Starting /dee2/code/volunteer_pipeline.sh SRR8618253 current disk space = 1543376687104 free memory = 1602281976 SRR8618253 SRAfilesize 732ad6c4ebc8dd0fe12612083fdd97e2 SRR8618253.sra SRR8618253.sra file validated SRR8618253 is paired end SRR8618253 is conventional basespace SRR8618253 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618253_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0885 34.0 31.0 34.0 31.0 34.0 2 33.23475 34.0 34.0 34.0 31.0 34.0 3 33.283 34.0 34.0 34.0 31.0 34.0 4 31.94825 37.0 35.0 37.0 2.0 37.0 5 34.241 37.0 35.0 37.0 19.0 37.0 6 35.71175 37.0 35.0 37.0 32.0 37.0 7 36.1875 37.0 35.0 37.0 35.0 37.0 8 36.36475 37.0 37.0 37.0 35.0 37.0 9 38.37575 39.0 39.0 39.0 37.0 39.0 10-11 38.396125 39.0 39.0 39.0 37.0 39.0 12-13 38.4005 39.0 39.0 39.0 37.0 39.0 14-15 39.9415 41.0 40.0 41.0 38.0 41.0 16-17 39.916125 41.0 40.0 41.0 38.0 41.0 18-19 39.877250000000004 41.0 40.0 41.0 38.0 41.0 20-21 39.796625 41.0 40.0 41.0 38.0 41.0 22-23 39.756 41.0 40.0 41.0 37.5 41.0 24-25 39.681625 41.0 40.0 41.0 37.0 41.0 26-27 39.5235 41.0 39.0 41.0 37.0 41.0 28-29 39.30775 40.0 39.0 41.0 36.0 41.0 30-31 39.219875 40.0 38.5 41.0 36.0 41.0 32-33 39.156375 40.0 38.5 41.0 35.0 41.0 34-35 39.233125 40.0 39.0 41.0 35.0 41.0 36-37 39.256 41.0 39.0 41.0 35.0 41.0 38-39 39.12949999999999 40.5 38.0 41.0 35.0 41.0 40-41 38.957875 40.0 38.0 41.0 35.0 41.0 42-43 38.72975 40.0 37.0 41.0 35.0 41.0 44-45 38.565749999999994 40.0 37.0 41.0 35.0 41.0 46-47 38.310249999999996 40.0 36.0 41.0 34.5 41.0 48-49 38.060125 39.5 35.0 41.0 34.0 41.0 50-51 37.76975 39.0 35.0 41.0 34.0 41.0 52-53 37.530249999999995 39.0 35.0 41.0 34.0 41.0 54-55 37.236125 38.5 35.0 41.0 33.0 41.0 56-57 36.982124999999996 37.0 35.0 40.5 33.0 41.0 58-59 36.65775 37.0 35.0 40.0 33.0 41.0 60-61 36.416875000000005 36.0 35.0 40.0 33.0 41.0 62-63 36.19225 35.5 35.0 39.5 33.0 41.0 64-65 35.810249999999996 35.0 35.0 39.0 32.0 41.0 66-67 35.494749999999996 35.0 34.5 39.0 31.0 41.0 68-69 35.23025 35.0 34.0 37.5 31.0 40.0 70-71 34.82275 35.0 34.0 37.0 31.0 39.5 72-73 34.607375 35.0 34.0 36.5 31.0 39.0 74-75 34.3605 35.0 34.0 36.0 31.0 39.0 76-77 33.488875 34.5 32.5 35.0 29.0 37.0 78-79 33.948125000000005 35.0 33.5 35.0 30.0 37.0 80-81 33.806625 35.0 33.5 35.0 30.0 37.0 82-83 33.641999999999996 35.0 33.0 35.0 30.0 36.0 84-85 33.364374999999995 35.0 33.0 35.0 29.5 36.0 86-87 33.2365 35.0 33.0 35.0 29.0 35.5 88-89 33.10925 35.0 33.0 35.0 29.0 35.0 90-91 32.947 35.0 33.0 35.0 29.0 35.0 92-93 32.723 35.0 33.0 35.0 29.0 35.0 94-95 32.570625 35.0 33.0 35.0 28.0 35.0 96-97 32.22725 35.0 33.0 35.0 27.0 35.0 98-99 31.999125 35.0 32.5 35.0 27.0 35.0 100 31.54475 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 0.02927092987333424 1101 2 0.1346926166203275 1101 3 0.1665636906600767 1101 4 -5.393600041190403 1101 5 -2.7774173617547113 1101 6 -0.8604160230666267 1101 7 -0.31853053238595663 1101 8 -0.2107403974873847 1101 9 0.03300381011224829 1101 10-11 0.07472196478221349 1101 12-13 0.13918494490783218 1101 14-15 0.13258160848522493 1101 16-17 0.26170064874883536 1101 18-19 0.18441715580269857 1101 20-21 0.14160488106271174 1101 22-23 0.23923900731129777 1101 24-25 0.23623983111934876 1101 26-27 0.20024971681598913 1101 28-29 0.1857687158891963 1101 30-31 0.11002986304190898 1101 32-33 0.14657347338069826 1101 34-35 0.3367186695499953 1101 36-37 0.2560240963855449 1101 38-39 0.10464936669756497 1101 40-41 0.14206827309237013 1101 42-43 0.28278498609823544 1101 44-45 0.15367881783544846 1101 46-47 0.23289311090515952 1101 48-49 0.08518690145195507 1101 50-51 0.23938059932036282 1101 52-53 0.270826897332924 1101 54-55 0.14175934507260024 1101 56-57 0.3514313664916102 1101 58-59 0.3652301513747247 1101 60-61 0.2463572237668643 1101 62-63 0.10650293481619144 1101 64-65 0.1376660488106225 1101 66-67 0.26152044073730707 1101 68-69 0.02956698589228779 1101 70-71 0.1951781484914008 1101 72-73 0.025795489650910497 1101 74-75 0.06390948409021036 1101 76-77 0.0894861497271151 1101 78-79 -0.010735248687055332 1101 80-81 0.04370044279682617 1101 82-83 0.06820873236536329 1101 84-85 0.32631809288435676 1101 86-87 0.24867418391514207 1101 88-89 0.06425702811244349 1101 90-91 -0.10701781484913653 1101 92-93 -0.13322520852641162 1101 94-95 0.022075481412834108 1101 96-97 -0.22822057460611944 1101 98-99 -0.7135722376686218 1101 100 -0.17202141900937207 1104 1 -0.029270929873341345 1104 2 -0.1346926166203275 1104 3 -0.1665636906600767 1104 4 5.393600041190403 1104 5 2.7774173617547078 1104 6 0.8604160230666267 1104 7 0.3185305323859495 1104 8 0.2107403974873847 1104 9 -0.03300381011224118 1104 10-11 -0.07472196478220638 1104 12-13 -0.13918494490783218 1104 14-15 -0.13258160848522493 1104 16-17 -0.26170064874884247 1104 18-19 -0.18441715580269857 1104 20-21 -0.14160488106271174 1104 22-23 -0.23923900731129777 1104 24-25 -0.23623983111934876 1104 26-27 -0.20024971681598203 1104 28-29 -0.1857687158891963 1104 30-31 -0.11002986304190898 1104 32-33 -0.14657347338070537 1104 34-35 -0.3367186695499953 1104 36-37 -0.2560240963855449 1104 38-39 -0.10464936669755787 1104 40-41 -0.14206827309237013 1104 42-43 -0.28278498609824254 1104 44-45 -0.15367881783544846 1104 46-47 -0.23289311090515952 1104 48-49 -0.08518690145196217 1104 50-51 -0.2393805993203557 1104 52-53 -0.270826897332924 1104 54-55 -0.14175934507260024 1104 56-57 -0.3514313664916102 1104 58-59 -0.3652301513747318 1104 60-61 -0.2463572237668572 1104 62-63 -0.10650293481618434 1104 64-65 -0.1376660488106225 1104 66-67 -0.26152044073730707 1104 68-69 -0.02956698589228779 1104 70-71 -0.1951781484914008 1104 72-73 -0.025795489650917602 1104 74-75 -0.06390948409021036 1104 76-77 -0.0894861497271151 1104 78-79 0.010735248687055332 1104 80-81 -0.04370044279682617 1104 82-83 -0.06820873236536329 1104 84-85 -0.32631809288435676 1104 86-87 -0.24867418391514917 1104 88-89 -0.0642570281124506 1104 90-91 0.10701781484914363 1104 92-93 0.13322520852641162 1104 94-95 -0.022075481412827003 1104 96-97 0.22822057460611944 1104 98-99 0.7135722376686218 1104 100 0.17202141900937207 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 9.0 28 17.0 29 39.0 30 57.0 31 110.0 32 123.0 33 188.0 34 253.0 35 440.0 36 780.0 37 960.0 38 882.0 39 141.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.900000000000002 9.825000000000001 13.875000000000002 48.4 2 26.3 17.7 32.125 23.875 3 28.475 22.075 23.05 26.400000000000002 4 28.666281755196305 28.060046189376443 16.51270207852194 26.760969976905315 5 31.7 28.349999999999998 18.025 21.925 6 23.001753946379353 32.72362816336758 19.067902781257832 25.206715108995237 7 21.975 15.25 36.449999999999996 26.325 8 22.35 19.55 24.224999999999998 33.875 9 22.95 17.125 29.075 30.85 10-11 27.4125 27.3 18.575 26.7125 12-13 24.825 20.962500000000002 25.124999999999996 29.0875 14-15 25.55 23.3375 22.650000000000002 28.462500000000002 16-17 25.7 23.025000000000002 22.975 28.299999999999997 18-19 26.1125 22.5625 22.775000000000002 28.549999999999997 20-21 26.6125 22.85 23.8375 26.700000000000003 22-23 26.8375 23.3375 22.900000000000002 26.924999999999997 24-25 26.224999999999998 23.599999999999998 22.375 27.800000000000004 26-27 26.5375 23.7375 22.925 26.8 28-29 26.5625 22.8625 22.650000000000002 27.925 30-31 26.125 22.650000000000002 23.05 28.175 32-33 26.2625 23.8625 22.400000000000002 27.474999999999998 34-35 26.35 23.9375 21.837500000000002 27.875 36-37 26.55 22.7125 23.35 27.3875 38-39 25.95 23.875 23.150000000000002 27.025 40-41 26.174999999999997 23.200000000000003 22.662499999999998 27.962500000000002 42-43 26.237500000000004 22.9875 22.8625 27.9125 44-45 26.237500000000004 23.3875 22.925 27.450000000000003 46-47 26.674999999999997 23.4125 22.1375 27.775 48-49 26.700000000000003 23.0375 23.6875 26.575 50-51 26.7125 23.5 22.8375 26.950000000000003 52-53 27.4125 22.287499999999998 22.75 27.55 54-55 26.575 23.35 23.075000000000003 27.0 56-57 26.6625 23.7125 22.5875 27.037499999999998 58-59 27.900000000000002 22.975 22.375 26.75 60-61 27.450000000000003 23.6125 22.475 26.4625 62-63 27.3375 23.5375 21.8875 27.237499999999997 64-65 27.175 22.0 23.549999999999997 27.275 66-67 26.8125 23.1 22.4875 27.6 68-69 26.8625 23.275000000000002 23.3875 26.474999999999998 70-71 27.3 23.075000000000003 22.55 27.075 72-73 26.8125 23.575 22.8625 26.75 74-75 26.950000000000003 23.6375 22.7375 26.674999999999997 76-77 27.025 23.6125 22.275 27.0875 78-79 27.200000000000003 22.5125 22.662499999999998 27.625 80-81 27.8375 23.7125 22.275 26.174999999999997 82-83 27.712500000000002 22.412499999999998 22.7625 27.1125 84-85 27.212500000000002 22.525000000000002 22.675 27.5875 86-87 26.437500000000004 23.9125 22.8625 26.787499999999998 88-89 28.487499999999997 22.787499999999998 22.4625 26.2625 90-91 27.200000000000003 22.9375 23.6875 26.174999999999997 92-93 27.353419177397175 23.427928491061383 21.915239404925615 27.303412926615827 94-95 28.012500000000003 22.8125 22.287499999999998 26.887499999999996 96-97 27.3125 23.474999999999998 23.6875 25.525 98-99 27.9125 23.5125 22.675 25.900000000000002 100 28.95 21.925 22.25 26.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 3.5 29 3.0 30 1.0 31 2.0 32 4.5 33 13.5 34 18.5 35 20.0 36 28.0 37 39.0 38 52.0 39 65.0 40 82.0 41 103.0 42 109.0 43 113.5 44 142.0 45 157.5 46 150.5 47 146.5 48 141.5 49 129.0 50 124.5 51 122.0 52 110.5 53 104.0 54 94.5 55 83.0 56 90.5 57 104.0 58 111.0 59 106.0 60 104.5 61 115.0 62 121.5 63 119.0 64 115.0 65 114.5 66 101.0 67 95.5 68 91.0 69 78.0 70 68.5 71 58.5 72 50.0 73 41.5 74 40.5 75 33.0 76 22.0 77 19.0 78 13.0 79 6.5 80 2.5 81 3.5 82 5.5 83 3.5 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 13.4 5 0.0 6 0.22499999999999998 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.243761028485 98.425 2 0.6806150743634989 1.35 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618253 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618253_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2175 33.0 31.0 34.0 31.0 34.0 2 32.9485 34.0 31.0 34.0 31.0 34.0 3 33.0715 34.0 33.0 34.0 31.0 34.0 4 36.525 37.0 37.0 37.0 35.0 37.0 5 36.53675 37.0 37.0 37.0 35.0 37.0 6 36.499 37.0 37.0 37.0 35.0 37.0 7 36.529 37.0 37.0 37.0 35.0 37.0 8 36.5035 37.0 37.0 37.0 35.0 37.0 9 38.36075 39.0 39.0 39.0 37.0 39.0 10-11 38.378625 39.0 39.0 39.0 37.0 39.0 12-13 38.262 39.0 39.0 39.0 37.0 39.0 14-15 39.962999999999994 41.0 40.0 41.0 38.0 41.0 16-17 39.954 41.0 40.0 41.0 38.0 41.0 18-19 39.912125 41.0 40.0 41.0 38.0 41.0 20-21 39.846500000000006 41.0 40.0 41.0 38.0 41.0 22-23 39.734750000000005 41.0 40.0 41.0 37.5 41.0 24-25 39.654125 41.0 39.5 41.0 37.0 41.0 26-27 39.522999999999996 41.0 39.0 41.0 36.5 41.0 28-29 39.434875 41.0 39.0 41.0 36.0 41.0 30-31 39.303 41.0 39.0 41.0 36.0 41.0 32-33 39.342124999999996 41.0 39.0 41.0 36.0 41.0 34-35 39.153375 40.0 38.0 41.0 35.0 41.0 36-37 39.000625 40.0 38.0 41.0 35.0 41.0 38-39 38.830124999999995 40.0 38.0 41.0 35.0 41.0 40-41 38.51175 40.0 37.0 41.0 34.5 41.0 42-43 38.308125000000004 40.0 37.0 41.0 34.0 41.0 44-45 38.0275 40.0 36.0 41.0 33.0 41.0 46-47 37.695 39.0 35.0 41.0 33.0 41.0 48-49 37.625125 39.0 35.0 41.0 33.0 41.0 50-51 37.1305 38.5 35.0 40.5 32.5 41.0 52-53 37.172875000000005 38.5 35.0 40.5 33.0 41.0 54-55 37.320875 38.5 35.0 41.0 33.0 41.0 56-57 37.063874999999996 37.5 35.0 41.0 33.0 41.0 58-59 36.808375 37.0 35.0 40.5 33.0 41.0 60-61 36.592124999999996 36.0 35.0 40.0 33.0 41.0 62-63 36.398375 36.0 35.0 40.0 33.0 41.0 64-65 36.039 35.0 35.0 39.0 33.0 41.0 66-67 35.704499999999996 35.0 35.0 39.0 32.0 41.0 68-69 35.466750000000005 35.0 35.0 37.5 31.5 40.5 70-71 35.174499999999995 35.0 34.5 37.0 31.0 40.0 72-73 34.832875 35.0 34.0 36.5 31.0 39.0 74-75 34.526624999999996 35.0 34.0 36.0 31.0 39.0 76-77 34.232 35.0 34.0 36.0 30.5 37.5 78-79 33.9945 35.0 34.0 35.0 30.0 37.0 80-81 33.84225 35.0 34.0 35.0 30.0 37.0 82-83 33.736000000000004 35.0 33.5 35.0 30.0 36.0 84-85 33.44625 35.0 33.0 35.0 29.5 36.0 86-87 33.214 35.0 33.0 35.0 29.0 36.0 88-89 32.94125 35.0 33.0 35.0 29.0 35.0 90-91 32.85325 35.0 33.0 35.0 29.0 35.0 92-93 32.6065 35.0 33.0 35.0 27.5 35.0 94-95 32.33375 35.0 33.0 35.0 27.0 35.0 96-97 31.94225 35.0 32.0 35.0 26.5 35.0 98-99 31.670375 34.5 32.0 35.0 25.0 35.0 100 31.36225 34.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.19616929255483484 1101 2 0.1793327154772939 1101 3 0.2877664504170525 1101 4 0.0634589640613683 1101 5 0.05635361960663232 1101 6 -0.03223149006282 1101 7 0.027777777777778567 1101 8 0.0962825661620883 1101 9 0.020955617341158472 1101 10-11 0.15279064977860202 1101 12-13 -0.016836577077540937 1101 14-15 0.23872412727833847 1101 16-17 0.17272937905467955 1101 18-19 0.13225980846462448 1101 20-21 0.14577540932962307 1101 22-23 0.08522551745443252 1101 24-25 0.006667696426731595 1101 26-27 0.21891411801050253 1101 28-29 0.06201729996910643 1101 30-31 0.164053650499433 1101 32-33 0.011996704767788913 1101 34-35 -0.21724075790340436 1101 36-37 -0.13353413654618862 1101 38-39 -0.21663577386468802 1101 40-41 -0.2245391823705063 1101 42-43 -0.12555349603542254 1101 44-45 -0.15052517763361095 1101 46-47 -0.10159870250231506 1101 48-49 0.04036659458346037 1101 50-51 -0.1636417464730684 1101 52-53 -0.06159252394191839 1101 54-55 -0.27688960972093213 1101 56-57 -0.08401554937699984 1101 58-59 -9.010400576414668E-5 1101 60-61 -0.08908711770157396 1101 62-63 -0.26993872927608464 1101 64-65 -0.2540804242611472 1101 66-67 -0.4053135619400621 1101 68-69 -0.1663062506436006 1101 70-71 -0.17122335495829333 1101 72-73 -0.1414375450519998 1101 74-75 -0.013425496859227337 1101 76-77 -0.23522294305426783 1101 78-79 -0.2877664504170525 1101 80-81 -0.22000823808053127 1101 82-83 -0.2503861600247106 1101 84-85 -0.4243383791576534 1101 86-87 -0.22945628668519902 1101 88-89 -0.20711049325506536 1101 90-91 -0.3701858716918949 1101 92-93 -0.25621717639790376 1101 94-95 -0.2864921223354955 1101 96-97 -0.2922587787045572 1101 98-99 -0.2724873854391916 1101 100 -0.5981618782823581 1104 1 -0.1961692925548384 1104 2 -0.1793327154772939 1104 3 -0.2877664504170525 1104 4 -0.06345896406137541 1104 5 -0.05635361960663232 1104 6 0.032231490062812895 1104 7 -0.027777777777778567 1104 8 -0.0962825661620812 1104 9 -0.020955617341165578 1104 10-11 -0.15279064977860202 1104 12-13 0.016836577077540937 1104 14-15 -0.23872412727834558 1104 16-17 -0.17272937905467955 1104 18-19 -0.1322598084646316 1104 20-21 -0.14577540932963018 1104 22-23 -0.08522551745443252 1104 24-25 -0.006667696426738701 1104 26-27 -0.21891411801050253 1104 28-29 -0.06201729996911354 1104 30-31 -0.1640536504994401 1104 32-33 -0.011996704767781807 1104 34-35 0.21724075790341146 1104 36-37 0.13353413654618151 1104 38-39 0.21663577386468802 1104 40-41 0.2245391823705063 1104 42-43 0.12555349603542965 1104 44-45 0.15052517763361095 1104 46-47 0.10159870250231506 1104 48-49 -0.04036659458346037 1104 50-51 0.1636417464730684 1104 52-53 0.06159252394192549 1104 54-55 0.27688960972093213 1104 56-57 0.08401554937699984 1104 58-59 9.010400576414668E-5 1104 60-61 0.08908711770157396 1104 62-63 0.26993872927607754 1104 64-65 0.2540804242611472 1104 66-67 0.4053135619400692 1104 68-69 0.1663062506436006 1104 70-71 0.17122335495829333 1104 72-73 0.1414375450519998 1104 74-75 0.013425496859227337 1104 76-77 0.23522294305426783 1104 78-79 0.2877664504170525 1104 80-81 0.22000823808053127 1104 82-83 0.2503861600247106 1104 84-85 0.4243383791576534 1104 86-87 0.22945628668519902 1104 88-89 0.20711049325506536 1104 90-91 0.3701858716918949 1104 92-93 0.25621717639790376 1104 94-95 0.2864921223355026 1104 96-97 0.2922587787045643 1104 98-99 0.2724873854391916 1104 100 0.5981618782823617 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 1.0 27 9.0 28 27.0 29 53.0 30 66.0 31 87.0 32 111.0 33 170.0 34 249.0 35 475.0 36 727.0 37 945.0 38 920.0 39 160.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.975 9.075 14.099999999999998 47.85 2 26.200000000000003 16.900000000000002 32.275 24.625 3 26.674999999999997 21.4 23.3 28.625 4 29.125 26.950000000000003 16.575 27.35 5 31.324999999999996 27.900000000000002 18.2 22.575 6 23.375 32.175 18.55 25.900000000000002 7 21.65 13.875000000000002 38.4 26.075 8 22.675 18.525 25.3 33.5 9 23.849999999999998 18.35 26.875 30.925000000000004 10-11 28.226613306653327 25.975487743871934 18.234117058529264 27.56378189094547 12-13 24.6875 20.6625 26.1 28.549999999999997 14-15 25.7625 22.3375 24.1625 27.737499999999997 16-17 26.5125 22.4625 22.8625 28.1625 18-19 27.4125 22.925 21.975 27.6875 20-21 26.487500000000004 22.425 23.599999999999998 27.487499999999997 22-23 26.187500000000004 23.1125 23.025000000000002 27.675 24-25 27.462500000000002 22.7125 22.8625 26.9625 26-27 27.037499999999998 22.95 22.575 27.437499999999996 28-29 25.4625 23.3375 23.45 27.750000000000004 30-31 26.237500000000004 22.95 23.4625 27.35 32-33 25.9875 22.85 23.1875 27.975 34-35 26.3 23.1125 23.025000000000002 27.5625 36-37 26.474999999999998 22.775000000000002 22.975 27.775 38-39 25.837500000000002 23.65 22.95 27.5625 40-41 27.6625 23.05 22.162499999999998 27.125 42-43 26.5125 23.35 22.650000000000002 27.487499999999997 44-45 26.325 23.200000000000003 23.724999999999998 26.75 46-47 26.937499999999996 23.1125 22.537499999999998 27.4125 48-49 26.424999999999997 23.849999999999998 22.4875 27.237499999999997 50-51 26.85 23.0375 23.125 26.987499999999997 52-53 26.3625 23.0375 23.1875 27.4125 54-55 26.3 23.4625 22.175 28.0625 56-57 26.7125 22.9375 22.6125 27.737499999999997 58-59 27.287499999999998 22.925 22.8875 26.900000000000002 60-61 26.8375 22.8375 22.825 27.500000000000004 62-63 27.025 22.662499999999998 23.275000000000002 27.037499999999998 64-65 26.974999999999998 22.537499999999998 22.900000000000002 27.5875 66-67 26.687499999999996 23.4125 23.35 26.55 68-69 27.175 22.7375 23.1625 26.924999999999997 70-71 27.325 22.162499999999998 22.7 27.8125 72-73 26.487500000000004 23.275000000000002 23.150000000000002 27.0875 74-75 26.450000000000003 22.475 23.0 28.075 76-77 27.625 21.825 23.1 27.450000000000003 78-79 27.437499999999996 23.275000000000002 22.775000000000002 26.5125 80-81 27.5875 23.45 22.6 26.3625 82-83 27.474999999999998 22.875 22.662499999999998 26.987499999999997 84-85 26.724999999999998 23.0 23.2375 27.037499999999998 86-87 26.8625 23.075000000000003 23.0625 27.0 88-89 26.3 23.2875 23.125 27.287499999999998 90-91 26.55 23.025000000000002 23.1375 27.287499999999998 92-93 26.8375 22.575 23.3875 27.200000000000003 94-95 27.6125 23.175 22.8375 26.375 96-97 26.887499999999996 23.225 23.5 26.387500000000003 98-99 28.025 22.3875 22.6125 26.974999999999998 100 26.724999999999998 23.05 23.25 26.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.5 30 2.5 31 3.0 32 6.5 33 11.5 34 14.5 35 21.5 36 32.5 37 42.5 38 52.0 39 70.5 40 83.5 41 98.0 42 122.0 43 127.5 44 125.0 45 140.5 46 148.0 47 135.5 48 131.0 49 120.0 50 111.5 51 111.0 52 115.0 53 119.0 54 113.5 55 105.5 56 89.0 57 89.0 58 100.0 59 109.0 60 119.5 61 119.0 62 109.5 63 104.5 64 113.0 65 118.5 66 112.5 67 103.0 68 89.5 69 76.0 70 69.5 71 61.0 72 52.0 73 45.5 74 37.5 75 33.0 76 23.0 77 18.0 78 17.5 79 11.0 80 7.5 81 4.0 82 1.0 83 2.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.05 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8329126703685007 1.6500000000000001 3 0.025239777889954566 0.075 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0375 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra Read 570058 spots for SRR8618253.sra Written 570058 spots for SRR8618253.sra SRR ids: ['SRR8618253.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1lme0jbk SRR8618253.sra spots: 11401160 blocks: [[1, 570058], [570059, 1140116], [1140117, 1710174], [1710175, 2280232], [2280233, 2850290], [2850291, 3420348], [3420349, 3990406], [3990407, 4560464], [4560465, 5130522], [5130523, 5700580], [5700581, 6270638], [6270639, 6840696], [6840697, 7410754], [7410755, 7980812], [7980813, 8550870], [8550871, 9120928], [9120929, 9690986], [9690987, 10261044], [10261045, 10831102], [10831103, 11401160]] SRR8618253 file size 2967279 SRR8618253 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618253 SRR8618253_1.fastq SRR8618253_2.fastq Input file: SRR8618253_1.fastq Paired file: SRR8618253_2.fastq trimmed: SRR8618253-trimmed-pair1.fastq, SRR8618253-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:49:29 2024 >> started Sat Dec 7 10:49:39 2024 >> done (10.379s) 11401160 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11401160 (100.00%) read pairs available; of these: 1391197 (12.20%) trimmed read pairs available after processing 10009963 (87.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 7 0.00% 82 22 0.00% 83 74 0.00% 84 5234 0.05% 85 5416 0.05% 86 5952 0.05% 87 6665 0.06% 88 8055 0.07% 89 9782 0.09% 90 16388 0.14% 91 30207 0.26% 92 43345 0.38% 93 60238 0.53% 94 81312 0.71% 95 103442 0.91% 96 137184 1.20% 97 192618 1.69% 98 282298 2.48% 99 402958 3.53% 100 10009963 87.80% 11401160 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=33 prefix-density=0.41 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=32 fanout-score=25.75 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=7.2 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=2.2 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=34 fanout-score=24.16 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=7.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR8618253 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:50:25 Started mapping on | Dec 07 10:50:27 Finished on | Dec 07 10:50:52 Mapping speed, Million of reads per hour | 1641.77 Number of input reads | 11401160 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11204706 Uniquely mapped reads % | 98.28% Average mapped length | 198.46 Number of splices: Total | 6904507 Number of splices: Annotated (sjdb) | 6583816 Number of splices: GT/AG | 6814049 Number of splices: GC/AG | 79084 Number of splices: AT/AC | 1996 Number of splices: Non-canonical | 9378 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 90306 % of reads mapped to multiple loci | 0.79% Number of reads mapped to too many loci | 5540 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 106148 106148 106148 N_multimapping 90306 90306 90306 N_noFeature 251243 5594161 5670145 N_ambiguous 230880 19885 20567 UnstrandedReadsAssigned:10722583 PositiveStrandReadsAssigned:5590660 NegativeStrandReadsAssigned:5513994 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618253 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618253-trimmed-pair1.fastq SRR8618253-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,401,160 reads, 10,962,946 reads pseudoaligned [quant] estimated average fragment length: 165.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52973 SRR8618253.ke.tsv 35125 SRR8618253.se.tsv 88098 total ==> SRR8618253.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.88 0 0 PNS24247 1044 879.72 12.9098 1.84572 PNS24249 1928 1763.72 60.2115 4.29379 PNS24246 1044 879.72 12.9098 1.84572 PNS24248 1044 879.72 12.9098 1.84572 PNS24244 1471 1306.72 12.0592 1.16072 PNS24243 293 135.885 6 5.55355 KQK14069 1603 1438.72 2423.8 211.89 KQK14071 474 311.145 160.434 64.8524 ==> SRR8618253.se.tsv <== BRADI_1g14170v3 2764 BRADI_1g53295v3 18 BRADI_1g59795v3 182 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 83 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 120 BRADI_1g48960v3 0 SRR8618253 completed mapping pipeline successfully