-79 -0.03530517894470364 1103 80-81 -0.11862587079501452 1103 82-83 0.17913387782006396 1103 84-85 -0.1664202329945752 1103 86-87 -0.1280870426303835 1103 88-89 -0.26869479697627696 1103 90-91 -0.7126578116087963 1103 92-93 -0.3131498512368296 1103 94-95 -0.42065573178384597 1103 96-97 -0.36131645996337625 1103 98-99 -0.1680767939995107 1103 100 -0.41246766263494195 1104 1 -0.18097517002042451 1104 2 -0.034536531628539535 1104 3 -3.3680522634682575E-4 1104 4 -4.908123356795322 1104 5 -2.502280734229373 1104 6 -0.9152182386501337 1104 7 -0.29696815098746754 1104 8 -0.37626531462995416 1104 9 0.07136643896947703 1104 10-11 -0.008422388066442466 1104 12-13 0.055443061406002414 1104 14-15 0.0815165716297983 1104 16-17 0.06224553371889385 1104 18-19 -0.258260531935548 1104 20-21 -0.2442016978715742 1104 22-23 -0.30959887370406136 1104 24-25 0.02041170601328446 1104 26-27 0.033781353511550094 1104 28-29 -0.17014427844973312 1104 30-31 0.2964751331494355 1104 32-33 0.14853682358660336 1104 34-35 -0.08012909362071241 1104 36-37 -0.07121090358010207 1104 38-39 0.017034247884431863 1104 40-41 -0.08392003359022482 1104 42-43 -0.006513975610971556 1104 44-45 0.03261480046773357 1104 46-47 0.061824075704421944 1104 48-49 0.12725684333138787 1104 50-51 0.08267274059827656 1104 52-53 -0.00498533437475146 1104 54-55 0.0045973612409113684 1104 56-57 0.050038300683695525 1104 58-59 -0.19391079326810967 1104 60-61 0.13774746831728635 1104 62-63 -0.01179751354067804 1104 64-65 -0.22859510985298215 1104 66-67 -0.07711199300504745 1104 68-69 -0.30228788268703966 1104 70-71 -0.15411457698436948 1104 72-73 -0.09400169155082239 1104 74-75 -0.050085330010425366 1104 76-77 -0.23649317736151687 1104 78-79 -0.3673337306370854 1104 80-81 -0.07119322055324773 1104 82-83 -0.30509361469663077 1104 84-85 -0.05489977862355744 1104 86-87 -0.3637152566145758 1104 88-89 -0.5045148906135495 1104 90-91 0.3360028684126988 1104 92-93 0.18017273683593515 1104 94-95 0.26757820788918707 1104 96-97 0.09374532528492097 1104 98-99 -0.28178467641565774 1104 100 0.34392192981267655 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 8.0 28 26.0 29 58.0 30 84.0 31 100.0 32 151.0 33 210.0 34 330.0 35 477.0 36 762.0 37 962.0 38 695.0 39 134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.425 10.5 13.55 47.525 2 25.650000000000002 18.575 31.05 24.725 3 27.375 22.375 22.775000000000002 27.474999999999998 4 28.8135593220339 27.18511133266866 17.414423396477236 26.586905948820206 5 31.775 28.975 18.35 20.9 6 22.980745186296573 32.65816454113528 19.154788697174293 25.206301575393848 7 21.8 14.325 38.4 25.474999999999998 8 22.400000000000002 19.675 23.825 34.1 9 23.3 18.7 28.525 29.475 10-11 27.187499999999996 26.075 19.1375 27.6 12-13 25.624999999999996 21.087500000000002 25.724999999999998 27.5625 14-15 25.8125 23.05 23.75 27.3875 16-17 26.787499999999998 22.675 23.075000000000003 27.462500000000002 18-19 26.1 24.3 22.287499999999998 27.3125 20-21 26.2125 23.7 23.5625 26.525 22-23 25.912499999999998 23.1375 23.3 27.650000000000002 24-25 26.7625 23.4625 22.4625 27.3125 26-27 26.7125 23.400000000000002 23.2625 26.625 28-29 26.5375 23.6875 22.725 27.05 30-31 25.775 23.4875 23.3375 27.400000000000002 32-33 26.1125 23.575 23.1125 27.200000000000003 34-35 26.137500000000003 23.0875 23.1625 27.6125 36-37 25.5 23.6875 23.175 27.6375 38-39 27.1375 23.8375 22.225 26.8 40-41 27.200000000000003 22.875 22.3875 27.537499999999998 42-43 26.7125 22.900000000000002 22.8625 27.525 44-45 26.7125 23.4125 23.400000000000002 26.474999999999998 46-47 26.900000000000002 23.075000000000003 22.6375 27.3875 48-49 26.075 23.4875 23.275000000000002 27.1625 50-51 26.325 23.175 23.5125 26.987499999999997 52-53 26.687499999999996 23.549999999999997 23.025000000000002 26.737499999999997 54-55 26.4125 23.6375 22.787499999999998 27.1625 56-57 26.674999999999997 23.4125 22.775000000000002 27.1375 58-59 26.9625 23.3 22.925 26.8125 60-61 26.137500000000003 23.575 22.6875 27.6 62-63 26.974999999999998 22.8125 23.025000000000002 27.187499999999996 64-65 25.6 23.125 23.05 28.225 66-67 25.937500000000004 22.475 24.1625 27.425 68-69 26.1125 22.537499999999998 23.225 28.125 70-71 26.5375 22.9625 23.724999999999998 26.775 72-73 26.275 22.275 24.4125 27.037499999999998 74-75 27.2625 23.3125 22.975 26.450000000000003 76-77 27.187499999999996 23.0 22.475 27.3375 78-79 26.875 24.2 23.025000000000002 25.900000000000002 80-81 27.775 23.45 21.85 26.924999999999997 82-83 27.487499999999997 22.25 23.525 26.737499999999997 84-85 26.2625 23.7375 22.9625 27.037499999999998 86-87 27.375 23.0125 23.1625 26.450000000000003 88-89 26.8625 22.412499999999998 23.7125 27.0125 90-91 26.974999999999998 23.125 23.225 26.674999999999997 92-93 26.728341042630326 23.302912864108013 22.95286910863858 27.015876984623077 94-95 27.625 22.9625 23.075000000000003 26.337500000000002 96-97 26.6 23.5 23.599999999999998 26.3 98-99 27.6625 23.325000000000003 22.787499999999998 26.224999999999998 100 27.35 22.925 23.125 26.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 2.0 29 5.5 30 6.5 31 6.5 32 9.5 33 14.5 34 14.5 35 24.0 36 35.0 37 48.0 38 56.5 39 74.5 40 97.5 41 111.5 42 122.0 43 123.5 44 149.5 45 156.5 46 150.0 47 142.5 48 119.5 49 113.5 50 111.5 51 115.5 52 112.5 53 93.5 54 87.5 55 85.5 56 89.0 57 106.5 58 120.5 59 124.5 60 120.0 61 113.0 62 110.0 63 112.5 64 105.5 65 94.0 66 89.5 67 81.0 68 78.0 69 76.0 70 71.0 71 64.0 72 53.0 73 43.5 74 36.0 75 32.0 76 25.0 77 18.5 78 14.5 79 11.0 80 9.5 81 5.0 82 2.0 83 1.5 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 24.775 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01465386558868 97.975 2 0.9348155634158665 1.8499999999999999 3 0.025265285497726126 0.075 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618247 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618247_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0905 33.0 31.0 34.0 31.0 34.0 2 32.8505 34.0 31.0 34.0 31.0 34.0 3 32.78525 34.0 31.0 34.0 31.0 34.0 4 36.28175 37.0 37.0 37.0 35.0 37.0 5 36.3755 37.0 37.0 37.0 35.0 37.0 6 36.45 37.0 37.0 37.0 35.0 37.0 7 36.46125 37.0 37.0 37.0 35.0 37.0 8 36.506 37.0 37.0 37.0 35.0 37.0 9 38.38175 39.0 39.0 39.0 37.0 39.0 10-11 38.037375 39.0 39.0 39.0 37.0 39.0 12-13 37.482875 39.0 38.5 39.0 36.0 39.0 14-15 39.29175 41.0 39.5 41.0 36.5 41.0 16-17 39.64375 41.0 39.0 41.0 37.0 41.0 18-19 39.771625 41.0 40.0 41.0 37.5 41.0 20-21 39.742875 41.0 40.0 41.0 37.5 41.0 22-23 39.68 41.0 39.0 41.0 37.0 41.0 24-25 39.532875 41.0 39.0 41.0 37.0 41.0 26-27 39.48675 41.0 39.0 41.0 36.5 41.0 28-29 39.2745 40.0 39.0 41.0 36.0 41.0 30-31 39.14075 40.0 38.0 41.0 35.5 41.0 32-33 39.15075 40.0 38.0 41.0 35.0 41.0 34-35 39.056 40.0 38.0 41.0 35.0 41.0 36-37 38.823 40.0 38.0 41.0 35.0 41.0 38-39 38.60975 40.0 38.0 41.0 34.5 41.0 40-41 38.421 40.0 37.0 41.0 34.0 41.0 42-43 38.24225 40.0 37.0 41.0 34.0 41.0 44-45 37.90475 39.5 36.0 41.0 33.0 41.0 46-47 37.559875 39.0 35.0 41.0 33.0 41.0 48-49 37.484625 39.0 35.0 41.0 33.0 41.0 50-51 37.002375 38.5 34.5 40.0 32.0 40.5 52-53 37.019 38.0 35.0 40.0 33.0 41.0 54-55 37.21 38.0 35.0 41.0 33.0 41.0 56-57 37.059625 37.0 35.0 41.0 33.0 41.0 58-59 36.77475 37.0 35.0 40.0 33.0 41.0 60-61 36.482625 36.0 35.0 40.0 33.0 41.0 62-63 36.13575 35.5 35.0 39.5 32.0 41.0 64-65 35.836375000000004 35.0 35.0 39.0 31.5 41.0 66-67 35.534125 35.0 35.0 39.0 31.0 41.0 68-69 35.256625 35.0 34.0 37.5 31.0 40.5 70-71 35.047 35.0 34.0 37.0 31.0 39.5 72-73 34.696875000000006 35.0 34.0 36.5 30.5 39.0 74-75 34.406000000000006 35.0 34.0 36.0 30.0 39.0 76-77 34.137375 35.0 33.5 36.0 30.0 37.5 78-79 33.964749999999995 35.0 33.0 35.0 30.0 37.0 80-81 33.701499999999996 35.0 33.0 35.0 29.5 37.0 82-83 33.481750000000005 35.0 33.0 35.0 29.0 36.0 84-85 33.179125 35.0 33.0 35.0 29.0 36.0 86-87 32.905249999999995 35.0 33.0 35.0 28.0 35.5 88-89 32.677625 35.0 32.5 35.0 27.5 35.0 90-91 32.394625000000005 35.0 32.5 35.0 27.0 35.0 92-93 32.1375 34.5 32.0 35.0 27.0 35.0 94-95 31.8415 34.0 32.0 35.0 25.0 35.0 96-97 31.512749999999997 34.0 32.0 35.0 25.0 35.0 98-99 31.11475 34.0 31.0 35.0 24.0 35.0 100 30.81875 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.06736164724543414 1101 2 0.129000314532135 1101 3 0.3431295797158356 1101 4 0.0924197754932834 1101 5 0.1665103035611395 1101 6 0.2974366383286764 1101 7 0.21640954793153355 1101 8 0.05385241670541774 1101 9 0.0586206637079556 1101 10-11 0.2061243470448204 1101 12-13 0.577297702410462 1101 14-15 0.46875341432911455 1101 16-17 0.1754526478639633 1101 18-19 0.1512464652758041 1101 20-21 0.07474833666677227 1101 22-23 -0.003286484599222206 1101 24-25 0.18730704807827436 1101 26-27 0.14480337226609663 1101 28-29 0.06888900928396424 1101 30-31 0.06492515188590886 1101 32-33 0.11813089653698938 1101 34-35 0.2116831382180635 1101 36-37 0.18191169322130207 1101 38-39 0.17130278007280708 1101 40-41 -0.2227832632784441 1101 42-43 -0.3424007380218157 1101 44-45 -0.1893676098115904 1101 46-47 -0.2134661893001919 1101 48-49 -0.3278269140183454 1101 50-51 0.2357407833806633 1101 52-53 0.1655131313404965 1101 54-55 0.27802007286911845 1101 56-57 0.17894380409313015 1101 58-59 -0.12043676323856545 1101 60-61 -0.17893462396855142 1101 62-63 -0.07794286952634621 1101 64-65 -0.15889531497609966 1101 66-67 0.04734250442828625 1101 68-69 -0.07880158740908172 1101 70-71 -0.0817983713556032 1101 72-73 -0.141741273990597 1101 74-75 -0.29775688923201926 1101 76-77 -0.30207606259941855 1101 78-79 -0.01650300460962484 1101 80-81 0.2904206152489408 1101 82-83 0.04415068045792481 1101 84-85 -0.2596684018607007 1101 86-87 -0.30248104153780986 1101 88-89 0.24472270756488257 1101 90-91 0.010226508286940827 1101 92-93 0.1754622794700822 1101 94-95 -0.13581151548807213 1101 96-97 -0.46312720191307477 1101 98-99 -0.64060489496282 1101 100 -0.5237501862361356 1103 1 0.1615375354224895 1103 2 -0.10774983107065594 1103 3 -0.4750416491717573 1103 4 -0.2290711971333934 1103 5 -0.3050680307428806 1103 6 -0.31776429352921554 1103 7 -0.274679560979358 1103 8 -0.10433046040582639 1103 9 -0.14865947607072627 1103 10-11 -0.25520355045080834 1103 12-13 -1.3198484827962957 1103 14-15 -1.092021192543335 1103 16-17 -0.2978729199869363 1103 18-19 -0.221758776424835 1103 20-21 0.1393086162241417 1103 22-23 -0.058702908594554515 1103 24-25 -0.23767839164217008 1103 26-27 -0.44902306920157997 1103 28-29 -0.4473311421429429 1103 30-31 -0.21058445789859803 1103 32-33 -0.05557323858240437 1103 34-35 -0.041811328875702714 1103 36-37 -0.1947627389277926 1103 38-39 0.09882170843623328 1103 40-41 0.16312238611002527 1103 42-43 0.17052879022512712 1103 44-45 0.043509501428943054 1103 46-47 0.06047091029212481 1103 48-49 0.23577238708823955 1103 50-51 -0.09396218691636449 1103 52-53 -0.23766100960300918 1103 54-55 -0.24003467378201293 1103 56-57 -0.06322276550501016 1103 58-59 0.03471757572474132 1103 60-61 0.038945399327893426 1103 62-63 0.001439774620415335 1103 64-65 0.1381052674350869 1103 66-67 -0.1794775305163867 1103 68-69 -0.08418889084530434 1103 70-71 -0.10984146978309184 1103 72-73 0.15030881337108326 1103 74-75 0.2630468381995499 1103 76-77 0.15666010513499629 1103 78-79 -0.19702135056186876 1103 80-81 -0.09545591358041605 1103 82-83 -0.07867983788803201 1103 84-85 0.22847953057959813 1103 86-87 -0.12071051154363488 1103 88-89 -0.28160227787484615 1103 90-91 -0.2372108825109649 1103 92-93 -0.24547540253341538 1103 94-95 -0.05176958188295089 1103 96-97 -0.3278039637069057 1103 98-99 0.14099091167667055 1103 100 0.2677466105023605 1104 1 -0.22889918266793075 1104 2 -0.021250483461479064 1104 3 0.1319120694559217 1104 4 0.13665142164011002 1104 5 0.1385577271817482 1104 6 0.02032765520053914 1104 7 0.05827001304781021 1104 8 0.05047804370040154 1104 9 0.09003881236277067 1104 10-11 0.049079203405973715 1104 12-13 0.7425507803858338 1104 14-15 0.6232677782142062 1104 16-17 0.12242027212297302 1104 18-19 0.07051231114903089 1104 20-21 -0.21405695289091398 1104 22-23 0.06198939319376251 1104 24-25 0.050371343563902826 1104 26-27 0.30421969693549755 1104 28-29 0.37844213285897865 1104 30-31 0.14565930601268207 1104 32-33 -0.0625576579545779 1104 34-35 -0.1698718093423608 1104 36-37 0.012851045706483433 1104 38-39 -0.27012448850904036 1104 40-41 0.059660877168433046 1104 42-43 0.17187194779669568 1104 44-45 0.14585810838266156 1104 46-47 0.1529952790080671 1104 48-49 0.09205452693012006 1104 50-51 -0.1417785964642917 1104 52-53 0.07214787826251978 1104 54-55 -0.037985399087098415 1104 56-57 -0.1157210385881271 1104 58-59 0.08571918751382412 1104 60-61 0.1399892246406651 1104 62-63 0.07650309490593799 1104 64-65 0.020790047541005663 1104 66-67 0.13213502608811467 1104 68-69 0.16299047825439317 1104 70-71 0.19163984113870214 1104 72-73 -0.008567539380472056 1104 74-75 0.03471005103245517 1104 76-77 0.14541595746441516 1104 78-79 0.2135243551714936 1104 80-81 -0.19496470166853186 1104 82-83 0.034529157430107205 1104 84-85 0.031188871281109698 1104 86-87 0.42319155308143763 1104 88-89 0.03687957030997069 1104 90-91 0.22698437422400985 1104 92-93 0.07001312306333318 1104 94-95 0.18758109737102302 1104 96-97 0.7909311656199804 1104 98-99 0.49961398328615303 1104 100 0.256003575733768 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 7.0 27 13.0 28 29.0 29 47.0 30 83.0 31 117.0 32 118.0 33 200.0 34 283.0 35 498.0 36 750.0 37 876.0 38 831.0 39 148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.975 9.525 13.625000000000002 48.875 2 26.55 18.55 30.2 24.7 3 27.640845070422536 22.811871227364186 21.830985915492956 27.71629778672032 4 30.88346337780015 26.32771205638057 15.982884470173673 26.80594009564561 5 31.0 29.549999999999997 18.725 20.724999999999998 6 23.7 32.2 20.1 24.0 7 21.224999999999998 14.875 38.1 25.8 8 23.150000000000002 18.925 24.525 33.4 9 21.85 19.0 29.349999999999998 29.799999999999997 10-11 27.723146747352494 26.197680282400405 18.456883509833585 27.622289460413512 12-13 24.812412565178686 21.175123998473865 25.995167238967316 28.017296197380137 14-15 26.525 23.200000000000003 23.35 26.924999999999997 16-17 26.724999999999998 22.375 22.75 28.15 18-19 25.8 24.2875 22.3375 27.575 20-21 26.3125 23.9 22.425 27.3625 22-23 26.337500000000002 24.337500000000002 22.2 27.125 24-25 25.724999999999998 23.8875 22.9875 27.400000000000002 26-27 26.787499999999998 23.799999999999997 22.45 26.9625 28-29 26.9125 23.1875 23.0375 26.8625 30-31 26.3 22.7625 23.6125 27.325 32-33 26.5625 24.1125 22.912499999999998 26.4125 34-35 26.400000000000002 23.6375 22.412499999999998 27.55 36-37 25.5625 23.799999999999997 22.900000000000002 27.737499999999997 38-39 25.4875 24.087500000000002 23.849999999999998 26.575 40-41 26.987499999999997 23.425 23.0875 26.5 42-43 26.55 23.0875 23.4125 26.950000000000003 44-45 26.875 24.075 22.0625 26.987499999999997 46-47 26.6125 23.4875 22.025 27.875 48-49 26.337500000000002 23.4375 23.125 27.1 50-51 26.025 22.9875 22.7625 28.225 52-53 27.2625 22.7625 22.8875 27.0875 54-55 26.075 23.3 22.95 27.675 56-57 26.637499999999996 23.4625 23.575 26.325 58-59 26.7625 23.1875 23.35 26.700000000000003 60-61 26.237500000000004 23.5875 22.425 27.750000000000004 62-63 27.500000000000004 23.35 22.975 26.174999999999997 64-65 27.150000000000002 22.2 22.6875 27.962500000000002 66-67 26.6 23.3625 23.225 26.8125 68-69 26.1125 23.0875 23.925 26.875 70-71 27.025 22.287499999999998 23.3125 27.375 72-73 26.075 22.975 23.4875 27.462500000000002 74-75 25.825 23.6875 23.0375 27.450000000000003 76-77 27.900000000000002 22.8625 22.5 26.737499999999997 78-79 26.3625 22.85 23.4375 27.35 80-81 25.7625 24.15 23.375 26.7125 82-83 27.287499999999998 22.2125 23.4125 27.0875 84-85 26.424999999999997 22.6875 24.075 26.8125 86-87 27.787499999999998 23.425 22.925 25.8625 88-89 26.987499999999997 23.3125 22.2 27.500000000000004 90-91 26.625 23.4875 23.025000000000002 26.8625 92-93 26.9625 23.05 23.674999999999997 26.3125 94-95 27.650000000000002 22.775000000000002 23.150000000000002 26.424999999999997 96-97 27.462500000000002 22.8875 23.3625 26.2875 98-99 27.237499999999997 22.8375 22.8375 27.0875 100 28.225 22.775000000000002 22.3 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.5 28 3.5 29 6.0 30 8.0 31 7.0 32 10.0 33 14.0 34 16.5 35 22.0 36 29.5 37 38.5 38 52.0 39 73.0 40 91.0 41 108.0 42 128.0 43 134.5 44 136.5 45 142.0 46 142.5 47 135.0 48 132.0 49 137.0 50 130.0 51 119.5 52 101.0 53 91.0 54 82.0 55 78.0 56 97.0 57 99.0 58 103.0 59 121.0 60 119.5 61 119.5 62 119.0 63 103.0 64 97.0 65 99.5 66 112.0 67 104.5 68 90.0 69 80.0 70 60.5 71 56.5 72 53.0 73 39.0 74 34.5 75 34.0 76 24.0 77 17.5 78 14.0 79 9.5 80 7.5 81 6.0 82 3.5 83 2.0 84 1.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.6 4 0.675 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.8500000000000001 12-13 1.7125000000000001 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.04040404040404 98.05 2 0.9090909090909091 1.7999999999999998 3 0.050505050505050504 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556197 spots for SRR8618247.sra Written 556197 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra Read 556182 spots for SRR8618247.sra Written 556182 spots for SRR8618247.sra SRR ids: ['SRR8618247.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x17pe4gn SRR8618247.sra spots: 11123655 blocks: [[1, 556182], [556183, 1112364], [1112365, 1668546], [1668547, 2224728], [2224729, 2780910], [2780911, 3337092], [3337093, 3893274], [3893275, 4449456], [4449457, 5005638], [5005639, 5561820], [5561821, 6118002], [6118003, 6674184], [6674185, 7230366], [7230367, 7786548], [7786549, 8342730], [8342731, 8898912], [8898913, 9455094], [9455095, 10011276], [10011277, 10567458], [10567459, 11123655]] SRR8618247 file size 2894808 SRR8618247 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618247 SRR8618247_1.fastq SRR8618247_2.fastq Input file: SRR8618247_1.fastq Paired file: SRR8618247_2.fastq trimmed: SRR8618247-trimmed-pair1.fastq, SRR8618247-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:10:48 2024 >> started Sat Dec 7 10:11:04 2024 >> done (15.998s) 11123655 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11123655 (100.00%) read pairs available; of these: 1452652 (13.06%) trimmed read pairs available after processing 9671003 (86.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 3 0.00% 82 29 0.00% 83 85 0.00% 84 4133 0.04% 85 4577 0.04% 86 4899 0.04% 87 5728 0.05% 88 7052 0.06% 89 9107 0.08% 90 15314 0.14% 91 30572 0.27% 92 44294 0.40% 93 63054 0.57% 94 86768 0.78% 95 111735 1.00% 96 150069 1.35% 97 211001 1.90% 98 300015 2.70% 99 404216 3.63% 100 9671003 86.94% 11123655 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.16 fanout-score-rank=13 prefix-density=0.48 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.15 sequence-density-rank=37 fanout-score=21.86 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=6.6 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=4.20 fanout-score-rank=14 prefix-density=0.48 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.16 sequence-density-rank=34 fanout-score=20.59 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=6.5 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR8618247 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:11:35 Started mapping on | Dec 07 10:11:36 Finished on | Dec 07 10:12:07 Mapping speed, Million of reads per hour | 1291.78 Number of input reads | 11123655 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 10885050 Uniquely mapped reads % | 97.85% Average mapped length | 198.42 Number of splices: Total | 6540591 Number of splices: Annotated (sjdb) | 6224906 Number of splices: GT/AG | 6453659 Number of splices: GC/AG | 75832 Number of splices: AT/AC | 1793 Number of splices: Non-canonical | 9307 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 101120 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 12008 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.46% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 137485 137485 137485 N_multimapping 101120 101120 101120 N_noFeature 290871 5470829 5516158 N_ambiguous 231013 21171 22145 UnstrandedReadsAssigned:10363166 PositiveStrandReadsAssigned:5393050 NegativeStrandReadsAssigned:5346747 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618247 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618247-trimmed-pair1.fastq SRR8618247-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,123,655 reads, 10,609,305 reads pseudoaligned [quant] estimated average fragment length: 166.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52973 SRR8618247.ke.tsv 35125 SRR8618247.se.tsv 88098 total ==> SRR8618247.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.353 0 0 PNS24247 1044 878.225 17.8617 2.6004 PNS24249 1928 1762.23 66.9389 4.8567 PNS24246 1044 878.225 17.8617 2.6004 PNS24248 1044 878.225 17.8617 2.6004 PNS24244 1471 1305.23 11.4759 1.12415 PNS24243 293 134.426 14 13.3158 KQK14069 1603 1437.23 2406.02 214.041 KQK14071 474 309.743 183.631 75.7997 ==> SRR8618247.se.tsv <== BRADI_1g14170v3 2832 BRADI_1g53295v3 12 BRADI_1g59795v3 312 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 165 BRADI_1g74790v3 55 BRADI_1g09890v3 0 BRADI_1g77505v3 130 BRADI_1g48960v3 0 SRR8618247 completed mapping pipeline successfully