Starting /dee2/code/volunteer_pipeline.sh SRR8618250 current disk space = 1543488782336 free memory = 1597149876 SRR8618250 SRAfilesize 3b8822710637db1124f98fe155310cce SRR8618250.sra SRR8618250.sra file validated SRR8618250 is paired end SRR8618250 is conventional basespace SRR8618250 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618250_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1495 34.0 33.0 34.0 31.0 34.0 2 33.30925 34.0 34.0 34.0 31.0 34.0 3 33.3485 34.0 34.0 34.0 31.0 34.0 4 32.29325 37.0 37.0 37.0 2.0 37.0 5 34.3975 37.0 37.0 37.0 19.0 37.0 6 35.91 37.0 36.0 37.0 32.0 37.0 7 36.312 37.0 36.0 37.0 35.0 37.0 8 36.45225 37.0 37.0 37.0 35.0 37.0 9 38.4875 39.0 39.0 39.0 37.0 39.0 10-11 38.486999999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.45 39.0 39.0 39.0 37.0 39.0 14-15 40.02775 41.0 40.0 41.0 38.0 41.0 16-17 40.051249999999996 41.0 40.0 41.0 38.0 41.0 18-19 39.9725 41.0 40.0 41.0 38.0 41.0 20-21 39.95425 41.0 40.0 41.0 38.0 41.0 22-23 39.845375000000004 41.0 40.0 41.0 38.0 41.0 24-25 39.726124999999996 41.0 40.0 41.0 37.5 41.0 26-27 39.589749999999995 41.0 39.0 41.0 37.0 41.0 28-29 39.43 40.5 39.0 41.0 36.5 41.0 30-31 39.255625 40.0 39.0 41.0 36.0 41.0 32-33 39.198125000000005 40.0 38.5 41.0 36.0 41.0 34-35 39.41975 41.0 39.0 41.0 36.0 41.0 36-37 39.35425 41.0 39.0 41.0 35.0 41.0 38-39 39.220875 41.0 38.5 41.0 35.0 41.0 40-41 39.0045 40.0 38.0 41.0 35.0 41.0 42-43 38.778375 40.0 37.0 41.0 35.0 41.0 44-45 38.553749999999994 40.0 37.0 41.0 35.0 41.0 46-47 38.356875 40.0 36.0 41.0 35.0 41.0 48-49 38.042125 39.5 35.0 41.0 34.0 41.0 50-51 37.728125000000006 39.0 35.0 41.0 34.0 41.0 52-53 37.494625 39.0 35.0 41.0 33.5 41.0 54-55 37.21475 38.0 35.0 41.0 33.0 41.0 56-57 36.912625000000006 37.0 35.0 40.5 33.0 41.0 58-59 36.629625 36.5 35.0 40.0 33.0 41.0 60-61 36.4115 36.0 35.0 40.0 33.0 41.0 62-63 36.078125 35.0 35.0 39.5 32.5 41.0 64-65 35.87875 35.0 35.0 39.0 32.0 41.0 66-67 35.603750000000005 35.0 35.0 38.5 32.0 41.0 68-69 35.352875 35.0 34.5 37.5 32.0 40.0 70-71 34.978625 35.0 34.0 37.0 31.0 39.5 72-73 34.72125 35.0 34.0 36.5 31.0 39.0 74-75 34.445625 35.0 34.0 36.0 30.5 39.0 76-77 33.6225 34.5 32.5 35.0 29.5 37.0 78-79 33.938500000000005 35.0 33.5 35.0 30.0 37.0 80-81 33.83225 35.0 34.0 35.0 30.0 36.5 82-83 33.605375 35.0 33.5 35.0 30.0 36.0 84-85 33.372625 35.0 33.0 35.0 29.0 36.0 86-87 33.301375 35.0 33.0 35.0 29.0 35.5 88-89 33.085875 35.0 33.0 35.0 29.0 35.0 90-91 32.860125 35.0 33.0 35.0 29.0 35.0 92-93 32.58175 35.0 33.0 35.0 27.0 35.0 94-95 32.41775 35.0 33.0 35.0 27.0 35.0 96-97 32.1565 35.0 33.0 35.0 27.0 35.0 98-99 31.8555 35.0 33.0 35.0 26.5 35.0 100 31.352 35.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0046792112901599126 1101 2 0.02782504253828222 1101 3 -0.01603943549194753 1101 4 -4.127714943449103 1101 5 -2.0882794515063594 1101 6 -0.5496947252527278 1101 7 -0.21679511560404308 1101 8 -0.13839955960364136 1101 9 -0.18256430787709377 1101 10-11 -0.136998298468626 1101 12-13 -0.08177359623661573 1101 14-15 0.0025272745470914515 1101 16-17 -0.05153388049244256 1101 18-19 -0.1296667000300289 1101 20-21 -0.042951156040437866 1101 22-23 -0.041187068361523416 1101 24-25 0.0692623361024971 1101 26-27 -0.02378390551496068 1101 28-29 0.10195425883294718 1101 30-31 -0.013599739765787433 1101 32-33 0.13920028025222564 1101 34-35 0.1289160244219829 1101 36-37 0.03195375838254222 1101 38-39 -0.13051746571914435 1101 40-41 0.0051045941347211965 1101 42-43 -0.032904614152741374 1101 44-45 -0.04611650485436769 1101 46-47 0.0037033329996987163 1101 48-49 -0.243419077169456 1101 50-51 -0.36509108197377316 1101 52-53 -0.26388749874887907 1101 54-55 -0.19266089480532145 1101 56-57 -0.1390126113502177 1101 58-59 -0.14555600040036154 1101 60-61 -0.0675232709438447 1101 62-63 -0.2423931538384494 1101 64-65 -0.27169452507256153 1101 66-67 -0.26648984085677085 1101 68-69 -0.21317936142528282 1101 70-71 -0.0909943949554588 1101 72-73 -0.04960714643178932 1101 74-75 -0.20111850665598752 1101 76-77 -0.1303297968171293 1101 78-79 -0.27638624762285957 1101 80-81 -0.20568511660494693 1101 82-83 -0.4910794715243725 1101 84-85 -0.33391302171954607 1101 86-87 -0.10145380842758556 1101 88-89 -0.1976904213792423 1101 90-91 -0.29283855469923026 1101 92-93 -0.4365053548193316 1101 94-95 -0.38947552797517915 1101 96-97 -0.7061230107096428 1101 98-99 -0.5554749274346911 1101 100 -0.4690721649484537 1104 1 -0.0046792112901599126 1104 2 -0.02782504253828222 1104 3 0.016039435491940424 1104 4 4.1277149434491065 1104 5 2.0882794515063523 1104 6 0.5496947252527278 1104 7 0.21679511560404308 1104 8 0.13839955960364847 1104 9 0.18256430787708666 1104 10-11 0.13699829846861888 1104 12-13 0.08177359623661573 1104 14-15 -0.0025272745470914515 1104 16-17 0.05153388049244256 1104 18-19 0.1296667000300218 1104 20-21 0.04295115604043076 1104 22-23 0.041187068361523416 1104 24-25 -0.06926233610249 1104 26-27 0.02378390551496068 1104 28-29 -0.10195425883295428 1104 30-31 0.013599739765787433 1104 32-33 -0.13920028025222564 1104 34-35 -0.1289160244219829 1104 36-37 -0.031953758382549324 1104 38-39 0.13051746571915146 1104 40-41 -0.0051045941347211965 1104 42-43 0.03290461415273427 1104 44-45 0.04611650485436769 1104 46-47 -0.0037033329996987163 1104 48-49 0.24341907716944888 1104 50-51 0.36509108197377316 1104 52-53 0.26388749874887196 1104 54-55 0.19266089480532145 1104 56-57 0.1390126113502106 1104 58-59 0.14555600040036154 1104 60-61 0.0675232709438447 1104 62-63 0.2423931538384565 1104 64-65 0.27169452507256864 1104 66-67 0.26648984085677796 1104 68-69 0.21317936142528282 1104 70-71 0.0909943949554588 1104 72-73 0.04960714643178932 1104 74-75 0.20111850665598752 1104 76-77 0.1303297968171364 1104 78-79 0.27638624762285957 1104 80-81 0.20568511660493982 1104 82-83 0.4910794715243725 1104 84-85 0.33391302171954607 1104 86-87 0.10145380842758556 1104 88-89 0.1976904213792423 1104 90-91 0.29283855469923026 1104 92-93 0.4365053548193387 1104 94-95 0.38947552797517915 1104 96-97 0.7061230107096392 1104 98-99 0.5554749274346911 1104 100 0.4690721649484537 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 9.0 28 20.0 29 38.0 30 67.0 31 71.0 32 123.0 33 161.0 34 275.0 35 455.0 36 805.0 37 970.0 38 848.0 39 158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.5 10.025 13.3 47.175 2 27.575 17.625 30.65 24.15 3 27.650000000000002 21.75 22.125 28.475 4 30.33772180881511 26.98912421293646 14.968517458500285 27.70463651974814 5 31.35 28.825 18.9 20.925 6 23.897795591182362 32.03907815631262 19.664328657314627 24.39879759519038 7 22.7 13.100000000000001 37.3 26.900000000000002 8 23.025000000000002 18.775 23.3 34.9 9 22.35 18.825 29.025000000000002 29.799999999999997 10-11 27.8875 25.6125 18.7625 27.737499999999997 12-13 24.925 20.5875 24.837500000000002 29.65 14-15 25.912499999999998 22.787499999999998 24.95 26.35 16-17 27.450000000000003 22.275 22.025 28.249999999999996 18-19 26.7625 22.925 22.925 27.3875 20-21 26.387500000000003 23.962500000000002 22.400000000000002 27.250000000000004 22-23 27.6625 22.975 21.837500000000002 27.525 24-25 26.724999999999998 22.8875 22.1 28.287499999999998 26-27 26.8 23.8875 22.112499999999997 27.200000000000003 28-29 27.1 22.3875 22.6 27.9125 30-31 26.35 22.7375 23.1 27.8125 32-33 27.175 23.4125 22.8125 26.6 34-35 27.900000000000002 22.3375 21.825 27.9375 36-37 26.087500000000002 22.3375 23.225 28.349999999999998 38-39 26.7625 23.549999999999997 22.425 27.2625 40-41 27.05 22.775000000000002 22.775000000000002 27.400000000000002 42-43 26.437500000000004 22.3125 22.7625 28.487499999999997 44-45 26.9625 23.1625 22.725 27.150000000000002 46-47 26.3 23.150000000000002 22.9625 27.5875 48-49 26.8625 21.825 23.0 28.3125 50-51 26.924999999999997 22.8625 22.5875 27.625 52-53 27.9375 22.7625 21.325 27.975 54-55 25.9625 23.6125 22.975 27.450000000000003 56-57 26.987499999999997 22.35 23.225 27.437499999999996 58-59 28.6375 21.8875 22.2 27.275 60-61 27.275 21.85 23.05 27.825 62-63 26.9125 23.5125 22.8 26.775 64-65 27.650000000000002 23.0 21.7375 27.6125 66-67 26.375 22.975 22.9375 27.712500000000002 68-69 27.025 22.7375 23.0625 27.175 70-71 27.462500000000002 22.7625 22.0875 27.6875 72-73 26.924999999999997 22.125 23.325000000000003 27.625 74-75 27.3375 22.5625 22.4375 27.6625 76-77 27.425 22.325 22.45 27.800000000000004 78-79 27.425 23.2125 22.7375 26.625 80-81 27.6125 24.025 22.4375 25.924999999999997 82-83 27.6375 22.625 21.725 28.012500000000003 84-85 27.3875 22.3625 23.1625 27.0875 86-87 27.875 22.2625 22.112499999999997 27.750000000000004 88-89 28.1 21.925 22.0 27.975 90-91 27.400000000000002 23.325000000000003 22.0 27.275 92-93 27.815976997124643 22.540317539692463 23.002875359419928 26.64083010376297 94-95 28.349999999999998 21.6125 22.4375 27.6 96-97 27.500000000000004 23.275000000000002 23.075000000000003 26.150000000000002 98-99 27.750000000000004 23.1875 22.3125 26.75 100 28.175 23.275000000000002 20.575 27.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 1.5 29 1.5 30 4.5 31 7.5 32 8.0 33 12.0 34 12.5 35 19.0 36 30.5 37 36.0 38 50.0 39 62.5 40 76.5 41 87.0 42 105.5 43 123.0 44 130.0 45 147.0 46 137.0 47 125.0 48 133.0 49 131.5 50 114.0 51 100.5 52 98.0 53 98.0 54 95.0 55 95.5 56 96.0 57 102.0 58 115.5 59 114.5 60 127.5 61 127.5 62 113.5 63 108.5 64 106.5 65 114.0 66 110.0 67 104.5 68 103.0 69 102.0 70 82.0 71 58.5 72 55.5 73 52.0 74 41.5 75 35.0 76 27.0 77 17.0 78 16.5 79 10.5 80 6.0 81 5.0 82 2.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 12.65 5 0.0 6 0.2 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618250 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618250_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2835 34.0 31.0 34.0 31.0 34.0 2 33.0095 34.0 33.0 34.0 31.0 34.0 3 33.1445 34.0 33.0 34.0 31.0 34.0 4 36.61 37.0 37.0 37.0 35.0 37.0 5 36.62025 37.0 37.0 37.0 35.0 37.0 6 36.57575 37.0 37.0 37.0 35.0 37.0 7 36.58025 37.0 37.0 37.0 35.0 37.0 8 36.5665 37.0 37.0 37.0 35.0 37.0 9 38.51625 39.0 39.0 39.0 37.0 39.0 10-11 38.460625 39.0 39.0 39.0 37.0 39.0 12-13 38.373875 39.0 39.0 39.0 37.0 39.0 14-15 40.028875 41.0 40.0 41.0 38.0 41.0 16-17 39.992 41.0 40.0 41.0 38.0 41.0 18-19 39.954 41.0 40.0 41.0 38.0 41.0 20-21 39.912625000000006 41.0 40.0 41.0 38.0 41.0 22-23 39.803 41.0 40.0 41.0 37.5 41.0 24-25 39.66025 41.0 40.0 41.0 37.0 41.0 26-27 39.62425 41.0 39.5 41.0 37.0 41.0 28-29 39.511375 41.0 39.0 41.0 37.0 41.0 30-31 39.395125 41.0 39.0 41.0 36.0 41.0 32-33 39.362625 41.0 39.0 41.0 35.5 41.0 34-35 39.23125 40.0 39.0 41.0 35.0 41.0 36-37 39.066 40.0 38.0 41.0 35.0 41.0 38-39 38.87775 40.0 38.0 41.0 35.0 41.0 40-41 38.48175 40.0 37.0 41.0 34.5 41.0 42-43 38.274625 40.0 37.0 41.0 34.0 41.0 44-45 37.891125 39.5 35.5 41.0 33.0 41.0 46-47 37.623125 39.0 35.0 41.0 33.0 41.0 48-49 37.5095 39.0 35.0 41.0 33.0 41.0 50-51 37.10825 38.5 35.0 40.5 32.5 41.0 52-53 37.12075 38.0 35.0 40.0 33.0 41.0 54-55 37.197375 37.5 35.0 41.0 33.0 41.0 56-57 36.957125000000005 37.0 35.0 41.0 33.0 41.0 58-59 36.833 36.5 35.0 40.0 33.0 41.0 60-61 36.58925 36.0 35.0 40.0 33.0 41.0 62-63 36.329875 35.0 35.0 40.0 33.0 41.0 64-65 36.024125 35.0 35.0 39.0 32.5 41.0 66-67 35.765625 35.0 35.0 39.0 32.0 41.0 68-69 35.403375 35.0 35.0 37.5 32.0 40.5 70-71 35.1525 35.0 34.5 37.0 32.0 39.5 72-73 34.846625 35.0 34.0 37.0 31.0 39.0 74-75 34.5365 35.0 34.0 36.0 31.0 39.0 76-77 34.28575 35.0 34.0 35.5 31.0 37.5 78-79 34.08075 35.0 34.0 35.0 30.5 37.0 80-81 33.8995 35.0 34.0 35.0 30.0 37.0 82-83 33.716375 35.0 34.0 35.0 30.0 36.0 84-85 33.459875 35.0 33.0 35.0 29.5 36.0 86-87 33.252875 35.0 33.0 35.0 29.0 35.5 88-89 33.0785 35.0 33.0 35.0 29.0 35.0 90-91 32.84525 35.0 33.0 35.0 29.0 35.0 92-93 32.52012499999999 35.0 33.0 35.0 27.0 35.0 94-95 32.32325 35.0 32.5 35.0 27.0 35.0 96-97 31.994374999999998 35.0 32.0 35.0 27.0 35.0 98-99 31.755625000000002 34.5 32.0 35.0 26.0 35.0 100 31.34875 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.07118907016315035 1101 2 0.043514162746475904 1101 3 -0.08159843859473881 1101 4 0.013011710539487353 1101 5 -0.06145530977880043 1101 6 -0.09130717645881248 1101 7 -0.11515363827444958 1101 8 -0.11678010209188017 1101 9 -0.11645480932839547 1101 10-11 -0.01687768992093197 1101 12-13 -0.12215994394955487 1101 14-15 -0.13334501050945846 1101 16-17 -0.08179861875688488 1101 18-19 -0.19618907016315035 1101 20-21 -0.030527474727257697 1101 22-23 -0.3036607947152419 1101 24-25 -0.19139725753177572 1101 26-27 0.03635772194975573 1101 28-29 -0.15310029026123573 1101 30-31 -0.1549269342408124 1101 32-33 -0.12773996596937565 1101 34-35 0.0687743969572594 1101 36-37 -0.09912671404264017 1101 38-39 -0.11542888599739598 1101 40-41 -0.1323816434791354 1101 42-43 -0.03071514362926564 1101 44-45 0.024159243318990775 1101 46-47 0.061668001201077516 1101 48-49 0.04621659493544428 1101 50-51 -0.13115553998598983 1101 52-53 0.0543238915023494 1101 54-55 0.11621709538584923 1101 56-57 -0.11784355920327982 1101 58-59 -0.1346211590431352 1101 60-61 -0.20566009408467067 1101 62-63 -0.08187368631768521 1101 64-65 -0.056550895806232404 1101 66-67 -0.26767841056950914 1101 68-69 -0.2849814833350024 1101 70-71 -0.3259433490141177 1101 72-73 -0.3121934741267154 1101 74-75 -0.11084976478831265 1101 76-77 -0.3960314282854611 1101 78-79 -0.26936743068761615 1101 80-81 -0.22048593734361077 1101 82-83 -0.10633319987989154 1101 84-85 -0.11866930237213325 1101 86-87 -0.2627239515564028 1101 88-89 -0.3609748773896513 1101 90-91 -0.08571464317886068 1101 92-93 -0.134946451806627 1101 94-95 -0.20413372034831667 1101 96-97 -0.41385997397657803 1101 98-99 -0.2482359123210891 1101 100 -0.6028175357822043 1104 1 -0.07118907016314324 1104 2 -0.0435141627464688 1104 3 0.0815984385947317 1104 4 -0.013011710539487353 1104 5 0.06145530977880043 1104 6 0.09130717645881958 1104 7 0.11515363827444247 1104 8 0.11678010209188727 1104 9 0.11645480932839547 1104 10-11 0.016877689920924865 1104 12-13 0.12215994394955487 1104 14-15 0.13334501050945846 1104 16-17 0.08179861875688488 1104 18-19 0.19618907016314324 1104 20-21 0.030527474727257697 1104 22-23 0.303660794715249 1104 24-25 0.19139725753177572 1104 26-27 -0.03635772194975573 1104 28-29 0.15310029026123573 1104 30-31 0.1549269342408124 1104 32-33 0.12773996596937565 1104 34-35 -0.0687743969572594 1104 36-37 0.09912671404263307 1104 38-39 0.11542888599739598 1104 40-41 0.13238164347912829 1104 42-43 0.030715143629272745 1104 44-45 -0.02415924331898367 1104 46-47 -0.061668001201077516 1104 48-49 -0.04621659493544428 1104 50-51 0.13115553998598983 1104 52-53 -0.0543238915023494 1104 54-55 -0.11621709538584213 1104 56-57 0.11784355920328693 1104 58-59 0.1346211590431423 1104 60-61 0.20566009408467778 1104 62-63 0.08187368631769232 1104 64-65 0.0565508958062253 1104 66-67 0.26767841056950914 1104 68-69 0.2849814833350024 1104 70-71 0.3259433490141106 1104 72-73 0.3121934741267154 1104 74-75 0.11084976478831265 1104 76-77 0.396031428285454 1104 78-79 0.26936743068761615 1104 80-81 0.22048593734360367 1104 82-83 0.10633319987989154 1104 84-85 0.11866930237213325 1104 86-87 0.2627239515563957 1104 88-89 0.3609748773896513 1104 90-91 0.08571464317886068 1104 92-93 0.134946451806627 1104 94-95 0.20413372034831667 1104 96-97 0.41385997397657803 1104 98-99 0.2482359123210891 1104 100 0.6028175357822008 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 10.0 28 27.0 29 41.0 30 51.0 31 81.0 32 117.0 33 175.0 34 252.0 35 471.0 36 793.0 37 914.0 38 903.0 39 164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.425 9.575 13.575000000000001 48.425000000000004 2 28.125 17.675 29.15 25.05 3 25.624999999999996 23.125 21.25 30.0 4 29.975 26.900000000000002 16.2 26.924999999999997 5 32.074999999999996 28.749999999999996 17.525 21.65 6 23.575 31.974999999999998 19.8 24.65 7 21.625 13.725000000000001 38.35 26.3 8 23.925 19.275000000000002 22.25 34.55 9 23.825 18.85 27.85 29.475 10-11 27.881970492623154 25.70642660665166 18.829707426856714 27.581895473868467 12-13 25.2125 20.525 24.837500000000002 29.425 14-15 26.2875 22.975 22.6875 28.050000000000004 16-17 27.05 21.85 22.787499999999998 28.3125 18-19 26.337500000000002 23.125 22.9625 27.575 20-21 27.150000000000002 22.575 22.675 27.6 22-23 27.1625 22.662499999999998 21.7375 28.4375 24-25 26.737499999999997 23.0375 22.025 28.199999999999996 26-27 26.924999999999997 21.975 22.125 28.975 28-29 26.5125 22.6125 22.55 28.325 30-31 25.874999999999996 21.625 23.2875 29.212500000000002 32-33 26.075 22.925 23.0875 27.9125 34-35 27.037499999999998 23.0375 22.650000000000002 27.275 36-37 26.4625 22.675 22.6 28.262500000000003 38-39 26.575 23.375 21.75 28.299999999999997 40-41 26.7125 22.375 22.8 28.1125 42-43 27.0625 23.0625 22.3625 27.5125 44-45 28.349999999999998 22.6 21.837500000000002 27.212500000000002 46-47 27.3625 22.975 22.0125 27.650000000000002 48-49 26.825 22.075 23.400000000000002 27.700000000000003 50-51 26.337500000000002 22.662499999999998 22.475 28.525 52-53 26.700000000000003 22.537499999999998 22.537499999999998 28.225 54-55 26.674999999999997 22.9375 22.9875 27.400000000000002 56-57 26.0125 23.1375 22.9875 27.8625 58-59 26.737499999999997 22.3625 22.650000000000002 28.249999999999996 60-61 27.1125 22.3375 23.35 27.200000000000003 62-63 26.700000000000003 22.900000000000002 22.35 28.050000000000004 64-65 26.3 22.5 22.7625 28.4375 66-67 27.3625 22.400000000000002 22.45 27.787499999999998 68-69 26.2875 22.725 23.2875 27.700000000000003 70-71 27.0625 22.25 22.237499999999997 28.449999999999996 72-73 27.3625 21.349999999999998 23.5875 27.700000000000003 74-75 26.4625 23.4625 22.325 27.750000000000004 76-77 27.037499999999998 23.0125 22.3 27.650000000000002 78-79 27.0125 22.1875 22.5625 28.237499999999997 80-81 27.975 23.0 21.9 27.125 82-83 26.525 23.1875 22.3875 27.900000000000002 84-85 27.125 22.5125 22.537499999999998 27.825 86-87 27.0625 22.45 23.0125 27.474999999999998 88-89 27.0 22.925 22.15 27.925 90-91 26.7125 22.625 22.8875 27.775 92-93 27.9375 23.2375 22.0625 26.7625 94-95 27.8375 22.125 22.85 27.187499999999996 96-97 26.9625 22.125 23.4625 27.450000000000003 98-99 27.462500000000002 23.175 22.537499999999998 26.825 100 27.925 23.65 21.95 26.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 0.0 28 0.5 29 3.0 30 3.0 31 5.5 32 8.5 33 11.0 34 15.0 35 19.0 36 33.5 37 43.0 38 49.0 39 58.0 40 74.5 41 99.5 42 106.5 43 103.0 44 121.5 45 125.5 46 130.5 47 140.0 48 125.5 49 115.0 50 114.5 51 114.0 52 109.0 53 106.0 54 104.5 55 99.5 56 94.5 57 103.5 58 109.0 59 112.5 60 123.5 61 117.5 62 121.0 63 122.0 64 110.5 65 113.0 66 101.0 67 95.0 68 101.5 69 95.5 70 72.5 71 64.0 72 62.5 73 51.5 74 48.0 75 39.0 76 28.5 77 23.5 78 17.5 79 11.0 80 6.5 81 5.0 82 5.0 83 3.0 84 0.5 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01490275322051 98.0 2 0.9345794392523363 1.8499999999999999 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566718 spots for SRR8618250.sra Written 566718 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra Read 566701 spots for SRR8618250.sra Written 566701 spots for SRR8618250.sra SRR ids: ['SRR8618250.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l9wtry49 SRR8618250.sra spots: 11334037 blocks: [[1, 566701], [566702, 1133402], [1133403, 1700103], [1700104, 2266804], [2266805, 2833505], [2833506, 3400206], [3400207, 3966907], [3966908, 4533608], [4533609, 5100309], [5100310, 5667010], [5667011, 6233711], [6233712, 6800412], [6800413, 7367113], [7367114, 7933814], [7933815, 8500515], [8500516, 9067216], [9067217, 9633917], [9633918, 10200618], [10200619, 10767319], [10767320, 11334037]] SRR8618250 file size 2949741 SRR8618250 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618250 SRR8618250_1.fastq SRR8618250_2.fastq Input file: SRR8618250_1.fastq Paired file: SRR8618250_2.fastq trimmed: SRR8618250-trimmed-pair1.fastq, SRR8618250-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:32:09 2024 >> started Sat Dec 7 10:32:20 2024 >> done (10.282s) 11334037 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11334037 (100.00%) read pairs available; of these: 1406264 (12.41%) trimmed read pairs available after processing 9927773 (87.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 4 0.00% 81 14 0.00% 82 31 0.00% 83 88 0.00% 84 4548 0.04% 85 4931 0.04% 86 5375 0.05% 87 6137 0.05% 88 7582 0.07% 89 9235 0.08% 90 16219 0.14% 91 30236 0.27% 92 43089 0.38% 93 60168 0.53% 94 82293 0.73% 95 104791 0.92% 96 139572 1.23% 97 196475 1.73% 98 287001 2.53% 99 408475 3.60% 100 9927773 87.59% 11334037 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=32 prefix-density=0.40 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=28 fanout-score=25.58 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=7.3 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=35 prefix-density=0.39 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=30 fanout-score=24.59 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=7.2 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618250 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:32:47 Started mapping on | Dec 07 10:32:47 Finished on | Dec 07 10:33:12 Mapping speed, Million of reads per hour | 1632.10 Number of input reads | 11334037 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11131691 Uniquely mapped reads % | 98.21% Average mapped length | 198.43 Number of splices: Total | 6731276 Number of splices: Annotated (sjdb) | 6419975 Number of splices: GT/AG | 6642375 Number of splices: GC/AG | 77314 Number of splices: AT/AC | 1952 Number of splices: Non-canonical | 9635 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 90839 % of reads mapped to multiple loci | 0.80% Number of reads mapped to too many loci | 6968 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 111507 111507 111507 N_multimapping 90839 90839 90839 N_noFeature 236912 5568405 5612428 N_ambiguous 229973 21095 22210 UnstrandedReadsAssigned:10664806 PositiveStrandReadsAssigned:5542191 NegativeStrandReadsAssigned:5497053 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618250 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618250-trimmed-pair1.fastq SRR8618250-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,334,037 reads, 10,901,930 reads pseudoaligned [quant] estimated average fragment length: 168.161 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52973 SRR8618250.ke.tsv 35125 SRR8618250.se.tsv 88098 total ==> SRR8618250.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 768.839 0 0 PNS24247 1044 876.839 22.1025 3.0974 PNS24249 1928 1760.84 60.5495 4.22538 PNS24246 1044 876.839 22.1025 3.0974 PNS24248 1044 876.839 22.1025 3.0974 PNS24244 1471 1303.84 24.143 2.27531 PNS24243 293 134.45 10 9.13934 KQK14069 1603 1435.84 2055.38 175.898 KQK14071 474 308.282 179.225 71.4374 ==> SRR8618250.se.tsv <== BRADI_1g14170v3 2462 BRADI_1g53295v3 16 BRADI_1g59795v3 179 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 423 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 126 BRADI_1g48960v3 0 SRR8618250 completed mapping pipeline successfully