Starting /dee2/code/volunteer_pipeline.sh SRR8618248 current disk space = 1543717871616 free memory = 1596695908 SRR8618248 SRAfilesize 1e7de3510d93441576795bacd0224bef SRR8618248.sra SRR8618248.sra file validated SRR8618248 is paired end SRR8618248 is conventional basespace SRR8618248 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618248_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.171 34.0 33.0 34.0 31.0 34.0 2 33.33825 34.0 34.0 34.0 31.0 34.0 3 33.36875 34.0 34.0 34.0 31.0 34.0 4 32.90075 37.0 37.0 37.0 2.0 37.0 5 34.725 37.0 37.0 37.0 19.0 37.0 6 35.976 37.0 37.0 37.0 32.0 37.0 7 36.34375 37.0 37.0 37.0 35.0 37.0 8 36.49075 37.0 37.0 37.0 35.0 37.0 9 38.47625 39.0 39.0 39.0 37.0 39.0 10-11 38.46775 39.0 39.0 39.0 37.0 39.0 12-13 38.502875 39.0 39.0 39.0 37.0 39.0 14-15 40.118875 41.0 40.0 41.0 38.0 41.0 16-17 40.057500000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.912875 41.0 40.0 41.0 38.0 41.0 20-21 39.931625 41.0 40.0 41.0 38.0 41.0 22-23 39.905375 41.0 40.0 41.0 38.0 41.0 24-25 39.783500000000004 41.0 40.0 41.0 37.5 41.0 26-27 39.611875 41.0 39.5 41.0 37.0 41.0 28-29 39.4435 40.5 39.0 41.0 36.5 41.0 30-31 39.237625 40.0 39.0 41.0 36.0 41.0 32-33 39.214875 40.0 38.5 41.0 35.5 41.0 34-35 39.292874999999995 40.5 39.0 41.0 35.0 41.0 36-37 39.266999999999996 41.0 39.0 41.0 35.0 41.0 38-39 39.157375 41.0 38.0 41.0 35.0 41.0 40-41 38.993 40.0 38.0 41.0 35.0 41.0 42-43 38.756249999999994 40.0 37.0 41.0 35.0 41.0 44-45 38.545625 40.0 37.0 41.0 35.0 41.0 46-47 38.2695 40.0 36.0 41.0 34.5 41.0 48-49 38.0625 39.5 35.0 41.0 34.0 41.0 50-51 37.787875 39.0 35.0 41.0 34.0 41.0 52-53 37.484375 39.0 35.0 41.0 33.0 41.0 54-55 37.213875 38.0 35.0 41.0 33.0 41.0 56-57 36.976875 37.0 35.0 40.5 33.0 41.0 58-59 36.699 36.5 35.0 40.0 33.0 41.0 60-61 36.38625 36.0 35.0 40.0 33.0 41.0 62-63 36.188125 35.0 35.0 39.5 33.0 41.0 64-65 35.9305 35.0 35.0 39.0 32.5 41.0 66-67 35.60675 35.0 35.0 39.0 31.5 41.0 68-69 35.315 35.0 34.0 37.5 31.0 40.5 70-71 35.0245 35.0 34.0 37.0 31.0 39.5 72-73 34.754374999999996 35.0 34.0 36.5 31.0 39.0 74-75 34.45525 35.0 34.0 36.0 31.0 39.0 76-77 33.678875000000005 34.5 33.0 35.0 29.5 37.0 78-79 34.111374999999995 35.0 34.0 35.0 31.0 37.0 80-81 33.956125 35.0 34.0 35.0 30.5 37.0 82-83 33.81125 35.0 34.0 35.0 30.0 36.0 84-85 33.52975 35.0 33.0 35.0 30.0 36.0 86-87 33.410250000000005 35.0 33.0 35.0 30.0 36.0 88-89 33.26625 35.0 33.0 35.0 29.5 35.0 90-91 33.033249999999995 35.0 33.0 35.0 29.0 35.0 92-93 32.781375 35.0 33.0 35.0 29.0 35.0 94-95 32.637875 35.0 33.0 35.0 29.0 35.0 96-97 32.489999999999995 35.0 33.0 35.0 29.0 35.0 98-99 32.241125 35.0 33.0 35.0 28.0 35.0 100 31.77725 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.03723351015914744 1101 2 -5.75517966169059E-4 1101 3 0.06235612050846129 1101 4 -3.380742668401563 1101 5 -1.7343609248323446 1101 6 -0.6079721749574603 1101 7 -0.20135622059854086 1101 8 -0.1727554799319364 1101 9 -0.17515764187768923 1101 10-11 -0.08644029626664462 1101 12-13 0.00818236412771256 1101 14-15 0.04717996196576735 1101 16-17 -0.05875287758983205 1101 18-19 0.07551796616955642 1101 20-21 0.02171954759283068 1101 22-23 -0.005692623361021276 1101 24-25 0.05203433089781129 1101 26-27 0.18596737063356983 1101 28-29 0.05474927434691068 1101 30-31 0.015864277850063502 1101 32-33 0.07131418276448898 1101 34-35 0.10324291862676205 1101 36-37 -0.0875663096787136 1101 38-39 0.0017015313782451358 1101 40-41 0.04496546892202957 1101 42-43 0.08934290861775196 1101 44-45 0.016977780002001452 1101 46-47 0.05601291162045641 1101 48-49 0.08238664798318496 1101 50-51 0.07459213291962641 1101 52-53 -0.015476428785902385 1101 54-55 -0.15403863477129676 1101 56-57 -0.11167550795715897 1101 58-59 -0.24600890801721675 1101 60-61 -4.2538284456128395E-4 1101 62-63 0.0856645981383295 1101 64-65 0.020180662596331445 1101 66-67 -0.06183064758282342 1101 68-69 0.13892503252927924 1101 70-71 0.11444049644680376 1101 72-73 0.008432589330396922 1101 74-75 -0.11515363827444958 1101 76-77 0.024784806325691022 1101 78-79 -0.19657691922730436 1101 80-81 -0.314382944650184 1101 82-83 -0.34383445100590393 1101 84-85 -0.3105169652687394 1101 86-87 -0.2365253728355512 1101 88-89 -0.2126288659793829 1101 90-91 -0.3282203983585177 1101 92-93 -0.2817660894805343 1101 94-95 -0.25867030327295026 1101 96-97 -0.27359623661295274 1101 98-99 -0.3046616955259722 1101 100 -0.4396206585927338 1104 1 0.03723351015914034 1104 2 5.75517966169059E-4 1104 3 -0.06235612050845418 1104 4 3.3807426684015596 1104 5 1.7343609248323517 1104 6 0.6079721749574603 1104 7 0.20135622059853375 1104 8 0.1727554799319364 1104 9 0.17515764187768923 1104 10-11 0.08644029626663752 1104 12-13 -0.00818236412771256 1104 14-15 -0.04717996196576735 1104 16-17 0.05875287758982495 1104 18-19 -0.07551796616954931 1104 20-21 -0.02171954759283068 1104 22-23 0.005692623361021276 1104 24-25 -0.05203433089780418 1104 26-27 -0.18596737063356983 1104 28-29 -0.05474927434691068 1104 30-31 -0.015864277850063502 1104 32-33 -0.07131418276448898 1104 34-35 -0.10324291862676205 1104 36-37 0.0875663096787136 1104 38-39 -0.0017015313782451358 1104 40-41 -0.04496546892202957 1104 42-43 -0.08934290861775196 1104 44-45 -0.016977780002001452 1104 46-47 -0.05601291162046351 1104 48-49 -0.08238664798318496 1104 50-51 -0.07459213291963351 1104 52-53 0.01547642878590949 1104 54-55 0.15403863477128965 1104 56-57 0.11167550795716608 1104 58-59 0.24600890801721675 1104 60-61 4.253828445541785E-4 1104 62-63 -0.08566459813832239 1104 64-65 -0.02018066259633855 1104 66-67 0.06183064758282342 1104 68-69 -0.13892503252927213 1104 70-71 -0.11444049644680376 1104 72-73 -0.008432589330396922 1104 74-75 0.11515363827444247 1104 76-77 -0.024784806325698128 1104 78-79 0.19657691922730436 1104 80-81 0.314382944650184 1104 82-83 0.34383445100590393 1104 84-85 0.3105169652687394 1104 86-87 0.2365253728355512 1104 88-89 0.2126288659793829 1104 90-91 0.3282203983585248 1104 92-93 0.2817660894805343 1104 94-95 0.25867030327294316 1104 96-97 0.27359623661294563 1104 98-99 0.3046616955259722 1104 100 0.43962065859273025 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 8.0 28 22.0 29 42.0 30 61.0 31 74.0 32 105.0 33 156.0 34 279.0 35 442.0 36 735.0 37 985.0 38 928.0 39 163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.425 10.625 13.425 47.525 2 26.55 18.575 29.525000000000002 25.35 3 27.875 22.7 21.475 27.950000000000003 4 30.74333800841515 27.040673211781208 15.511921458625528 26.704067321178123 5 31.674999999999997 29.325000000000003 17.549999999999997 21.45 6 23.25988983475213 33.24987481221833 18.252378567851775 25.237856785177765 7 22.1 14.274999999999999 37.2 26.424999999999997 8 23.225 19.725 24.45 32.6 9 24.025 18.525 26.825 30.625000000000004 10-11 26.900000000000002 27.187499999999996 18.587500000000002 27.325 12-13 26.125 20.837500000000002 24.7 28.3375 14-15 26.1625 22.425 23.4375 27.975 16-17 27.250000000000004 22.9375 22.162499999999998 27.650000000000002 18-19 26.5875 22.9375 22.662499999999998 27.8125 20-21 27.1 23.0875 22.5125 27.3 22-23 26.3625 23.7375 22.5 27.400000000000002 24-25 26.775 23.125 22.775000000000002 27.325 26-27 27.375 23.1875 22.825 26.6125 28-29 26.487500000000004 22.75 22.15 28.6125 30-31 26.187500000000004 23.35 22.8875 27.575 32-33 27.3625 23.150000000000002 22.9875 26.5 34-35 27.224999999999998 22.900000000000002 21.912499999999998 27.962500000000002 36-37 26.224999999999998 22.925 22.95 27.900000000000002 38-39 27.400000000000002 22.675 21.925 28.000000000000004 40-41 26.8125 23.35 22.537499999999998 27.3 42-43 25.7 23.1 23.225 27.975 44-45 27.1 23.6875 22.2 27.0125 46-47 27.1375 22.537499999999998 22.3125 28.012500000000003 48-49 26.2125 22.8375 22.400000000000002 28.549999999999997 50-51 26.575 23.0 22.525000000000002 27.900000000000002 52-53 26.875 23.400000000000002 21.987499999999997 27.737499999999997 54-55 26.6 22.6875 22.675 28.037499999999998 56-57 26.9125 23.1 22.875 27.1125 58-59 27.575 22.575 22.162499999999998 27.6875 60-61 27.175 23.200000000000003 22.6 27.025 62-63 27.3 22.95 22.662499999999998 27.0875 64-65 26.9125 23.6625 22.425 27.0 66-67 27.075 22.4625 23.1875 27.275 68-69 26.900000000000002 23.799999999999997 22.375 26.924999999999997 70-71 26.424999999999997 22.875 23.7375 26.9625 72-73 27.6 22.8875 22.75 26.7625 74-75 26.9625 23.2125 22.0 27.825 76-77 26.25 21.95 23.2375 28.5625 78-79 26.424999999999997 23.1625 23.1625 27.250000000000004 80-81 28.549999999999997 22.575 22.0125 26.8625 82-83 27.5625 22.95 22.3375 27.150000000000002 84-85 26.575 23.175 23.150000000000002 27.1 86-87 27.400000000000002 22.875 22.725 27.0 88-89 27.125 23.549999999999997 22.55 26.775 90-91 27.3375 22.35 23.35 26.9625 92-93 28.487499999999997 22.575 23.0125 25.924999999999997 94-95 27.3 22.225 22.825 27.650000000000002 96-97 27.3375 23.5375 22.075 27.05 98-99 26.8 22.6375 23.5625 27.0 100 26.650000000000002 23.35 23.525 26.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 2.0 29 4.0 30 3.5 31 5.5 32 10.0 33 14.5 34 18.5 35 19.0 36 23.5 37 33.5 38 50.0 39 63.0 40 79.5 41 100.0 42 116.5 43 133.5 44 136.0 45 141.0 46 147.0 47 145.5 48 143.0 49 127.5 50 122.0 51 120.5 52 96.5 53 90.5 54 88.5 55 83.0 56 84.5 57 91.0 58 104.5 59 115.0 60 112.5 61 115.0 62 118.5 63 109.0 64 110.5 65 110.0 66 105.0 67 104.5 68 91.5 69 84.0 70 74.0 71 53.5 72 56.0 73 55.0 74 48.5 75 38.0 76 27.5 77 24.5 78 20.0 79 12.5 80 7.0 81 4.0 82 2.0 83 1.5 84 0.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 10.875 5 0.0 6 0.15 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618248 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618248_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.28825 34.0 31.0 34.0 31.0 34.0 2 33.06425 34.0 33.0 34.0 31.0 34.0 3 33.2405 34.0 33.0 34.0 31.0 34.0 4 36.58125 37.0 37.0 37.0 35.0 37.0 5 36.622 37.0 37.0 37.0 35.0 37.0 6 36.568 37.0 37.0 37.0 35.0 37.0 7 36.61 37.0 37.0 37.0 35.0 37.0 8 36.6035 37.0 37.0 37.0 35.0 37.0 9 38.446 39.0 39.0 39.0 37.0 39.0 10-11 38.4715 39.0 39.0 39.0 37.0 39.0 12-13 38.397375 39.0 39.0 39.0 37.0 39.0 14-15 40.002250000000004 41.0 40.0 41.0 38.0 41.0 16-17 40.02925 41.0 40.0 41.0 38.0 41.0 18-19 39.946875 41.0 40.0 41.0 38.0 41.0 20-21 39.977875 41.0 40.0 41.0 38.0 41.0 22-23 39.818875 41.0 40.0 41.0 37.5 41.0 24-25 39.7055 41.0 40.0 41.0 37.0 41.0 26-27 39.65175 41.0 40.0 41.0 37.0 41.0 28-29 39.5145 41.0 39.0 41.0 36.5 41.0 30-31 39.46725 41.0 39.0 41.0 36.0 41.0 32-33 39.393125 41.0 39.0 41.0 36.0 41.0 34-35 39.265 41.0 39.0 41.0 35.0 41.0 36-37 39.159625 40.0 38.5 41.0 35.0 41.0 38-39 38.980125 40.0 38.0 41.0 35.0 41.0 40-41 38.59525 40.0 37.0 41.0 35.0 41.0 42-43 38.458375000000004 40.0 37.0 41.0 34.5 41.0 44-45 38.189375 40.0 36.0 41.0 34.0 41.0 46-47 37.878874999999994 39.0 35.0 41.0 33.0 41.0 48-49 37.70275 39.0 35.0 41.0 33.0 41.0 50-51 37.205375000000004 38.5 35.0 40.5 32.5 41.0 52-53 37.3155 38.5 35.0 40.5 33.0 41.0 54-55 37.434124999999995 38.5 35.0 41.0 34.0 41.0 56-57 37.147125 37.0 35.0 41.0 33.0 41.0 58-59 36.900625 37.0 35.0 41.0 33.0 41.0 60-61 36.684375 36.0 35.0 40.0 33.0 41.0 62-63 36.485375000000005 36.0 35.0 40.0 33.0 41.0 64-65 36.20399999999999 35.0 35.0 39.0 33.0 41.0 66-67 35.842 35.0 35.0 39.0 32.5 41.0 68-69 35.533249999999995 35.0 35.0 37.5 32.0 40.5 70-71 35.291124999999994 35.0 35.0 37.0 32.0 40.0 72-73 35.009375000000006 35.0 34.5 36.5 31.5 39.0 74-75 34.683 35.0 34.0 36.0 31.0 39.0 76-77 34.483374999999995 35.0 34.0 36.0 31.0 38.0 78-79 34.216625 35.0 34.0 35.0 31.0 37.0 80-81 33.994749999999996 35.0 34.0 35.0 30.0 37.0 82-83 33.78775 35.0 34.0 35.0 30.0 36.0 84-85 33.510875 35.0 33.0 35.0 30.0 36.0 86-87 33.32875 35.0 33.0 35.0 29.0 36.0 88-89 33.2305 35.0 33.0 35.0 29.0 35.5 90-91 33.023375 35.0 33.0 35.0 29.0 35.0 92-93 32.7145 35.0 33.0 35.0 28.5 35.0 94-95 32.516375 35.0 33.0 35.0 27.0 35.0 96-97 32.1515 35.0 33.0 35.0 27.0 35.0 98-99 31.757125000000002 35.0 32.0 35.0 26.0 35.0 100 31.321 35.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.07131418276448187 1101 2 -0.01851666499849358 1101 3 -0.07226503853468103 1101 4 0.03135321789610401 1101 5 -0.04781803623260572 1101 6 0.029826844159742905 1101 7 -0.07949654689220154 1101 8 -0.03280452407166479 1101 9 -0.013937543789410256 1101 10-11 -0.03767140426383975 1101 12-13 -0.07535531978781052 1101 14-15 -0.06652237013311435 1101 16-17 0.015726653988593853 1101 18-19 -0.1089730757681906 1101 20-21 -0.15561505354819616 1101 22-23 -0.11665498949054154 1101 24-25 -0.19976729056150333 1101 26-27 -0.1895956360724682 1101 28-29 -0.2571814633169822 1101 30-31 -0.16099489540586376 1101 32-33 -0.28294214793314154 1101 34-35 -0.2304449004103688 1101 36-37 -0.01436292663397154 1101 38-39 -0.13447102392152743 1101 40-41 -0.08416324692222332 1101 42-43 -0.20641076969272376 1101 44-45 -0.22687919127214684 1101 46-47 -0.040311280152138806 1101 48-49 -0.02882594334901256 1101 50-51 0.0922955660094118 1101 52-53 -0.05551246121508768 1101 54-55 0.0027149434491064994 1101 56-57 -0.003002702432191029 1101 58-59 -0.0820863777399623 1101 60-61 -0.09335902312081146 1101 62-63 -0.06429536582924555 1101 64-65 -0.13425833249925034 1101 66-67 0.00714392953658205 1101 68-69 -0.26089730757681906 1101 70-71 -0.1466820138124305 1101 72-73 -0.005592533279951795 1101 74-75 -0.12725202682413794 1101 76-77 -0.38328245420878915 1101 78-79 -0.2376764087678893 1101 80-81 -0.1692147933139836 1101 82-83 -0.0273245921329206 1101 84-85 0.00949604644179658 1101 86-87 -0.12068361525373206 1101 88-89 -0.38382043839455804 1101 90-91 -0.35303022720448496 1101 92-93 -0.36993293964567897 1101 94-95 -0.14345410869783137 1101 96-97 -0.5833875487939117 1101 98-99 -0.7644004604143717 1101 100 -0.8886998298468605 1104 1 0.07131418276448898 1104 2 0.018516664998500687 1104 3 0.07226503853468103 1104 4 -0.03135321789610401 1104 5 0.047818036232612826 1104 6 -0.029826844159742905 1104 7 0.07949654689220154 1104 8 0.03280452407166479 1104 9 0.013937543789410256 1104 10-11 0.03767140426383975 1104 12-13 0.07535531978781052 1104 14-15 0.06652237013312146 1104 16-17 -0.015726653988586747 1104 18-19 0.1089730757681906 1104 20-21 0.15561505354819616 1104 22-23 0.11665498949054154 1104 24-25 0.19976729056151044 1104 26-27 0.1895956360724682 1104 28-29 0.2571814633169893 1104 30-31 0.16099489540586376 1104 32-33 0.28294214793314154 1104 34-35 0.2304449004103688 1104 36-37 0.01436292663397154 1104 38-39 0.13447102392152743 1104 40-41 0.08416324692223043 1104 42-43 0.20641076969272376 1104 44-45 0.22687919127214684 1104 46-47 0.040311280152138806 1104 48-49 0.02882594334901256 1104 50-51 -0.0922955660094047 1104 52-53 0.05551246121509479 1104 54-55 -0.0027149434491064994 1104 56-57 0.0030027024321839235 1104 58-59 0.0820863777399623 1104 60-61 0.09335902312081146 1104 62-63 0.06429536582924555 1104 64-65 0.13425833249924324 1104 66-67 -0.00714392953658205 1104 68-69 0.26089730757681906 1104 70-71 0.1466820138124305 1104 72-73 0.005592533279951795 1104 74-75 0.12725202682414505 1104 76-77 0.38328245420878915 1104 78-79 0.2376764087678893 1104 80-81 0.1692147933139836 1104 82-83 0.0273245921329206 1104 84-85 -0.00949604644179658 1104 86-87 0.12068361525372495 1104 88-89 0.38382043839455804 1104 90-91 0.35303022720448496 1104 92-93 0.36993293964567897 1104 94-95 0.14345410869783137 1104 96-97 0.5833875487939153 1104 98-99 0.7644004604143717 1104 100 0.888699829846864 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 7.0 28 15.0 29 44.0 30 63.0 31 81.0 32 115.0 33 152.0 34 242.0 35 422.0 36 768.0 37 954.0 38 929.0 39 207.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.800000000000004 9.125 14.575 48.5 2 26.0 16.75 31.0 26.25 3 27.650000000000002 21.15 22.525000000000002 28.675 4 30.325000000000003 26.25 16.225 27.200000000000003 5 31.225 29.099999999999998 18.125 21.55 6 22.05 33.975 18.625 25.35 7 22.15 13.675 37.4 26.775 8 22.85 19.900000000000002 23.25 34.0 9 24.0 18.825 26.950000000000003 30.225 10-11 27.51593949243655 26.35329416177022 18.32729091136392 27.803475434429302 12-13 25.5 20.3375 26.1625 28.000000000000004 14-15 25.912499999999998 23.025000000000002 23.6125 27.450000000000003 16-17 27.325 22.8 21.55 28.325 18-19 25.924999999999997 22.9875 22.825 28.262500000000003 20-21 26.987499999999997 23.0625 22.0 27.950000000000003 22-23 26.487500000000004 23.599999999999998 22.425 27.487499999999997 24-25 26.275 23.4375 22.5625 27.725 26-27 26.700000000000003 22.775000000000002 23.325000000000003 27.200000000000003 28-29 26.6125 23.125 22.2625 28.000000000000004 30-31 26.4125 22.725 22.275 28.5875 32-33 26.75 22.7375 23.275000000000002 27.237499999999997 34-35 26.3625 22.45 23.175 28.012500000000003 36-37 26.7125 23.3625 22.6125 27.3125 38-39 27.05 23.3625 22.425 27.1625 40-41 27.05 23.4875 21.875 27.5875 42-43 25.7 23.2625 22.85 28.1875 44-45 27.3375 23.0 23.200000000000003 26.4625 46-47 26.3125 23.7 22.525000000000002 27.462500000000002 48-49 26.787499999999998 22.537499999999998 23.0875 27.5875 50-51 26.224999999999998 22.55 23.7375 27.487499999999997 52-53 26.55 22.8875 23.75 26.8125 54-55 26.724999999999998 23.375 22.537499999999998 27.3625 56-57 26.4125 23.599999999999998 22.912499999999998 27.075 58-59 26.9125 23.0125 22.3375 27.737499999999997 60-61 26.4125 22.95 22.725 27.9125 62-63 27.0 23.325000000000003 22.7 26.974999999999998 64-65 28.012500000000003 22.4875 21.837500000000002 27.6625 66-67 26.5625 22.650000000000002 23.1125 27.675 68-69 26.8375 22.412499999999998 23.425 27.325 70-71 27.437499999999996 22.625 22.8875 27.05 72-73 26.487500000000004 22.5125 23.5375 27.462500000000002 74-75 26.687499999999996 22.5625 24.05 26.700000000000003 76-77 27.500000000000004 22.037499999999998 22.8 27.6625 78-79 27.0625 22.4875 22.6125 27.8375 80-81 27.0625 23.65 22.7375 26.55 82-83 27.3875 23.45 21.525 27.6375 84-85 27.0 22.237499999999997 23.8125 26.950000000000003 86-87 26.575 22.35 23.6125 27.462500000000002 88-89 27.375 22.15 22.650000000000002 27.825 90-91 28.025 21.825 23.3375 26.8125 92-93 26.5125 23.4625 22.537499999999998 27.487499999999997 94-95 26.937499999999996 23.6875 22.9625 26.4125 96-97 27.85 22.875 22.475 26.8 98-99 28.0625 23.474999999999998 22.5875 25.874999999999996 100 27.625 23.45 22.225 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 2.0 27 1.5 28 1.0 29 1.5 30 4.0 31 9.0 32 9.0 33 9.5 34 17.0 35 22.5 36 26.5 37 31.0 38 42.0 39 62.0 40 82.0 41 99.5 42 117.0 43 129.0 44 140.5 45 151.5 46 148.0 47 145.5 48 145.0 49 126.0 50 113.0 51 102.0 52 97.5 53 96.5 54 84.5 55 81.5 56 88.5 57 97.0 58 111.0 59 123.5 60 115.0 61 116.5 62 122.0 63 103.5 64 99.5 65 108.5 66 105.0 67 102.0 68 100.5 69 81.0 70 69.5 71 71.5 72 58.5 73 47.0 74 40.5 75 36.5 76 29.0 77 19.0 78 17.5 79 15.0 80 8.5 81 5.0 82 2.5 83 2.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70755195134313 97.375 2 1.2164216928535225 2.4 3 0.07602635580334516 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564662 spots for SRR8618248.sra Written 564662 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra Read 564647 spots for SRR8618248.sra Written 564647 spots for SRR8618248.sra SRR ids: ['SRR8618248.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zne5xaww SRR8618248.sra spots: 11292955 blocks: [[1, 564647], [564648, 1129294], [1129295, 1693941], [1693942, 2258588], [2258589, 2823235], [2823236, 3387882], [3387883, 3952529], [3952530, 4517176], [4517177, 5081823], [5081824, 5646470], [5646471, 6211117], [6211118, 6775764], [6775765, 7340411], [7340412, 7905058], [7905059, 8469705], [8469706, 9034352], [9034353, 9598999], [9599000, 10163646], [10163647, 10728293], [10728294, 11292955]] SRR8618248 file size 2939028 SRR8618248 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618248 SRR8618248_1.fastq SRR8618248_2.fastq Input file: SRR8618248_1.fastq Paired file: SRR8618248_2.fastq trimmed: SRR8618248-trimmed-pair1.fastq, SRR8618248-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:19:55 2024 >> started Sat Dec 7 10:20:05 2024 >> done (9.989s) 11292955 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11292955 (100.00%) read pairs available; of these: 1406189 (12.45%) trimmed read pairs available after processing 9886766 (87.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 12 0.00% 82 31 0.00% 83 86 0.00% 84 4823 0.04% 85 5141 0.05% 86 5584 0.05% 87 6220 0.06% 88 7439 0.07% 89 9192 0.08% 90 16068 0.14% 91 30442 0.27% 92 43273 0.38% 93 61148 0.54% 94 82824 0.73% 95 104708 0.93% 96 140114 1.24% 97 196348 1.74% 98 287567 2.55% 99 405169 3.59% 100 9886766 87.55% 11292955 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=32 prefix-density=0.46 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=34 fanout-score=24.35 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=7.0 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=33 prefix-density=0.47 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=33 fanout-score=22.05 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=6.7 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR8618248 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:20:34 Started mapping on | Dec 07 10:20:34 Finished on | Dec 07 10:20:58 Mapping speed, Million of reads per hour | 1693.94 Number of input reads | 11292955 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11107831 Uniquely mapped reads % | 98.36% Average mapped length | 198.47 Number of splices: Total | 6744889 Number of splices: Annotated (sjdb) | 6423811 Number of splices: GT/AG | 6654941 Number of splices: GC/AG | 78970 Number of splices: AT/AC | 1728 Number of splices: Non-canonical | 9250 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 81258 % of reads mapped to multiple loci | 0.72% Number of reads mapped to too many loci | 6488 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 103866 103866 103866 N_multimapping 81258 81258 81258 N_noFeature 274106 5572110 5619951 N_ambiguous 233994 21791 23563 UnstrandedReadsAssigned:10599731 PositiveStrandReadsAssigned:5513930 NegativeStrandReadsAssigned:5464317 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618248 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618248-trimmed-pair1.fastq SRR8618248-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,292,955 reads, 10,834,513 reads pseudoaligned [quant] estimated average fragment length: 166.635 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR8618248.ke.tsv 35125 SRR8618248.se.tsv 88098 total ==> SRR8618248.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.404 0 0 PNS24247 1044 878.365 15.1995 2.15762 PNS24249 1928 1762.36 53.5951 3.79185 PNS24246 1044 878.365 15.1995 2.15762 PNS24248 1044 878.365 15.1995 2.15762 PNS24244 1471 1305.36 21.8064 2.08293 PNS24243 293 134.731 21 19.4345 KQK14069 1603 1437.36 1903.48 165.121 KQK14071 474 309.612 175.556 70.7 ==> SRR8618248.se.tsv <== BRADI_1g14170v3 2268 BRADI_1g53295v3 11 BRADI_1g59795v3 287 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 86 BRADI_1g74790v3 54 BRADI_1g09890v3 0 BRADI_1g77505v3 123 BRADI_1g48960v3 0 SRR8618248 completed mapping pipeline successfully