Starting /dee2/code/volunteer_pipeline.sh SRR8618251 current disk space = 1543405838336 free memory = 1605745552 SRR8618251 SRAfilesize 5b7812d0bdd32976b100d6f2dbe0898d SRR8618251.sra SRR8618251.sra file validated SRR8618251 is paired end SRR8618251 is conventional basespace SRR8618251 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618251_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10275 34.0 31.0 34.0 31.0 34.0 2 33.27725 34.0 34.0 34.0 31.0 34.0 3 33.276 34.0 34.0 34.0 31.0 34.0 4 32.15325 37.0 37.0 37.0 2.0 37.0 5 34.31975 37.0 35.0 37.0 19.0 37.0 6 35.79575 37.0 35.0 37.0 32.0 37.0 7 36.2575 37.0 35.0 37.0 35.0 37.0 8 36.4275 37.0 37.0 37.0 35.0 37.0 9 38.3865 39.0 39.0 39.0 37.0 39.0 10-11 38.450874999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.416875000000005 39.0 39.0 39.0 37.0 39.0 14-15 40.04575 41.0 40.0 41.0 38.0 41.0 16-17 39.98775 41.0 40.0 41.0 38.0 41.0 18-19 39.865875 41.0 40.0 41.0 38.0 41.0 20-21 39.842375000000004 41.0 40.0 41.0 38.0 41.0 22-23 39.76375 41.0 40.0 41.0 37.5 41.0 24-25 39.644875 41.0 39.5 41.0 37.0 41.0 26-27 39.4825 41.0 39.0 41.0 36.5 41.0 28-29 39.322 40.0 39.0 41.0 36.0 41.0 30-31 39.12425 40.0 38.5 41.0 35.5 41.0 32-33 39.1435 40.0 38.5 41.0 35.0 41.0 34-35 39.237875 40.5 39.0 41.0 35.0 41.0 36-37 39.23075 41.0 39.0 41.0 35.0 41.0 38-39 39.076375 40.5 38.0 41.0 35.0 41.0 40-41 38.88575 40.0 38.0 41.0 35.0 41.0 42-43 38.647625 40.0 37.0 41.0 35.0 41.0 44-45 38.4915 40.0 36.5 41.0 35.0 41.0 46-47 38.22625 40.0 36.0 41.0 34.5 41.0 48-49 38.014624999999995 39.5 35.0 41.0 34.0 41.0 50-51 37.66125 39.0 35.0 41.0 33.5 41.0 52-53 37.466375 39.0 35.0 41.0 33.0 41.0 54-55 37.229749999999996 38.0 35.0 41.0 33.0 41.0 56-57 36.8505 37.0 35.0 40.5 33.0 41.0 58-59 36.453125 36.5 35.0 40.0 32.5 41.0 60-61 36.303250000000006 36.0 35.0 40.0 32.5 41.0 62-63 35.9935 35.0 35.0 39.0 32.0 41.0 64-65 35.75675 35.0 35.0 39.0 32.0 41.0 66-67 35.414125 35.0 34.0 38.5 31.0 41.0 68-69 35.1535 35.0 34.0 37.0 31.0 40.0 70-71 34.886250000000004 35.0 34.0 37.0 31.0 39.5 72-73 34.48175 35.0 34.0 36.5 30.5 39.0 74-75 34.242 35.0 34.0 36.0 30.0 39.0 76-77 33.511125 34.5 32.5 35.0 29.0 37.0 78-79 33.955124999999995 35.0 33.0 35.0 30.0 37.0 80-81 33.895250000000004 35.0 33.5 35.0 30.5 37.0 82-83 33.613 35.0 33.0 35.0 30.0 36.0 84-85 33.38875 35.0 33.0 35.0 29.0 36.0 86-87 33.27875 35.0 33.0 35.0 29.5 35.5 88-89 32.85675 35.0 33.0 35.0 28.0 35.0 90-91 32.664375 35.0 33.0 35.0 27.0 35.0 92-93 32.495999999999995 35.0 33.0 35.0 27.0 35.0 94-95 32.33275 35.0 33.0 35.0 27.0 35.0 96-97 32.0015 35.0 33.0 35.0 27.0 35.0 98-99 31.638875 35.0 32.0 35.0 25.0 35.0 100 31.28775 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 -0.0035855965822335634 1101 2 0.05892076085851272 1101 3 0.145839690774082 1101 4 -5.042645712541958 1101 5 -2.5897416336079786 1101 6 -0.6906469331705836 1101 7 -0.28577967653341574 1101 8 -0.10586410334655483 1101 9 0.11349303224493923 1101 10-11 -0.017775404333235656 1101 12-13 9.536161122980502E-4 1101 14-15 -0.05955650493337572 1101 16-17 -0.048507272912218014 1101 18-19 0.032359373410642434 1101 20-21 0.10508849557521671 1101 22-23 0.07075831553249401 1101 24-25 -0.032511951988603016 1101 26-27 0.048341979452757755 1101 28-29 0.029956260807651347 1101 30-31 0.1282295799003137 1101 32-33 -0.021628013426912673 1101 34-35 0.21475434848947117 1101 36-37 0.25868426406265854 1101 38-39 0.16392025226325302 1101 40-41 0.08255772556199759 1101 42-43 0.19772912216458138 1101 44-45 0.08953819550401931 1101 46-47 0.11936730749669522 1101 48-49 0.2163055640321403 1101 50-51 0.19547858813955798 1101 52-53 0.4173151256230341 1101 54-55 0.26185026955548807 1101 56-57 0.31662597904587386 1101 58-59 0.32801851286745887 1101 60-61 0.46076187569931903 1101 62-63 0.4473222459566699 1101 64-65 0.473781914352557 1101 66-67 0.2744125724748301 1101 68-69 0.329073848031733 1101 70-71 0.4511494252873547 1101 72-73 0.23447512969179485 1101 74-75 0.002848133455394475 1101 76-77 0.12564845895636267 1101 78-79 0.08400722205269773 1101 80-81 0.1455853931441382 1101 82-83 0.10445275150036082 1101 84-85 0.06197233241785938 1101 86-87 0.0012969179127253483 1101 88-89 0.09686196724646834 1101 90-91 -0.42757603499135044 1101 92-93 -0.4186629030617439 1101 94-95 -0.31345997355304434 1101 96-97 -0.03940341776014833 1101 98-99 0.007272912216457428 1101 100 -0.4322042518563727 1104 1 0.003585596582240669 1104 2 -0.058920760858505616 1104 3 -0.145839690774082 1104 4 5.042645712541958 1104 5 2.5897416336079715 1104 6 0.6906469331705836 1104 7 0.28577967653341574 1104 8 0.10586410334655483 1104 9 -0.11349303224493923 1104 10-11 0.01777540433322855 1104 12-13 -9.536161122980502E-4 1104 14-15 0.05955650493337572 1104 16-17 0.04850727291221091 1104 18-19 -0.032359373410642434 1104 20-21 -0.10508849557522382 1104 22-23 -0.07075831553250111 1104 24-25 0.032511951988603016 1104 26-27 -0.04834197945275065 1104 28-29 -0.029956260807651347 1104 30-31 -0.1282295799003137 1104 32-33 0.021628013426912673 1104 34-35 -0.21475434848947828 1104 36-37 -0.25868426406266565 1104 38-39 -0.1639202522632459 1104 40-41 -0.08255772556199759 1104 42-43 -0.19772912216458138 1104 44-45 -0.08953819550401221 1104 46-47 -0.11936730749669522 1104 48-49 -0.2163055640321474 1104 50-51 -0.19547858813955798 1104 52-53 -0.417315125623027 1104 54-55 -0.26185026955548807 1104 56-57 -0.31662597904587386 1104 58-59 -0.32801851286745887 1104 60-61 -0.46076187569931903 1104 62-63 -0.4473222459566628 1104 64-65 -0.473781914352557 1104 66-67 -0.274412572474823 1104 68-69 -0.3290738480317401 1104 70-71 -0.4511494252873547 1104 72-73 -0.23447512969178774 1104 74-75 -0.002848133455394475 1104 76-77 -0.12564845895636267 1104 78-79 -0.08400722205269062 1104 80-81 -0.1455853931441382 1104 82-83 -0.10445275150035371 1104 84-85 -0.06197233241785938 1104 86-87 -0.0012969179127253483 1104 88-89 -0.09686196724646123 1104 90-91 0.427576034991354 1104 92-93 0.4186629030617439 1104 94-95 0.31345997355304434 1104 96-97 0.03940341776014833 1104 98-99 -0.007272912216457428 1104 100 0.4322042518563691 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 12.0 28 19.0 29 47.0 30 65.0 31 90.0 32 135.0 33 184.0 34 273.0 35 473.0 36 770.0 37 941.0 38 853.0 39 136.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.2 10.674999999999999 13.575000000000001 45.550000000000004 2 26.474999999999998 17.325 30.8 25.4 3 27.725 21.95 21.7 28.625 4 29.617925883366848 27.57828210284401 15.828784831944843 26.975007181844298 5 30.85 29.2 18.85 21.099999999999998 6 22.80130293159609 31.520922074668 19.819594086695062 25.85818090704084 7 21.725 14.899999999999999 37.225 26.150000000000002 8 22.400000000000002 18.0 24.5 35.099999999999994 9 23.825 19.1 27.224999999999998 29.849999999999998 10-11 27.700000000000003 26.3125 18.525 27.462500000000002 12-13 25.7 20.837500000000002 25.25 28.212500000000002 14-15 25.4375 22.575 23.6125 28.375 16-17 26.900000000000002 22.375 22.8875 27.8375 18-19 26.0 22.85 23.2375 27.9125 20-21 26.087500000000002 23.9375 22.55 27.425 22-23 26.575 23.175 22.575 27.675 24-25 26.900000000000002 23.025000000000002 22.7125 27.3625 26-27 27.2625 23.0375 22.625 27.075 28-29 26.974999999999998 22.912499999999998 22.55 27.5625 30-31 26.224999999999998 23.3875 22.5 27.8875 32-33 25.7 23.4875 22.6125 28.199999999999996 34-35 27.2625 22.75 22.325 27.6625 36-37 26.275 23.6125 22.3 27.8125 38-39 26.937499999999996 23.2375 22.787499999999998 27.037499999999998 40-41 27.200000000000003 23.3125 22.375 27.1125 42-43 26.3 22.575 23.3125 27.8125 44-45 27.3875 23.2125 22.7125 26.687499999999996 46-47 27.325 24.125 21.6 26.950000000000003 48-49 26.55 22.7 22.7125 28.037499999999998 50-51 27.6625 22.287499999999998 23.075000000000003 26.974999999999998 52-53 25.9625 23.375 22.900000000000002 27.762500000000003 54-55 25.837500000000002 22.8375 22.925 28.4 56-57 27.3 22.912499999999998 22.6125 27.175 58-59 27.8625 23.0625 21.762500000000003 27.3125 60-61 26.9125 23.175 22.175 27.737499999999997 62-63 26.724999999999998 23.0 22.7375 27.537499999999998 64-65 27.875 22.075 23.0 27.05 66-67 26.625 23.0375 22.912499999999998 27.425 68-69 27.0125 23.3125 22.075 27.6 70-71 27.325 22.175 23.2125 27.287499999999998 72-73 26.924999999999997 21.4375 23.674999999999997 27.962500000000002 74-75 27.3375 23.175 23.325000000000003 26.1625 76-77 28.0625 22.662499999999998 22.3875 26.887499999999996 78-79 26.6625 22.575 23.1875 27.575 80-81 27.275 22.825 22.825 27.075 82-83 28.262500000000003 22.0875 21.8625 27.787499999999998 84-85 26.6 22.225 23.5875 27.5875 86-87 28.1375 23.0625 22.35 26.450000000000003 88-89 29.075 21.462500000000002 23.1375 26.325 90-91 27.037499999999998 23.200000000000003 22.85 26.9125 92-93 27.419354838709676 22.36809202300575 23.818454613653415 26.39409852463116 94-95 27.9125 22.7 22.9875 26.400000000000002 96-97 27.537499999999998 23.1875 22.412499999999998 26.8625 98-99 27.525 22.35 23.175 26.950000000000003 100 27.325 23.1 22.85 26.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.0 29 2.0 30 3.5 31 6.5 32 8.5 33 9.0 34 14.5 35 24.0 36 32.5 37 42.5 38 58.0 39 79.0 40 90.0 41 106.5 42 115.5 43 107.0 44 118.5 45 135.5 46 131.0 47 129.5 48 134.5 49 127.5 50 118.0 51 107.0 52 94.0 53 103.5 54 102.5 55 88.0 56 92.0 57 102.0 58 117.0 59 120.5 60 128.0 61 127.0 62 113.0 63 110.0 64 113.5 65 102.5 66 95.0 67 93.0 68 82.5 69 78.0 70 72.0 71 65.0 72 53.0 73 53.0 74 52.0 75 36.0 76 28.0 77 25.5 78 19.5 79 10.0 80 7.5 81 6.5 82 3.5 83 2.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 12.975 5 0.0 6 0.22499999999999998 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618251 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618251_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4305 34.0 31.0 34.0 31.0 34.0 2 33.0285 34.0 33.0 34.0 31.0 34.0 3 33.135 34.0 33.0 34.0 31.0 34.0 4 36.57175 37.0 37.0 37.0 35.0 37.0 5 36.6 37.0 37.0 37.0 35.0 37.0 6 36.55875 37.0 37.0 37.0 35.0 37.0 7 36.5035 37.0 37.0 37.0 35.0 37.0 8 36.52725 37.0 37.0 37.0 35.0 37.0 9 38.43925 39.0 39.0 39.0 37.0 39.0 10-11 38.418375 39.0 39.0 39.0 37.0 39.0 12-13 38.342625 39.0 39.0 39.0 37.0 39.0 14-15 39.971875 41.0 40.0 41.0 38.0 41.0 16-17 39.923 41.0 40.0 41.0 38.0 41.0 18-19 39.8875 41.0 40.0 41.0 38.0 41.0 20-21 39.891 41.0 40.0 41.0 38.0 41.0 22-23 39.789375 41.0 40.0 41.0 38.0 41.0 24-25 39.675625 41.0 40.0 41.0 37.0 41.0 26-27 39.55375 41.0 39.0 41.0 36.5 41.0 28-29 39.428749999999994 41.0 39.0 41.0 36.0 41.0 30-31 39.286 40.0 39.0 41.0 35.5 41.0 32-33 39.224625 40.5 38.5 41.0 35.0 41.0 34-35 39.11475 40.0 38.0 41.0 35.0 41.0 36-37 38.969875 40.0 38.0 41.0 35.0 41.0 38-39 38.71 40.0 38.0 41.0 35.0 41.0 40-41 38.415 40.0 37.0 41.0 34.0 41.0 42-43 38.242375 40.0 36.5 41.0 34.0 41.0 44-45 37.93375 39.5 35.5 41.0 33.5 41.0 46-47 37.67675 39.0 35.0 41.0 33.0 41.0 48-49 37.4815 39.0 35.0 41.0 33.0 41.0 50-51 37.042249999999996 38.0 34.5 40.5 32.5 41.0 52-53 37.109750000000005 38.0 35.0 40.0 33.0 41.0 54-55 37.1985 37.5 35.0 41.0 33.0 41.0 56-57 36.96525 37.0 35.0 41.0 33.0 41.0 58-59 36.80075 36.5 35.0 40.0 33.0 41.0 60-61 36.559625 36.0 35.0 40.0 33.0 41.0 62-63 36.389 35.5 35.0 40.0 33.0 41.0 64-65 35.986875 35.0 35.0 39.0 33.0 41.0 66-67 35.670875 35.0 35.0 39.0 32.0 41.0 68-69 35.416375 35.0 35.0 37.5 32.0 40.5 70-71 35.172124999999994 35.0 34.5 37.0 31.5 40.0 72-73 34.89475 35.0 34.0 36.5 31.0 39.0 74-75 34.57825 35.0 34.0 36.0 31.0 39.0 76-77 34.37075 35.0 34.0 36.0 30.5 37.5 78-79 34.07325 35.0 34.0 35.0 30.0 37.0 80-81 33.858125 35.0 34.0 35.0 30.0 37.0 82-83 33.661625 35.0 33.0 35.0 29.5 36.0 84-85 33.452375 35.0 33.0 35.0 29.5 36.0 86-87 33.21025 35.0 33.0 35.0 29.0 36.0 88-89 33.079625 35.0 33.0 35.0 29.0 35.0 90-91 32.8595 35.0 33.0 35.0 28.0 35.0 92-93 32.593375 35.0 33.0 35.0 27.0 35.0 94-95 32.339125 35.0 33.0 35.0 27.0 35.0 96-97 32.029624999999996 35.0 32.5 35.0 27.0 35.0 98-99 31.607625 35.0 32.0 35.0 25.0 35.0 100 31.24125 35.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.06649883023090553 1101 2 0.11982504323059828 1101 3 0.11339131319295603 1101 4 0.03908554572271328 1101 5 0.010146475434851254 1101 6 -0.04490896144847767 1101 7 0.08908045977011625 1101 8 0.005060522835925951 1101 9 0.03654256942325418 1101 10-11 0.0331095514189812 1101 12-13 0.07636557827280654 1101 14-15 0.0702751500356058 1101 16-17 0.26904689248296876 1101 18-19 0.2485250737463076 1101 20-21 0.18530668294171448 1101 22-23 0.24923710711016156 1101 24-25 0.011875699318480315 1101 26-27 0.07583155324992674 1101 28-29 0.16856118400976072 1101 30-31 0.15621503407588477 1101 32-33 0.31791018207709953 1101 34-35 0.4035703387244425 1101 36-37 0.43238226019733617 1101 38-39 0.4654790967348248 1101 40-41 0.19007476350320474 1101 42-43 0.39325856983013097 1101 44-45 0.3187493642559289 1101 46-47 0.3279167938154828 1101 48-49 0.3561819753839899 1101 50-51 0.3100651001932633 1101 52-53 0.25027972739294313 1101 54-55 0.6435128674600747 1101 56-57 0.3877275963788023 1101 58-59 0.4376080764927295 1101 60-61 0.4066981995727801 1101 62-63 0.34911250127148463 1101 64-65 0.18826925033058473 1101 66-67 0.4470425185637197 1101 68-69 0.46388973654765664 1101 70-71 0.32890855457227275 1101 72-73 0.23247889329671523 1101 74-75 0.2818380632692552 1101 76-77 0.3193978232122845 1101 78-79 0.44500813752415525 1101 80-81 0.3286796867053141 1101 82-83 0.2455497914759448 1101 84-85 0.3358127352253035 1101 86-87 0.2599811819753839 1101 88-89 0.20977011494252906 1101 90-91 0.16674295595564814 1101 92-93 0.5619469026548671 1101 94-95 0.3725968873970089 1101 96-97 0.552932051673281 1101 98-99 0.5435993286542598 1101 100 0.5002797273929396 1104 1 0.06649883023090553 1104 2 -0.11982504323059828 1104 3 -0.11339131319296314 1104 4 -0.03908554572271328 1104 5 -0.010146475434851254 1104 6 0.04490896144847767 1104 7 -0.08908045977011625 1104 8 -0.005060522835933057 1104 9 -0.03654256942325418 1104 10-11 -0.0331095514189812 1104 12-13 -0.07636557827281365 1104 14-15 -0.0702751500356058 1104 16-17 -0.26904689248296165 1104 18-19 -0.2485250737463076 1104 20-21 -0.18530668294171448 1104 22-23 -0.24923710711016156 1104 24-25 -0.011875699318480315 1104 26-27 -0.07583155324991964 1104 28-29 -0.16856118400976783 1104 30-31 -0.15621503407587767 1104 32-33 -0.31791018207709953 1104 34-35 -0.4035703387244425 1104 36-37 -0.43238226019732906 1104 38-39 -0.4654790967348177 1104 40-41 -0.19007476350320474 1104 42-43 -0.39325856983013097 1104 44-45 -0.3187493642559218 1104 46-47 -0.3279167938154828 1104 48-49 -0.3561819753839899 1104 50-51 -0.3100651001932633 1104 52-53 -0.25027972739294313 1104 54-55 -0.6435128674600747 1104 56-57 -0.38772759637879517 1104 58-59 -0.4376080764927224 1104 60-61 -0.4066981995727801 1104 62-63 -0.34911250127149174 1104 64-65 -0.18826925033058473 1104 66-67 -0.4470425185637268 1104 68-69 -0.46388973654765664 1104 70-71 -0.32890855457227275 1104 72-73 -0.23247889329671523 1104 74-75 -0.2818380632692552 1104 76-77 -0.3193978232122845 1104 78-79 -0.44500813752415525 1104 80-81 -0.3286796867053141 1104 82-83 -0.2455497914759448 1104 84-85 -0.3358127352253035 1104 86-87 -0.2599811819753839 1104 88-89 -0.20977011494252906 1104 90-91 -0.16674295595564814 1104 92-93 -0.5619469026548671 1104 94-95 -0.3725968873970089 1104 96-97 -0.5529320516732774 1104 98-99 -0.5435993286542598 1104 100 -0.5002797273929431 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 9.0 28 27.0 29 47.0 30 52.0 31 93.0 32 117.0 33 179.0 34 274.0 35 469.0 36 768.0 37 914.0 38 854.0 39 197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.825 9.15 13.675 48.35 2 26.275 17.525 31.55 24.65 3 27.55 22.6 21.5 28.349999999999998 4 30.15 26.6 15.45 27.800000000000004 5 30.125 30.049999999999997 18.075 21.75 6 22.875 33.025 19.725 24.375 7 22.7 13.875000000000002 36.75 26.674999999999997 8 22.55 19.2 23.974999999999998 34.275 9 22.975 19.0 27.55 30.475 10-11 27.62631315657829 26.788394197098548 18.309154577288645 27.276138069034516 12-13 25.775 20.5125 25.4625 28.249999999999996 14-15 26.400000000000002 23.0 23.3375 27.2625 16-17 27.8875 22.5125 22.2625 27.3375 18-19 26.900000000000002 22.8875 22.4375 27.775 20-21 26.687499999999996 23.4875 22.675 27.150000000000002 22-23 27.474999999999998 22.475 22.525000000000002 27.525 24-25 26.125 22.900000000000002 22.662499999999998 28.3125 26-27 26.8625 22.85 23.025000000000002 27.2625 28-29 27.525 23.3125 21.95 27.212500000000002 30-31 25.362499999999997 23.375 23.025000000000002 28.237499999999997 32-33 27.35 23.9875 21.462500000000002 27.200000000000003 34-35 26.2125 22.25 22.3125 29.225 36-37 26.900000000000002 22.75 23.0 27.35 38-39 26.787499999999998 22.7375 23.1 27.375 40-41 27.3125 23.0 21.65 28.037499999999998 42-43 27.0625 23.25 22.475 27.212500000000002 44-45 27.287499999999998 22.3125 22.725 27.675 46-47 27.725 22.9375 21.925 27.4125 48-49 27.075 22.7375 22.3125 27.875 50-51 26.8 22.412499999999998 22.7625 28.025 52-53 26.525 22.625 22.5875 28.262500000000003 54-55 27.287499999999998 22.425 22.725 27.5625 56-57 26.9125 23.025000000000002 22.925 27.1375 58-59 26.775 22.725 22.6 27.900000000000002 60-61 26.325 22.912499999999998 22.9625 27.800000000000004 62-63 25.825 22.8 22.95 28.425 64-65 27.224999999999998 23.375 22.35 27.05 66-67 26.575 23.400000000000002 22.6125 27.4125 68-69 26.05 23.875 22.125 27.950000000000003 70-71 26.8625 22.425 23.125 27.5875 72-73 27.725 21.912499999999998 22.8 27.5625 74-75 26.900000000000002 23.1625 22.8125 27.125 76-77 28.125 22.2125 21.65 28.012500000000003 78-79 26.55 23.599999999999998 22.662499999999998 27.187499999999996 80-81 26.7625 22.8875 23.3875 26.9625 82-83 27.0625 22.725 21.8625 28.349999999999998 84-85 26.5125 22.900000000000002 23.0 27.5875 86-87 27.1125 22.925 23.1125 26.85 88-89 27.525 22.45 22.6 27.425 90-91 27.237499999999997 22.775000000000002 22.6875 27.3 92-93 26.787499999999998 23.225 23.075000000000003 26.9125 94-95 28.349999999999998 23.3875 22.237499999999997 26.025 96-97 26.625 22.5625 23.325000000000003 27.487499999999997 98-99 27.800000000000004 23.7875 22.125 26.2875 100 28.549999999999997 22.650000000000002 21.725 27.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 1.5 29 3.5 30 5.0 31 6.5 32 10.0 33 14.5 34 16.5 35 21.0 36 29.0 37 37.5 38 52.5 39 68.5 40 81.5 41 104.5 42 128.0 43 128.0 44 125.0 45 133.5 46 140.5 47 134.5 48 119.5 49 122.0 50 110.0 51 92.0 52 99.0 53 92.5 54 88.5 55 86.0 56 86.0 57 101.0 58 109.0 59 120.0 60 131.0 61 121.5 62 120.5 63 110.5 64 98.5 65 117.5 66 112.0 67 98.5 68 95.5 69 88.0 70 71.0 71 63.0 72 60.5 73 51.5 74 43.5 75 39.0 76 31.5 77 25.5 78 21.0 79 11.5 80 11.0 81 6.5 82 2.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.05 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8076728924785461 1.6 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566068 spots for SRR8618251.sra Written 566068 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra Read 566063 spots for SRR8618251.sra Written 566063 spots for SRR8618251.sra SRR ids: ['SRR8618251.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6sty0l1u SRR8618251.sra spots: 11321265 blocks: [[1, 566063], [566064, 1132126], [1132127, 1698189], [1698190, 2264252], [2264253, 2830315], [2830316, 3396378], [3396379, 3962441], [3962442, 4528504], [4528505, 5094567], [5094568, 5660630], [5660631, 6226693], [6226694, 6792756], [6792757, 7358819], [7358820, 7924882], [7924883, 8490945], [8490946, 9057008], [9057009, 9623071], [9623072, 10189134], [10189135, 10755197], [10755198, 11321265]] SRR8618251 file size 2946417 SRR8618251 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618251 SRR8618251_1.fastq SRR8618251_2.fastq Input file: SRR8618251_1.fastq Paired file: SRR8618251_2.fastq trimmed: SRR8618251-trimmed-pair1.fastq, SRR8618251-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:36:34 2024 >> started Sat Dec 7 10:36:45 2024 >> done (10.806s) 11321265 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11321265 (100.00%) read pairs available; of these: 1440380 (12.72%) trimmed read pairs available after processing 9880885 (87.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 5 0.00% 82 29 0.00% 83 84 0.00% 84 5732 0.05% 85 6064 0.05% 86 6390 0.06% 87 7143 0.06% 88 8449 0.07% 89 10675 0.09% 90 17641 0.16% 91 32065 0.28% 92 45529 0.40% 93 63491 0.56% 94 85786 0.76% 95 107778 0.95% 96 143522 1.27% 97 200023 1.77% 98 289144 2.55% 99 410830 3.63% 100 9880885 87.28% 11321265 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=32 prefix-density=0.41 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=31 fanout-score=23.43 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=7.0 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=34 prefix-density=0.42 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=31 fanout-score=22.43 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=6.8 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR8618251 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:37:35 Started mapping on | Dec 07 10:37:35 Finished on | Dec 07 10:38:09 Mapping speed, Million of reads per hour | 1198.72 Number of input reads | 11321265 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11130819 Uniquely mapped reads % | 98.32% Average mapped length | 198.42 Number of splices: Total | 6717131 Number of splices: Annotated (sjdb) | 6396951 Number of splices: GT/AG | 6628201 Number of splices: GC/AG | 77806 Number of splices: AT/AC | 1858 Number of splices: Non-canonical | 9266 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 85041 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 6652 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105405 105405 105405 N_multimapping 85041 85041 85041 N_noFeature 271947 5581457 5628885 N_ambiguous 235988 21910 22929 UnstrandedReadsAssigned:10622884 PositiveStrandReadsAssigned:5527452 NegativeStrandReadsAssigned:5479005 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618251 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618251-trimmed-pair1.fastq SRR8618251-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,321,265 reads, 10,860,277 reads pseudoaligned [quant] estimated average fragment length: 166.116 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52973 SRR8618251.ke.tsv 35125 SRR8618251.se.tsv 88098 total ==> SRR8618251.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.964 0 0 PNS24247 1044 878.884 12.8429 1.81506 PNS24249 1928 1762.88 71.8044 5.05929 PNS24246 1044 878.884 12.8429 1.81506 PNS24248 1044 878.884 12.8429 1.81506 PNS24244 1471 1305.88 5.66707 0.539033 PNS24243 293 135.783 10 9.14779 KQK14069 1603 1437.88 2382.99 205.854 KQK14071 474 310.377 279.514 111.86 ==> SRR8618251.se.tsv <== BRADI_1g14170v3 2936 BRADI_1g53295v3 17 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 177 BRADI_1g74790v3 56 BRADI_1g09890v3 1 BRADI_1g77505v3 136 BRADI_1g48960v3 0 SRR8618251 completed mapping pipeline successfully