Starting /dee2/code/volunteer_pipeline.sh SRR8618252 current disk space = 1543448768512 free memory = 1597639064 SRR8618252 SRAfilesize 59ed8d8dfabe8a5d0df04c1e24ff9e5c SRR8618252.sra SRR8618252.sra file validated SRR8618252 is paired end SRR8618252 is conventional basespace SRR8618252 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618252_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12125 34.0 33.0 34.0 31.0 34.0 2 33.29425 34.0 34.0 34.0 31.0 34.0 3 33.281 34.0 34.0 34.0 31.0 34.0 4 32.199 37.0 37.0 37.0 2.0 37.0 5 34.36675 37.0 37.0 37.0 19.0 37.0 6 35.8105 37.0 35.0 37.0 32.0 37.0 7 36.27775 37.0 35.0 37.0 35.0 37.0 8 36.40325 37.0 37.0 37.0 35.0 37.0 9 38.4225 39.0 39.0 39.0 37.0 39.0 10-11 38.423249999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.427499999999995 39.0 39.0 39.0 37.0 39.0 14-15 40.019125 41.0 40.0 41.0 38.0 41.0 16-17 40.007875 41.0 40.0 41.0 38.0 41.0 18-19 39.900125 41.0 40.0 41.0 38.0 41.0 20-21 39.844 41.0 40.0 41.0 38.0 41.0 22-23 39.739625000000004 41.0 40.0 41.0 37.5 41.0 24-25 39.649 41.0 39.5 41.0 37.0 41.0 26-27 39.535624999999996 41.0 39.0 41.0 37.0 41.0 28-29 39.379 40.5 39.0 41.0 36.0 41.0 30-31 39.215875 40.0 38.5 41.0 35.5 41.0 32-33 39.139250000000004 40.0 38.0 41.0 35.0 41.0 34-35 39.270125 40.5 39.0 41.0 35.0 41.0 36-37 39.324875000000006 41.0 39.0 41.0 35.0 41.0 38-39 39.15725 40.5 38.0 41.0 35.0 41.0 40-41 38.975125000000006 40.0 38.0 41.0 35.0 41.0 42-43 38.734875 40.0 37.0 41.0 35.0 41.0 44-45 38.529625 40.0 36.5 41.0 35.0 41.0 46-47 38.312625 40.0 36.0 41.0 35.0 41.0 48-49 38.06225 39.5 35.0 41.0 34.0 41.0 50-51 37.806625 39.0 35.0 41.0 34.0 41.0 52-53 37.495875 39.0 35.0 41.0 33.0 41.0 54-55 37.191625 38.0 35.0 41.0 33.0 41.0 56-57 36.838125 37.0 35.0 40.5 33.0 41.0 58-59 36.656125 36.5 35.0 40.0 33.0 41.0 60-61 36.416125 36.0 35.0 40.0 33.0 41.0 62-63 36.090500000000006 35.5 35.0 39.5 32.5 41.0 64-65 35.800625 35.0 35.0 39.0 32.0 41.0 66-67 35.488125 35.0 34.0 38.5 31.0 41.0 68-69 35.259125 35.0 34.5 37.0 31.5 40.0 70-71 34.973625 35.0 34.0 37.0 31.0 39.5 72-73 34.659 35.0 34.0 36.0 31.0 39.0 74-75 34.364375 35.0 34.0 36.0 31.0 38.5 76-77 33.534000000000006 34.5 32.5 35.0 29.5 37.0 78-79 33.887249999999995 35.0 33.5 35.0 30.0 37.0 80-81 33.897499999999994 35.0 34.0 35.0 30.0 36.5 82-83 33.691125 35.0 33.5 35.0 30.0 36.0 84-85 33.410875000000004 35.0 33.0 35.0 29.0 36.0 86-87 33.303375 35.0 33.0 35.0 29.5 35.5 88-89 33.0285 35.0 33.0 35.0 29.0 35.0 90-91 32.846875 35.0 33.0 35.0 29.0 35.0 92-93 32.679125 35.0 33.0 35.0 29.0 35.0 94-95 32.486875 35.0 33.0 35.0 28.0 35.0 96-97 32.227000000000004 35.0 33.0 35.0 27.5 35.0 98-99 31.878500000000003 35.0 33.0 35.0 27.0 35.0 100 31.47725 35.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 1.87617260785089E-4 1101 2 0.024640400250156347 1101 3 -0.0149468417761085 1101 4 -4.417823639774859 1101 5 -2.217010631644783 1101 6 -0.6213258286429024 1101 7 -0.16110068792995236 1101 8 -0.10569105691057246 1101 9 0.02482801751094854 1101 10-11 -0.007911194496564633 1101 12-13 0.050156347717326355 1101 14-15 -0.009537210756725756 1101 16-17 0.057973733583487785 1101 18-19 0.1494684177611063 1101 20-21 -0.04040025015634541 1101 22-23 0.034990619136962664 1101 24-25 0.0896810506566581 1101 26-27 -0.02692307692307594 1101 28-29 -0.1175422138836737 1101 30-31 0.06394621638524711 1101 32-33 -0.022076297686048463 1101 34-35 0.12435897435897658 1101 36-37 0.16707317073170458 1101 38-39 0.20162601626016396 1101 40-41 0.16835522201375852 1101 42-43 0.3013445903689771 1101 44-45 0.3138211382113809 1101 46-47 0.21322701688555412 1101 48-49 0.15994371482176462 1101 50-51 0.12632895559724489 1101 52-53 0.15337711069418702 1101 54-55 0.014446529080672121 1101 56-57 -0.11710444027517042 1101 58-59 0.25531582238899375 1101 60-61 0.05778611632269559 1101 62-63 -0.028674171357103262 1101 64-65 -0.1348030018761719 1101 66-67 -0.07454659161976451 1101 68-69 0.127923702313943 1101 70-71 0.1087867417135655 1101 72-73 -0.02004377736084706 1101 74-75 -0.00337711069418134 1101 76-77 0.10484677923702179 1101 78-79 -0.10981863664790126 1101 80-81 -0.14821763602251536 1101 82-83 -0.08864915572232235 1101 84-85 0.004377736085054096 1101 86-87 0.03258286429018398 1101 88-89 -0.07717323327079839 1101 90-91 -0.0234834271419615 1101 92-93 -0.06779237023139473 1101 94-95 -0.1197936210131374 1101 96-97 0.28711694809256016 1101 98-99 0.5030644152595372 1101 100 0.5196998123827399 1104 1 -1.8761726079219443E-4 1104 2 -0.024640400250156347 1104 3 0.014946841776115605 1104 4 4.417823639774859 1104 5 2.2170106316447757 1104 6 0.6213258286429024 1104 7 0.16110068792995946 1104 8 0.10569105691056535 1104 9 -0.024828017510941436 1104 10-11 0.007911194496564633 1104 12-13 -0.050156347717326355 1104 14-15 0.00953721075671865 1104 16-17 -0.057973733583487785 1104 18-19 -0.1494684177610992 1104 20-21 0.04040025015634541 1104 22-23 -0.034990619136962664 1104 24-25 -0.0896810506566581 1104 26-27 0.02692307692307594 1104 28-29 0.1175422138836737 1104 30-31 -0.06394621638524 1104 32-33 0.022076297686055568 1104 34-35 -0.12435897435897658 1104 36-37 -0.16707317073171168 1104 38-39 -0.20162601626016396 1104 40-41 -0.16835522201375852 1104 42-43 -0.3013445903689842 1104 44-45 -0.3138211382113809 1104 46-47 -0.21322701688555412 1104 48-49 -0.15994371482176462 1104 50-51 -0.12632895559724489 1104 52-53 -0.15337711069417992 1104 54-55 -0.014446529080672121 1104 56-57 0.11710444027517752 1104 58-59 -0.25531582238899375 1104 60-61 -0.057786116322702696 1104 62-63 0.028674171357096156 1104 64-65 0.1348030018761719 1104 66-67 0.07454659161976451 1104 68-69 -0.127923702313943 1104 70-71 -0.10878674171357261 1104 72-73 0.02004377736084706 1104 74-75 0.00337711069418134 1104 76-77 -0.10484677923702179 1104 78-79 0.10981863664790126 1104 80-81 0.14821763602251536 1104 82-83 0.08864915572232945 1104 84-85 -0.004377736085054096 1104 86-87 -0.03258286429017687 1104 88-89 0.07717323327079129 1104 90-91 0.023483427141968605 1104 92-93 0.06779237023139473 1104 94-95 0.11979362101313029 1104 96-97 -0.28711694809256016 1104 98-99 -0.5030644152595336 1104 100 -0.5196998123827399 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 4.0 27 7.0 28 20.0 29 51.0 30 63.0 31 78.0 32 122.0 33 175.0 34 250.0 35 451.0 36 782.0 37 987.0 38 859.0 39 150.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.7 10.075000000000001 12.45 47.775 2 27.55 17.1 31.424999999999997 23.925 3 27.0 22.625 23.35 27.025 4 29.988532110091743 27.666284403669728 16.1697247706422 26.175458715596328 5 31.125000000000004 29.65 18.9 20.325 6 22.61457550713749 32.90758827948911 18.83295767593288 25.64487853744052 7 21.875 13.525 39.2 25.4 8 23.275000000000002 18.375 23.875 34.475 9 23.025000000000002 18.95 28.675 29.349999999999998 10-11 28.0875 25.912499999999998 18.025 27.975 12-13 25.412499999999998 21.0125 24.712500000000002 28.8625 14-15 25.8 23.5 23.2875 27.4125 16-17 27.0625 21.7 22.625 28.6125 18-19 26.650000000000002 23.0125 22.5 27.8375 20-21 26.400000000000002 23.6125 21.987499999999997 28.000000000000004 22-23 27.8875 22.375 22.2625 27.474999999999998 24-25 26.125 23.05 22.8375 27.987499999999997 26-27 25.874999999999996 22.7125 22.8 28.6125 28-29 26.6 23.4875 22.175 27.737499999999997 30-31 26.6625 24.325 22.1375 26.875 32-33 27.625 22.85 21.462500000000002 28.0625 34-35 26.9125 23.025000000000002 22.8125 27.250000000000004 36-37 26.650000000000002 22.8625 22.7125 27.775 38-39 27.625 23.025000000000002 22.662499999999998 26.687499999999996 40-41 26.8375 22.775000000000002 22.6 27.787499999999998 42-43 27.400000000000002 23.525 22.1875 26.887499999999996 44-45 27.0625 23.7375 22.0 27.200000000000003 46-47 27.075 23.1125 22.025 27.787499999999998 48-49 27.625 23.025000000000002 22.175 27.175 50-51 27.325 23.425 21.7 27.55 52-53 27.325 22.3 22.675 27.700000000000003 54-55 27.450000000000003 22.6875 22.5125 27.35 56-57 27.35 22.475 23.5 26.674999999999997 58-59 26.25 23.200000000000003 22.35 28.199999999999996 60-61 26.85 23.125 22.400000000000002 27.625 62-63 27.3 22.662499999999998 22.6875 27.35 64-65 27.487499999999997 23.075000000000003 22.375 27.0625 66-67 26.8375 22.6 23.5875 26.974999999999998 68-69 27.2625 22.4375 22.6125 27.6875 70-71 26.687499999999996 22.475 22.662499999999998 28.175 72-73 26.137500000000003 22.900000000000002 22.787499999999998 28.175 74-75 27.187499999999996 23.2125 22.75 26.85 76-77 27.5125 22.625 21.762500000000003 28.1 78-79 26.8375 22.7375 22.725 27.700000000000003 80-81 26.8125 23.225 22.7 27.2625 82-83 27.3125 22.75 22.6 27.3375 84-85 26.637499999999996 22.525000000000002 23.150000000000002 27.6875 86-87 26.75 22.3375 23.2375 27.675 88-89 27.6625 22.662499999999998 22.662499999999998 27.0125 90-91 27.425 23.1125 22.7125 26.75 92-93 26.85 23.075000000000003 23.3125 26.7625 94-95 27.5875 22.475 23.05 26.887499999999996 96-97 27.6125 22.4625 22.400000000000002 27.525 98-99 28.512500000000003 22.7625 22.3 26.424999999999997 100 27.200000000000003 23.45 21.575 27.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 1.0 30 2.0 31 6.0 32 9.0 33 10.5 34 14.5 35 22.0 36 29.0 37 42.5 38 54.0 39 64.0 40 76.0 41 85.5 42 103.5 43 122.5 44 129.5 45 126.0 46 145.0 47 155.0 48 137.5 49 122.0 50 122.0 51 119.5 52 106.0 53 94.5 54 82.0 55 92.0 56 103.5 57 104.5 58 102.0 59 114.5 60 119.5 61 117.0 62 122.0 63 121.5 64 116.0 65 113.0 66 112.5 67 102.0 68 93.0 69 87.0 70 76.5 71 61.0 72 54.0 73 47.0 74 40.0 75 35.0 76 28.0 77 17.5 78 11.5 79 9.0 80 5.5 81 4.5 82 3.5 83 2.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 12.8 5 0.0 6 0.17500000000000002 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618252 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618252_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.293 34.0 31.0 34.0 31.0 34.0 2 32.93125 34.0 31.0 34.0 31.0 34.0 3 33.10075 34.0 33.0 34.0 31.0 34.0 4 36.56825 37.0 37.0 37.0 35.0 37.0 5 36.58525 37.0 37.0 37.0 35.0 37.0 6 36.5245 37.0 37.0 37.0 35.0 37.0 7 36.527 37.0 37.0 37.0 35.0 37.0 8 36.52375 37.0 37.0 37.0 35.0 37.0 9 38.44025 39.0 39.0 39.0 37.0 39.0 10-11 38.420500000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.376625000000004 39.0 39.0 39.0 37.0 39.0 14-15 40.004999999999995 41.0 40.0 41.0 38.0 41.0 16-17 40.0055 41.0 40.0 41.0 38.0 41.0 18-19 39.899875 41.0 40.0 41.0 38.0 41.0 20-21 39.879875 41.0 40.0 41.0 38.0 41.0 22-23 39.7915 41.0 40.0 41.0 37.5 41.0 24-25 39.6605 41.0 40.0 41.0 37.0 41.0 26-27 39.619 41.0 39.5 41.0 37.0 41.0 28-29 39.481625 41.0 39.0 41.0 36.0 41.0 30-31 39.371375 40.5 39.0 41.0 36.0 41.0 32-33 39.353875 41.0 39.0 41.0 36.0 41.0 34-35 39.16175 40.5 38.0 41.0 35.0 41.0 36-37 39.045375 40.0 38.0 41.0 35.0 41.0 38-39 38.887 40.0 38.0 41.0 35.0 41.0 40-41 38.496125 40.0 37.0 41.0 34.5 41.0 42-43 38.338625 40.0 37.0 41.0 34.5 41.0 44-45 38.0175 40.0 35.5 41.0 33.5 41.0 46-47 37.727625 39.0 35.0 41.0 33.0 41.0 48-49 37.61825 39.0 35.0 41.0 33.0 41.0 50-51 37.12425 38.5 35.0 40.5 33.0 41.0 52-53 37.135374999999996 38.0 35.0 40.0 33.0 41.0 54-55 37.2595 38.0 35.0 41.0 33.0 41.0 56-57 36.983625 37.0 35.0 41.0 33.0 41.0 58-59 36.79425 37.0 35.0 40.0 33.0 41.0 60-61 36.5295 36.0 35.0 40.0 33.0 41.0 62-63 36.302875 35.0 35.0 39.5 33.0 41.0 64-65 35.98325 35.0 35.0 39.0 33.0 41.0 66-67 35.684625 35.0 35.0 39.0 32.0 41.0 68-69 35.298125 35.0 35.0 37.5 32.0 40.0 70-71 35.1255 35.0 35.0 37.0 32.0 39.5 72-73 34.9095 35.0 34.5 36.5 31.0 39.0 74-75 34.599000000000004 35.0 34.0 36.0 31.0 39.0 76-77 34.32875 35.0 34.0 35.5 31.0 37.5 78-79 34.083 35.0 34.0 35.0 31.0 37.0 80-81 33.833625 35.0 34.0 35.0 30.0 36.5 82-83 33.715875 35.0 34.0 35.0 30.0 36.0 84-85 33.51975 35.0 33.0 35.0 29.5 36.0 86-87 33.307625 35.0 33.0 35.0 29.0 35.5 88-89 33.136375 35.0 33.0 35.0 29.0 35.0 90-91 32.837625 35.0 33.0 35.0 28.0 35.0 92-93 32.618875 35.0 33.0 35.0 27.0 35.0 94-95 32.410250000000005 35.0 33.0 35.0 27.0 35.0 96-97 32.0715 35.0 32.5 35.0 27.0 35.0 98-99 31.75225 35.0 32.0 35.0 26.5 35.0 100 31.36525 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.31238273921200843 1101 2 0.0983739837398403 1101 3 0.05528455284552791 1101 4 0.05165728580362838 1101 5 0.008505315822382897 1101 6 -0.04296435272045329 1101 7 -0.04853033145715813 1101 8 0.026141338336458375 1101 9 0.09893683552219557 1101 10-11 0.10218886804252492 1101 12-13 0.06529080675421994 1101 14-15 0.19140087554721674 1101 16-17 0.06535334584114594 1101 18-19 0.05237648530331285 1101 20-21 0.05747342088805851 1101 22-23 0.03517823639774775 1101 24-25 0.05456535334583634 1101 26-27 0.22945590994371656 1101 28-29 0.05569105691056819 1101 30-31 0.044934333958721595 1101 32-33 -0.048186366479050946 1101 34-35 0.10178236397748464 1101 36-37 0.21960600375234662 1101 38-39 0.25 1101 40-41 -0.2859912445278283 1101 42-43 0.13821138211381623 1101 44-45 0.08261413383364413 1101 46-47 -0.08151969981238238 1101 48-49 0.058818011257031344 1101 50-51 0.033927454659163914 1101 52-53 -0.08721075672295342 1101 54-55 0.10293933708567238 1101 56-57 0.019480925578484687 1101 58-59 0.02223264540337766 1101 60-61 0.0030331457160741593 1101 62-63 0.052782989368360234 1101 64-65 -0.06744840525328755 1101 66-67 0.0023764853033156896 1101 68-69 -0.20403377110693555 1101 70-71 -0.33449030644153055 1101 72-73 -0.11641651031894895 1101 74-75 -0.0897123202001282 1101 76-77 -0.3359599749843696 1101 78-79 -0.31313320825515945 1101 80-81 -0.31722951844903235 1101 82-83 -0.15706691682301255 1101 84-85 -0.16701063164477858 1101 86-87 -0.14346466541588399 1101 88-89 -0.052720450281427134 1101 90-91 -0.18636647904941128 1101 92-93 -0.024796747967485544 1101 94-95 0.04127579737335907 1101 96-97 -0.2489368355221977 1101 98-99 -0.16135084427767765 1101 100 -0.4839274546591632 1104 1 0.3123827392120049 1104 2 -0.09837398373983319 1104 3 -0.05528455284552791 1104 4 -0.05165728580362128 1104 5 -0.008505315822390003 1104 6 0.042964352720446186 1104 7 0.04853033145716523 1104 8 -0.02614133833646548 1104 9 -0.09893683552220267 1104 10-11 -0.10218886804252492 1104 12-13 -0.06529080675422705 1104 14-15 -0.19140087554721674 1104 16-17 -0.06535334584115304 1104 18-19 -0.05237648530331995 1104 20-21 -0.05747342088805851 1104 22-23 -0.03517823639774775 1104 24-25 -0.05456535334583634 1104 26-27 -0.22945590994371656 1104 28-29 -0.05569105691056819 1104 30-31 -0.044934333958721595 1104 32-33 0.048186366479050946 1104 34-35 -0.10178236397748464 1104 36-37 -0.21960600375234662 1104 38-39 -0.25 1104 40-41 0.2859912445278354 1104 42-43 -0.13821138211382333 1104 44-45 -0.08261413383365124 1104 46-47 0.08151969981238238 1104 48-49 -0.05881801125703845 1104 50-51 -0.033927454659163914 1104 52-53 0.08721075672295342 1104 54-55 -0.10293933708567948 1104 56-57 -0.019480925578484687 1104 58-59 -0.02223264540337766 1104 60-61 -0.0030331457160741593 1104 62-63 -0.05278298936835313 1104 64-65 0.06744840525328755 1104 66-67 -0.0023764853033156896 1104 68-69 0.20403377110694265 1104 70-71 0.33449030644152344 1104 72-73 0.11641651031895606 1104 74-75 0.0897123202001211 1104 76-77 0.3359599749843696 1104 78-79 0.31313320825515945 1104 80-81 0.31722951844903235 1104 82-83 0.15706691682301255 1104 84-85 0.16701063164477858 1104 86-87 0.14346466541588399 1104 88-89 0.052720450281427134 1104 90-91 0.18636647904940418 1104 92-93 0.02479674796747844 1104 94-95 -0.04127579737335196 1104 96-97 0.24893683552220125 1104 98-99 0.16135084427767055 1104 100 0.48392745465915965 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 11.0 28 28.0 29 50.0 30 57.0 31 74.0 32 107.0 33 170.0 34 249.0 35 435.0 36 809.0 37 971.0 38 890.0 39 148.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.7 10.025 13.325000000000001 47.949999999999996 2 25.85 17.7 31.0 25.45 3 27.950000000000003 22.0 22.325 27.725 4 31.225 26.6 14.799999999999999 27.375 5 30.9 28.225 18.375 22.5 6 23.75 32.525 19.525000000000002 24.2 7 21.825 13.975000000000001 37.075 27.125 8 24.25 19.3 23.75 32.7 9 23.325000000000003 19.05 27.825 29.799999999999997 10-11 28.49462365591398 26.331582895723933 18.242060515128784 26.93173293323331 12-13 25.775 20.4125 24.9125 28.9 14-15 26.875 21.75 23.4125 27.962500000000002 16-17 26.737499999999997 22.475 22.35 28.4375 18-19 26.3625 23.6625 22.55 27.425 20-21 26.437500000000004 23.2625 22.912499999999998 27.3875 22-23 27.3375 22.9875 22.6125 27.0625 24-25 26.275 22.412499999999998 23.075000000000003 28.237499999999997 26-27 26.150000000000002 22.9625 22.6 28.287499999999998 28-29 27.575 22.525000000000002 22.3625 27.537499999999998 30-31 26.087500000000002 23.7 23.474999999999998 26.737499999999997 32-33 27.0 23.075000000000003 22.7 27.224999999999998 34-35 27.1375 22.5 23.0625 27.3 36-37 26.375 23.375 22.625 27.625 38-39 26.5875 22.25 23.5375 27.625 40-41 26.937499999999996 21.75 23.7625 27.55 42-43 27.1 22.575 22.412499999999998 27.9125 44-45 26.825 23.9125 22.975 26.2875 46-47 26.900000000000002 22.475 22.275 28.349999999999998 48-49 27.175 23.2375 22.912499999999998 26.674999999999997 50-51 27.0625 23.0125 23.025000000000002 26.900000000000002 52-53 26.987499999999997 21.8875 22.575 28.549999999999997 54-55 26.35 23.4375 22.5 27.712500000000002 56-57 27.3875 23.1 22.575 26.937499999999996 58-59 26.8625 22.525000000000002 22.5875 28.025 60-61 26.5625 22.162499999999998 22.6375 28.6375 62-63 27.800000000000004 22.5875 22.3625 27.250000000000004 64-65 26.700000000000003 22.5625 23.1625 27.575 66-67 27.487499999999997 22.6 22.4875 27.425 68-69 26.5625 23.150000000000002 23.1625 27.125 70-71 26.787499999999998 22.9375 22.7625 27.5125 72-73 26.5375 22.275 23.0 28.1875 74-75 26.5125 23.5 22.475 27.5125 76-77 27.8625 22.2125 23.1 26.825 78-79 27.3875 22.6125 22.7625 27.237499999999997 80-81 27.037499999999998 22.4875 23.5125 26.9625 82-83 27.275 22.95 22.112499999999997 27.6625 84-85 26.5625 22.95 23.7125 26.775 86-87 27.575 22.1875 22.2 28.037499999999998 88-89 27.725 22.825 21.875 27.575 90-91 28.15 22.8125 22.45 26.5875 92-93 27.875 22.9875 21.8 27.3375 94-95 27.6625 22.650000000000002 22.8875 26.8 96-97 27.35 22.3625 22.675 27.6125 98-99 27.800000000000004 22.025 22.525000000000002 27.650000000000002 100 28.449999999999996 22.95 22.400000000000002 26.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 2.0 29 3.0 30 3.0 31 3.0 32 4.5 33 12.5 34 20.0 35 24.0 36 33.0 37 40.5 38 46.0 39 59.5 40 78.0 41 97.0 42 115.5 43 125.5 44 120.0 45 123.0 46 133.0 47 138.5 48 141.5 49 131.5 50 123.5 51 109.0 52 96.0 53 90.5 54 91.5 55 92.5 56 100.5 57 104.0 58 92.5 59 113.0 60 126.0 61 119.0 62 115.0 63 111.5 64 123.5 65 120.5 66 100.5 67 97.0 68 96.5 69 87.5 70 78.0 71 66.0 72 60.0 73 56.0 74 50.0 75 43.0 76 27.5 77 18.0 78 11.0 79 6.0 80 6.0 81 3.5 82 4.0 83 3.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.86104783599089 97.65 2 1.0630220197418374 2.1 3 0.05062009617818274 0.15 4 0.02531004808909137 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565358 spots for SRR8618252.sra Written 565358 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra Read 565356 spots for SRR8618252.sra Written 565356 spots for SRR8618252.sra SRR ids: ['SRR8618252.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y2b0b0ff SRR8618252.sra spots: 11307122 blocks: [[1, 565356], [565357, 1130712], [1130713, 1696068], [1696069, 2261424], [2261425, 2826780], [2826781, 3392136], [3392137, 3957492], [3957493, 4522848], [4522849, 5088204], [5088205, 5653560], [5653561, 6218916], [6218917, 6784272], [6784273, 7349628], [7349629, 7914984], [7914985, 8480340], [8480341, 9045696], [9045697, 9611052], [9611053, 10176408], [10176409, 10741764], [10741765, 11307122]] SRR8618252 file size 2942726 SRR8618252 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618252 SRR8618252_1.fastq SRR8618252_2.fastq Input file: SRR8618252_1.fastq Paired file: SRR8618252_2.fastq trimmed: SRR8618252-trimmed-pair1.fastq, SRR8618252-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:43:32 2024 >> started Sat Dec 7 10:43:42 2024 >> done (10.227s) 11307122 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11307122 (100.00%) read pairs available; of these: 1430037 (12.65%) trimmed read pairs available after processing 9877085 (87.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 8 0.00% 82 29 0.00% 83 85 0.00% 84 5438 0.05% 85 5716 0.05% 86 6171 0.05% 87 7074 0.06% 88 8362 0.07% 89 10144 0.09% 90 17017 0.15% 91 31725 0.28% 92 45247 0.40% 93 63044 0.56% 94 84925 0.75% 95 107472 0.95% 96 141240 1.25% 97 198373 1.75% 98 288584 2.55% 99 409382 3.62% 100 9877085 87.35% 11307122 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=30 prefix-density=0.40 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=29 fanout-score=22.03 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=6.7 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=32 prefix-density=0.40 prefix-fanout=2.1 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=32 fanout-score=22.97 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=6.9 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618252 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:44:09 Started mapping on | Dec 07 10:44:09 Finished on | Dec 07 10:44:33 Mapping speed, Million of reads per hour | 1696.07 Number of input reads | 11307122 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11119984 Uniquely mapped reads % | 98.34% Average mapped length | 198.40 Number of splices: Total | 6729599 Number of splices: Annotated (sjdb) | 6417762 Number of splices: GT/AG | 6639606 Number of splices: GC/AG | 78740 Number of splices: AT/AC | 1885 Number of splices: Non-canonical | 9368 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 84817 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 5628 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 102321 102321 102321 N_multimapping 84817 84817 84817 N_noFeature 251516 5565291 5615496 N_ambiguous 232318 20466 22287 UnstrandedReadsAssigned:10636150 PositiveStrandReadsAssigned:5534227 NegativeStrandReadsAssigned:5482201 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618252 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618252-trimmed-pair1.fastq SRR8618252-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,307,122 reads, 10,875,106 reads pseudoaligned [quant] estimated average fragment length: 165.495 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR8618252.ke.tsv 35125 SRR8618252.se.tsv 88098 total ==> SRR8618252.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.558 0 0 PNS24247 1044 879.505 14.7972 2.09621 PNS24249 1928 1763.5 69.6365 4.91988 PNS24246 1044 879.505 14.7972 2.09621 PNS24248 1044 879.505 14.7972 2.09621 PNS24244 1471 1306.5 12.972 1.23705 PNS24243 293 135.742 8 7.34292 KQK14069 1603 1438.5 1953.43 169.193 KQK14071 474 310.645 194.133 77.8627 ==> SRR8618252.se.tsv <== BRADI_1g14170v3 2296 BRADI_1g53295v3 18 BRADI_1g59795v3 240 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 248 BRADI_1g74790v3 49 BRADI_1g09890v3 3 BRADI_1g77505v3 127 BRADI_1g48960v3 0 SRR8618252 completed mapping pipeline successfully