Starting /dee2/code/volunteer_pipeline.sh SRR8618249 current disk space = 1543654281216 free memory = 1602456216 SRR8618249 SRAfilesize 55c6c9de18174a2b0b3bb0825de1287c SRR8618249.sra SRR8618249.sra file validated SRR8618249 is paired end SRR8618249 is conventional basespace SRR8618249 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618249_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98925 34.0 31.0 34.0 31.0 34.0 2 33.19925 34.0 33.0 34.0 31.0 34.0 3 33.251 34.0 34.0 34.0 31.0 34.0 4 32.2065 37.0 35.0 37.0 2.0 37.0 5 34.3455 37.0 35.0 37.0 19.0 37.0 6 35.8025 37.0 35.0 37.0 32.0 37.0 7 36.2485 37.0 35.0 37.0 35.0 37.0 8 36.388 37.0 37.0 37.0 35.0 37.0 9 38.37475 39.0 39.0 39.0 37.0 39.0 10-11 38.39275 39.0 39.0 39.0 37.0 39.0 12-13 38.359125 39.0 39.0 39.0 37.0 39.0 14-15 39.931875000000005 41.0 40.0 41.0 38.0 41.0 16-17 39.943625 41.0 40.0 41.0 38.0 41.0 18-19 39.87125 41.0 40.0 41.0 38.0 41.0 20-21 39.845 41.0 40.0 41.0 38.0 41.0 22-23 39.731375 41.0 40.0 41.0 38.0 41.0 24-25 39.65825 41.0 39.5 41.0 37.0 41.0 26-27 39.460499999999996 41.0 39.0 41.0 36.0 41.0 28-29 39.34375 40.0 39.0 41.0 36.5 41.0 30-31 39.1445 40.0 38.0 41.0 35.5 41.0 32-33 39.106125000000006 40.0 38.5 41.0 35.5 41.0 34-35 39.277375 41.0 39.0 41.0 35.5 41.0 36-37 39.27225 41.0 39.0 41.0 35.0 41.0 38-39 39.204625 41.0 38.5 41.0 35.0 41.0 40-41 39.03925 40.0 38.0 41.0 35.0 41.0 42-43 38.799125000000004 40.0 38.0 41.0 35.0 41.0 44-45 38.625625 40.0 37.0 41.0 35.0 41.0 46-47 38.421625 40.0 36.5 41.0 34.5 41.0 48-49 38.23675 40.0 36.0 41.0 34.0 41.0 50-51 38.045874999999995 40.0 35.0 41.0 34.0 41.0 52-53 37.8265 39.0 35.0 41.0 34.0 41.0 54-55 37.503125 39.0 35.0 41.0 33.0 41.0 56-57 37.290375 38.5 35.0 41.0 33.0 41.0 58-59 37.072125 37.5 35.0 41.0 33.0 41.0 60-61 36.825375 37.0 35.0 40.0 33.0 41.0 62-63 36.5215 36.5 35.0 40.0 32.5 41.0 64-65 36.240375 36.0 35.0 39.5 32.0 41.0 66-67 35.977000000000004 35.5 35.0 39.0 32.0 41.0 68-69 35.609875 35.0 35.0 39.0 31.5 41.0 70-71 35.197125 35.0 34.0 37.5 31.0 40.0 72-73 34.883875 35.0 34.0 37.0 31.0 39.0 74-75 34.569375 35.0 34.0 36.5 31.0 39.0 76-77 33.780874999999995 34.5 32.5 35.5 29.5 37.0 78-79 34.219125000000005 35.0 34.0 36.0 31.0 37.0 80-81 34.06725 35.0 34.0 35.0 31.0 37.0 82-83 33.8585 35.0 34.0 35.0 30.5 36.0 84-85 33.548625 35.0 33.0 35.0 30.0 36.0 86-87 33.36325 35.0 33.0 35.0 29.5 36.0 88-89 33.250875 35.0 33.0 35.0 29.5 35.5 90-91 32.961625 35.0 33.0 35.0 29.0 35.0 92-93 32.786500000000004 35.0 33.0 35.0 29.0 35.0 94-95 32.6385 35.0 33.0 35.0 29.0 35.0 96-97 32.319 35.0 33.0 35.0 28.0 35.0 98-99 32.079625 35.0 33.0 35.0 27.0 35.0 100 31.73125 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.11728488328170528 1101 2 0.05725113948275862 1101 3 0.02301629271486405 1101 4 -4.88338243811538 1101 5 -2.456561154340104 1101 6 -0.7228727556596439 1101 7 -0.24344640024174424 1101 8 -0.061179522046792556 1101 9 0.0122258316335504 1101 10-11 0.03478884943718441 1101 12-13 0.10942811815366582 1101 14-15 0.07383344665205982 1101 16-17 0.07373271889400712 1101 18-19 -0.10601596534964841 1101 20-21 0.07700637103069852 1101 22-23 0.0426015461710918 1101 24-25 0.05353050791972436 1101 26-27 0.02713983531011621 1101 28-29 0.2313527737906398 1101 30-31 0.09637128251618066 1101 32-33 0.32587318375261276 1101 34-35 0.23356248898290488 1101 36-37 0.27380322832464543 1101 38-39 0.1355480849134949 1101 40-41 0.209847397446552 1101 42-43 0.1133061368386592 1101 44-45 0.33113620911082364 1101 46-47 0.21784266324192458 1101 48-49 0.2543753619903768 1101 50-51 0.3150701317015461 1101 52-53 0.04859484777517764 1101 54-55 0.11538994233336552 1101 56-57 0.2385548084913509 1101 58-59 -0.03162222054342578 1101 60-61 0.14446878698597487 1101 62-63 0.3795044194303827 1101 64-65 0.29326886756818027 1101 66-67 0.34081236936869175 1101 68-69 0.3738825514341073 1101 70-71 0.16358817456120534 1101 72-73 0.4439072297348332 1101 74-75 0.49133741280753895 1101 76-77 0.39824607791292266 1101 78-79 0.27215381128654315 1101 80-81 0.2732492256553627 1101 82-83 0.1901173478381324 1101 84-85 0.46080431114804554 1101 86-87 0.4065938908614726 1101 88-89 0.3298771121351791 1101 90-91 0.05508549268464691 1101 92-93 0.1815428974339568 1101 94-95 0.24848278814433655 1101 96-97 0.4219296920248823 1101 98-99 0.3442559995970953 1101 100 -0.021178011130416508 1104 1 -0.11728488328171238 1104 2 -0.05725113948276572 1104 3 -0.02301629271486405 1104 4 4.883382438115383 1104 5 2.4565611543401076 1104 6 0.7228727556596368 1104 7 0.24344640024174424 1104 8 0.06117952204678545 1104 9 -0.0122258316335504 1104 10-11 -0.034788849437177305 1104 12-13 -0.10942811815365872 1104 14-15 -0.07383344665205982 1104 16-17 -0.07373271889401423 1104 18-19 0.10601596534965552 1104 20-21 -0.07700637103069141 1104 22-23 -0.04260154617108469 1104 24-25 -0.05353050791972436 1104 26-27 -0.02713983531011621 1104 28-29 -0.2313527737906398 1104 30-31 -0.09637128251618066 1104 32-33 -0.32587318375261276 1104 34-35 -0.23356248898290488 1104 36-37 -0.27380322832464543 1104 38-39 -0.135548084913502 1104 40-41 -0.2098473974465449 1104 42-43 -0.1133061368386592 1104 44-45 -0.33113620911083075 1104 46-47 -0.21784266324192458 1104 48-49 -0.2543753619903839 1104 50-51 -0.31507013170153897 1104 52-53 -0.048594847775170535 1104 54-55 -0.11538994233335842 1104 56-57 -0.2385548084913509 1104 58-59 0.03162222054342578 1104 60-61 -0.14446878698597487 1104 62-63 -0.3795044194303898 1104 64-65 -0.29326886756818027 1104 66-67 -0.34081236936869175 1104 68-69 -0.3738825514341144 1104 70-71 -0.16358817456120534 1104 72-73 -0.4439072297348332 1104 74-75 -0.49133741280753185 1104 76-77 -0.39824607791291555 1104 78-79 -0.27215381128654315 1104 80-81 -0.2732492256553556 1104 82-83 -0.19011734783812528 1104 84-85 -0.46080431114804554 1104 86-87 -0.4065938908614726 1104 88-89 -0.3298771121351791 1104 90-91 -0.05508549268464691 1104 92-93 -0.1815428974339568 1104 94-95 -0.24848278814434366 1104 96-97 -0.4219296920248752 1104 98-99 -0.3442559995970882 1104 100 0.021178011130416508 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 3.0 27 12.0 28 20.0 29 50.0 30 59.0 31 74.0 32 119.0 33 171.0 34 227.0 35 381.0 36 702.0 37 1026.0 38 1002.0 39 154.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.725 11.725 14.249999999999998 44.3 2 27.325 17.375 31.775 23.525 3 25.7 22.675 24.5 27.125 4 28.685943315201833 27.569424563412536 17.635270541082164 26.109361580303464 5 30.075000000000003 29.349999999999998 19.15 21.425 6 22.681704260651628 32.80701754385965 20.476190476190474 24.035087719298247 7 21.45 15.174999999999999 37.525 25.85 8 22.75 20.075000000000003 24.525 32.65 9 22.8 20.05 28.499999999999996 28.65 10-11 26.737499999999997 27.525 19.05 26.687499999999996 12-13 24.175 22.1 26.075 27.650000000000002 14-15 24.55 24.5 24.4375 26.5125 16-17 26.0375 23.225 22.85 27.8875 18-19 25.8625 22.775000000000002 24.275 27.0875 20-21 25.7375 24.45 23.3 26.5125 22-23 25.7 24.05 23.7375 26.5125 24-25 25.4375 23.95 24.0375 26.575 26-27 25.5625 24.6625 23.175 26.6 28-29 25.7125 24.5 22.6875 27.1 30-31 25.575 23.775 23.474999999999998 27.175 32-33 26.200000000000003 24.0625 23.962500000000002 25.775 34-35 25.55 23.825 23.7875 26.8375 36-37 25.0625 24.15 23.974999999999998 26.8125 38-39 25.7 23.5125 23.75 27.037499999999998 40-41 26.125 23.9375 23.8375 26.1 42-43 25.8 23.25 24.6625 26.2875 44-45 26.3125 24.637500000000003 23.325000000000003 25.724999999999998 46-47 26.2875 23.674999999999997 23.0375 27.0 48-49 25.35 23.925 24.212500000000002 26.5125 50-51 25.525 24.7875 23.35 26.337500000000002 52-53 26.2625 23.799999999999997 22.8875 27.05 54-55 25.3 24.2 23.575 26.924999999999997 56-57 25.874999999999996 24.5375 23.45 26.137500000000003 58-59 25.424999999999997 23.425 24.6625 26.487500000000004 60-61 25.8 24.0625 23.375 26.7625 62-63 25.912499999999998 24.5125 24.25 25.324999999999996 64-65 26.787499999999998 23.1125 23.625 26.474999999999998 66-67 25.674999999999997 23.9875 23.7125 26.625 68-69 26.625 23.7875 23.4625 26.125 70-71 26.137500000000003 24.5 23.45 25.912499999999998 72-73 26.6625 24.224999999999998 23.4875 25.624999999999996 74-75 25.5125 24.9 23.75 25.837500000000002 76-77 26.7625 23.425 23.400000000000002 26.4125 78-79 25.924999999999997 23.6125 23.775 26.687499999999996 80-81 26.337500000000002 24.375 24.1625 25.124999999999996 82-83 26.174999999999997 24.2375 23.025000000000002 26.5625 84-85 26.224999999999998 23.5625 24.2 26.0125 86-87 25.687500000000004 24.3125 24.175 25.825 88-89 26.525 23.6875 23.025000000000002 26.7625 90-91 26.0125 23.3 24.525 26.1625 92-93 26.403300412551566 24.253031628953618 24.028003500437556 25.315664458057256 94-95 28.037499999999998 23.7 22.7375 25.525 96-97 26.2875 23.375 24.224999999999998 26.1125 98-99 27.650000000000002 23.5625 22.7625 26.025 100 27.575 24.0 22.05 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 0.5 26 0.0 27 0.5 28 1.0 29 3.0 30 5.5 31 8.0 32 12.0 33 13.5 34 22.0 35 30.5 36 35.5 37 47.0 38 63.0 39 85.5 40 99.0 41 106.0 42 127.5 43 147.0 44 160.5 45 160.5 46 161.0 47 180.5 48 180.5 49 161.5 50 145.0 51 122.5 52 109.5 53 96.5 54 86.0 55 88.5 56 88.0 57 97.0 58 99.0 59 90.5 60 87.5 61 89.5 62 95.5 63 82.0 64 77.5 65 82.5 66 78.0 67 86.5 68 87.0 69 77.5 70 65.0 71 47.0 72 36.5 73 41.5 74 37.0 75 28.0 76 22.5 77 13.0 78 8.0 79 6.0 80 4.5 81 3.5 82 3.0 83 2.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 12.675 5 0.0 6 0.25 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.125 0.0 0.0 0.0 0.025 88 0.225 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618249 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618249_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.119 33.0 31.0 34.0 30.0 34.0 2 32.848 34.0 31.0 34.0 31.0 34.0 3 32.99875 34.0 33.0 34.0 31.0 34.0 4 36.48925 37.0 37.0 37.0 35.0 37.0 5 36.5465 37.0 37.0 37.0 35.0 37.0 6 36.52025 37.0 37.0 37.0 35.0 37.0 7 36.541 37.0 37.0 37.0 35.0 37.0 8 36.51575 37.0 37.0 37.0 35.0 37.0 9 38.388 39.0 39.0 39.0 37.0 39.0 10-11 38.398375 39.0 39.0 39.0 37.0 39.0 12-13 38.29625 39.0 39.0 39.0 37.0 39.0 14-15 39.895624999999995 41.0 40.0 41.0 38.0 41.0 16-17 39.941125 41.0 40.0 41.0 38.0 41.0 18-19 39.895125 41.0 40.0 41.0 38.0 41.0 20-21 39.878375000000005 41.0 40.0 41.0 38.0 41.0 22-23 39.7795 41.0 40.0 41.0 37.5 41.0 24-25 39.577625 41.0 39.0 41.0 37.0 41.0 26-27 39.55 41.0 39.0 41.0 37.0 41.0 28-29 39.409125 41.0 39.0 41.0 36.0 41.0 30-31 39.324375 40.0 39.0 41.0 36.0 41.0 32-33 39.33575 41.0 39.0 41.0 35.5 41.0 34-35 39.175625 40.0 38.5 41.0 35.0 41.0 36-37 39.055875 40.0 38.0 41.0 35.0 41.0 38-39 38.867625000000004 40.0 38.0 41.0 35.0 41.0 40-41 38.557375 40.0 37.5 41.0 35.0 41.0 42-43 38.4845 40.0 37.0 41.0 34.5 41.0 44-45 38.09725 40.0 36.0 41.0 33.5 41.0 46-47 37.931625 39.5 35.5 41.0 33.5 41.0 48-49 37.814125 39.0 35.0 41.0 33.0 41.0 50-51 37.33725 38.5 35.0 40.5 32.5 41.0 52-53 37.3735 39.0 35.0 40.5 33.0 41.0 54-55 37.4755 39.0 35.0 41.0 33.0 41.0 56-57 37.341875 38.5 35.0 41.0 33.0 41.0 58-59 37.1405 37.5 35.0 41.0 33.0 41.0 60-61 36.863749999999996 37.0 35.0 40.5 33.0 41.0 62-63 36.577124999999995 36.5 35.0 40.0 33.0 41.0 64-65 36.333875 36.0 35.0 39.5 33.0 41.0 66-67 36.035875000000004 35.0 35.0 39.0 32.0 41.0 68-69 35.742000000000004 35.0 35.0 39.0 32.0 41.0 70-71 35.466875 35.0 35.0 37.5 32.0 40.0 72-73 35.18962500000001 35.0 34.5 37.0 31.5 39.5 74-75 34.837500000000006 35.0 34.0 37.0 31.0 39.0 76-77 34.53425 35.0 34.0 36.0 31.0 39.0 78-79 34.19825 35.0 34.0 36.0 30.0 37.0 80-81 34.031625000000005 35.0 34.0 35.0 30.0 37.0 82-83 33.855625 35.0 34.0 35.0 30.0 36.5 84-85 33.556 35.0 33.5 35.0 29.5 36.0 86-87 33.3895 35.0 33.0 35.0 29.5 36.0 88-89 33.16175 35.0 33.0 35.0 29.0 36.0 90-91 32.963 35.0 33.0 35.0 29.0 35.0 92-93 32.743375 35.0 33.0 35.0 28.0 35.0 94-95 32.4315 35.0 33.0 35.0 27.0 35.0 96-97 32.1535 35.0 33.0 35.0 27.0 35.0 98-99 31.75275 35.0 32.5 35.0 26.0 35.0 100 31.3785 35.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.1125129057440013 1101 2 0.12165394978720911 1101 3 0.1482586688826757 1101 4 0.06364735211905526 1101 5 0.11641610636851141 1101 6 0.043929893480395776 1101 7 0.02780086122233172 1101 8 0.05436780740853209 1101 9 0.03632494774747386 1101 10-11 -0.006799123668507434 1101 12-13 0.06838155674749657 1101 14-15 0.054128578983153375 1101 16-17 0.1910176021757195 1101 18-19 0.1272191584195781 1101 20-21 0.18295308604668037 1101 22-23 0.04693283976732232 1101 24-25 0.08063886580544732 1101 26-27 0.1536161265140663 1101 28-29 0.16363224295535872 1101 30-31 0.17719271738309317 1101 32-33 0.183186018987179 1101 34-35 0.1285852786381625 1101 36-37 0.1948515524665737 1101 38-39 0.23815189745914012 1101 40-41 0.17217521593512686 1101 42-43 0.14475208380549986 1101 44-45 0.4110888670645423 1101 46-47 0.3371043287754034 1101 48-49 0.330305205106896 1101 50-51 0.16074891088111087 1101 52-53 0.23624436554103312 1101 54-55 0.3619777895293481 1101 56-57 0.3769925209639666 1101 58-59 0.4123920324343402 1101 60-61 0.22455365012213235 1101 62-63 0.11753670267683702 1101 64-65 0.05684822845055493 1101 66-67 0.10683437838382304 1101 68-69 0.09365792853365917 1101 70-71 0.2489549495102068 1101 72-73 -0.0017816222205411236 1101 74-75 0.1715267809926715 1101 76-77 0.12526755810732482 1101 78-79 -0.08345924303090158 1101 80-81 -0.05397119186120136 1101 82-83 0.07280098713202676 1101 84-85 0.2913109717710469 1101 86-87 0.21447457883206056 1101 88-89 0.17350356324443794 1101 90-91 0.19471934728412776 1101 92-93 0.18212208204275981 1101 94-95 0.15163304877741268 1101 96-97 0.006150688726044962 1101 98-99 0.05307093752360714 1101 100 0.23247966558384192 1104 1 0.11251290574399775 1104 2 -0.12165394978721622 1104 3 -0.1482586688826828 1104 4 -0.06364735211906236 1104 5 -0.11641610636851141 1104 6 -0.043929893480395776 1104 7 -0.02780086122233172 1104 8 -0.05436780740852498 1104 9 -0.03632494774747386 1104 10-11 0.006799123668507434 1104 12-13 -0.06838155674749657 1104 14-15 -0.054128578983153375 1104 16-17 -0.1910176021757195 1104 18-19 -0.1272191584195852 1104 20-21 -0.18295308604668747 1104 22-23 -0.046932839767315215 1104 24-25 -0.08063886580544732 1104 26-27 -0.1536161265140663 1104 28-29 -0.16363224295535161 1104 30-31 -0.17719271738308606 1104 32-33 -0.183186018987179 1104 34-35 -0.1285852786381625 1104 36-37 -0.1948515524665666 1104 38-39 -0.23815189745914722 1104 40-41 -0.17217521593512686 1104 42-43 -0.14475208380549276 1104 44-45 -0.4110888670645423 1104 46-47 -0.3371043287754034 1104 48-49 -0.330305205106896 1104 50-51 -0.16074891088111798 1104 52-53 -0.23624436554103312 1104 54-55 -0.3619777895293481 1104 56-57 -0.3769925209639595 1104 58-59 -0.4123920324343402 1104 60-61 -0.22455365012213235 1104 62-63 -0.11753670267684413 1104 64-65 -0.05684822845055493 1104 66-67 -0.10683437838382304 1104 68-69 -0.09365792853365917 1104 70-71 -0.2489549495102139 1104 72-73 0.001781622220548229 1104 74-75 -0.1715267809926786 1104 76-77 -0.12526755810732482 1104 78-79 0.08345924303089447 1104 80-81 0.053971191861194256 1104 82-83 -0.07280098713202676 1104 84-85 -0.2913109717710469 1104 86-87 -0.21447457883206056 1104 88-89 -0.17350356324444505 1104 90-91 -0.19471934728413487 1104 92-93 -0.18212208204275981 1104 94-95 -0.1516330487774198 1104 96-97 -0.006150688726044962 1104 98-99 -0.05307093752360714 1104 100 -0.23247966558384547 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 11.0 28 21.0 29 45.0 30 62.0 31 70.0 32 133.0 33 167.0 34 244.0 35 423.0 36 671.0 37 928.0 38 1004.0 39 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.825 8.475000000000001 14.649999999999999 48.05 2 25.974999999999998 17.2 32.6 24.224999999999998 3 26.1 22.15 24.224999999999998 27.525 4 28.775000000000002 27.800000000000004 16.400000000000002 27.025 5 31.125000000000004 28.9 18.425 21.55 6 22.775000000000002 33.15 20.025000000000002 24.05 7 21.675 14.95 38.3 25.074999999999996 8 21.825 20.349999999999998 24.9 32.925 9 22.05 20.25 28.050000000000004 29.65 10-11 27.303412926615827 26.128266033254157 20.040005000625076 26.52831603950494 12-13 24.25 21.1125 26.687499999999996 27.950000000000003 14-15 25.224999999999998 22.925 24.7375 27.1125 16-17 26.25 22.5625 23.1625 28.025 18-19 26.0 23.7125 23.549999999999997 26.737499999999997 20-21 25.324999999999996 23.4125 23.925 27.3375 22-23 26.637499999999996 23.974999999999998 22.775000000000002 26.6125 24-25 25.7625 24.2 23.2625 26.775 26-27 25.662499999999998 24.6 23.6625 26.075 28-29 26.5 24.087500000000002 23.3375 26.075 30-31 26.150000000000002 23.575 23.3375 26.937499999999996 32-33 26.5125 23.5375 23.95 26.0 34-35 26.575 23.425 22.9625 27.037499999999998 36-37 24.875 23.7125 24.1375 27.275 38-39 26.6125 23.5625 23.05 26.775 40-41 26.4125 24.0625 23.5125 26.0125 42-43 25.587500000000002 23.1 23.799999999999997 27.5125 44-45 25.974999999999998 23.775 24.0125 26.237500000000004 46-47 25.474999999999998 23.275000000000002 24.3 26.950000000000003 48-49 25.0375 23.4625 24.3125 27.187499999999996 50-51 26.200000000000003 23.625 24.425 25.75 52-53 25.7625 23.9875 24.224999999999998 26.025 54-55 25.887500000000003 23.4125 23.4875 27.212500000000002 56-57 25.2875 23.849999999999998 23.7 27.1625 58-59 27.212500000000002 23.8125 22.425 26.55 60-61 26.825 24.3 22.6125 26.2625 62-63 25.0375 24.825 24.5125 25.624999999999996 64-65 26.775 24.725 23.075000000000003 25.424999999999997 66-67 24.625 24.5125 24.887500000000003 25.974999999999998 68-69 26.3 23.525 24.075 26.1 70-71 26.375 22.8625 23.7375 27.025 72-73 25.9875 24.175 24.1875 25.650000000000002 74-75 26.400000000000002 23.7625 23.9 25.937500000000004 76-77 26.2875 24.675 22.85 26.187500000000004 78-79 25.587500000000002 23.724999999999998 24.4 26.2875 80-81 25.674999999999997 24.125 23.775 26.424999999999997 82-83 26.275 23.1125 24.099999999999998 26.5125 84-85 25.074999999999996 23.1375 24.45 27.3375 86-87 25.874999999999996 24.525 24.099999999999998 25.5 88-89 26.2625 24.5375 23.3 25.900000000000002 90-91 26.35 23.3 24.275 26.075 92-93 26.5875 23.799999999999997 23.5875 26.025 94-95 26.487500000000004 24.099999999999998 23.575 25.837500000000002 96-97 26.0 24.2625 23.4875 26.25 98-99 26.687499999999996 23.5125 23.8875 25.912499999999998 100 26.974999999999998 23.05 24.025 25.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 1.5 27 0.5 28 2.5 29 5.5 30 5.5 31 5.5 32 6.0 33 12.5 34 21.0 35 25.0 36 33.0 37 47.0 38 61.0 39 80.5 40 102.5 41 119.0 42 132.5 43 145.5 44 152.5 45 163.5 46 181.0 47 181.5 48 165.0 49 156.0 50 141.5 51 115.5 52 107.5 53 99.5 54 85.0 55 84.0 56 83.5 57 84.5 58 93.5 59 102.5 60 95.5 61 85.5 62 92.0 63 91.5 64 91.0 65 83.0 66 75.0 67 75.5 68 75.5 69 70.0 70 63.0 71 55.5 72 44.5 73 44.0 74 38.0 75 31.0 76 25.0 77 18.5 78 14.5 79 7.0 80 4.5 81 5.0 82 3.5 83 3.0 84 2.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575252 spots for SRR8618249.sra Written 575252 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra Read 575239 spots for SRR8618249.sra Written 575239 spots for SRR8618249.sra SRR ids: ['SRR8618249.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ju1p7zc0 SRR8618249.sra spots: 11504793 blocks: [[1, 575239], [575240, 1150478], [1150479, 1725717], [1725718, 2300956], [2300957, 2876195], [2876196, 3451434], [3451435, 4026673], [4026674, 4601912], [4601913, 5177151], [5177152, 5752390], [5752391, 6327629], [6327630, 6902868], [6902869, 7478107], [7478108, 8053346], [8053347, 8628585], [8628586, 9203824], [9203825, 9779063], [9779064, 10354302], [10354303, 10929541], [10929542, 11504793]] SRR8618249 file size 2994341 SRR8618249 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618249 SRR8618249_1.fastq SRR8618249_2.fastq Input file: SRR8618249_1.fastq Paired file: SRR8618249_2.fastq trimmed: SRR8618249-trimmed-pair1.fastq, SRR8618249-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:23:55 2024 >> started Sat Dec 7 10:24:07 2024 >> done (12.061s) 11504793 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11504793 (100.00%) read pairs available; of these: 1288073 (11.20%) trimmed read pairs available after processing 10216720 (88.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 7 0.00% 82 30 0.00% 83 96 0.00% 84 4390 0.04% 85 4724 0.04% 86 4948 0.04% 87 5457 0.05% 88 6562 0.06% 89 8246 0.07% 90 14254 0.12% 91 26959 0.23% 92 39295 0.34% 93 54187 0.47% 94 73579 0.64% 95 94612 0.82% 96 125300 1.09% 97 178286 1.55% 98 264537 2.30% 99 382603 3.33% 100 10216720 88.80% 11504793 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=20 prefix-density=0.26 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=33 fanout-score=28.42 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.0 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=25 prefix-density=0.26 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=27.95 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=8.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618249 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:24:37 Started mapping on | Dec 07 10:24:37 Finished on | Dec 07 10:25:05 Mapping speed, Million of reads per hour | 1479.19 Number of input reads | 11504793 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11256129 Uniquely mapped reads % | 97.84% Average mapped length | 198.51 Number of splices: Total | 7382872 Number of splices: Annotated (sjdb) | 7027857 Number of splices: GT/AG | 7282736 Number of splices: GC/AG | 86910 Number of splices: AT/AC | 2838 Number of splices: Non-canonical | 10388 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 112259 % of reads mapped to multiple loci | 0.98% Number of reads mapped to too many loci | 6846 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 136405 136405 136405 N_multimapping 112259 112259 112259 N_noFeature 313606 5658831 5719353 N_ambiguous 231134 19957 20821 UnstrandedReadsAssigned:10711389 PositiveStrandReadsAssigned:5577341 NegativeStrandReadsAssigned:5515955 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618249 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618249-trimmed-pair1.fastq SRR8618249-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,504,793 reads, 10,986,092 reads pseudoaligned [quant] estimated average fragment length: 171.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52973 SRR8618249.ke.tsv 35125 SRR8618249.se.tsv 88098 total ==> SRR8618249.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.944 0 0 PNS24247 1044 873.786 16.0032 2.38152 PNS24249 1928 1757.79 93.9903 6.95294 PNS24246 1044 873.786 16.0032 2.38152 PNS24248 1044 873.786 16.0032 2.38152 PNS24244 1471 1300.79 0 0 PNS24243 293 132.415 10 9.82007 KQK14069 1603 1432.79 3102.8 281.594 KQK14071 474 305.767 245.006 104.193 ==> SRR8618249.se.tsv <== BRADI_1g14170v3 3644 BRADI_1g53295v3 57 BRADI_1g59795v3 214 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 141 BRADI_1g74790v3 76 BRADI_1g09890v3 0 BRADI_1g77505v3 191 BRADI_1g48960v3 0 SRR8618249 completed mapping pipeline successfully