Starting /dee2/code/volunteer_pipeline.sh SRR8618254 current disk space = 1543355953152 free memory = 1598698196 SRR8618254 SRAfilesize f6431d7295a4f9a4f109c9da15da243c SRR8618254.sra SRR8618254.sra file validated SRR8618254 is paired end SRR8618254 is conventional basespace SRR8618254 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618254_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11375 34.0 33.0 34.0 31.0 34.0 2 33.28625 34.0 34.0 34.0 31.0 34.0 3 33.32525 34.0 34.0 34.0 31.0 34.0 4 32.0595 37.0 37.0 37.0 2.0 37.0 5 34.232 37.0 35.0 37.0 19.0 37.0 6 35.878 37.0 36.0 37.0 32.0 37.0 7 36.2695 37.0 35.0 37.0 35.0 37.0 8 36.4135 37.0 37.0 37.0 35.0 37.0 9 38.455 39.0 39.0 39.0 37.0 39.0 10-11 38.446124999999995 39.0 39.0 39.0 37.0 39.0 12-13 38.459 39.0 39.0 39.0 37.0 39.0 14-15 39.991249999999994 41.0 40.0 41.0 38.0 41.0 16-17 39.968 41.0 40.0 41.0 38.0 41.0 18-19 39.943 41.0 40.0 41.0 38.0 41.0 20-21 39.868375 41.0 40.0 41.0 38.0 41.0 22-23 39.8365 41.0 40.0 41.0 38.0 41.0 24-25 39.68275 41.0 39.5 41.0 37.0 41.0 26-27 39.545125 41.0 39.0 41.0 36.5 41.0 28-29 39.3155 40.0 39.0 41.0 36.0 41.0 30-31 39.138625 40.0 38.5 41.0 35.5 41.0 32-33 39.091375 40.0 38.0 41.0 35.0 41.0 34-35 39.127125 40.0 39.0 41.0 35.0 41.0 36-37 39.250375000000005 41.0 39.0 41.0 35.0 41.0 38-39 39.129625 40.5 38.0 41.0 35.0 41.0 40-41 38.9745 40.0 38.0 41.0 35.0 41.0 42-43 38.710499999999996 40.0 37.0 41.0 35.0 41.0 44-45 38.4905 40.0 37.0 41.0 35.0 41.0 46-47 38.232 40.0 35.5 41.0 34.5 41.0 48-49 37.948875 39.0 35.0 41.0 34.0 41.0 50-51 37.749 39.0 35.0 41.0 34.0 41.0 52-53 37.50175 39.0 35.0 41.0 33.5 41.0 54-55 37.226749999999996 38.0 35.0 41.0 33.0 41.0 56-57 36.918875 37.0 35.0 40.5 33.0 41.0 58-59 36.639624999999995 36.5 35.0 40.0 33.0 41.0 60-61 36.362 36.0 35.0 40.0 33.0 41.0 62-63 36.142875000000004 35.0 35.0 39.5 32.5 41.0 64-65 35.935125 35.0 35.0 39.0 32.5 41.0 66-67 35.509 35.0 34.0 38.5 31.5 41.0 68-69 35.34725 35.0 34.0 37.5 31.5 40.0 70-71 35.0075 35.0 34.0 37.0 31.0 39.5 72-73 34.66025 35.0 34.0 36.5 31.0 39.0 74-75 34.465 35.0 34.0 36.0 31.0 38.5 76-77 33.555375 34.5 32.5 35.0 29.5 37.0 78-79 33.896625 35.0 33.0 35.0 30.0 37.0 80-81 33.85525 35.0 33.5 35.0 30.0 36.5 82-83 33.5905 35.0 33.0 35.0 30.0 36.0 84-85 33.312625 35.0 33.0 35.0 29.0 36.0 86-87 33.212875 35.0 33.0 35.0 29.0 35.5 88-89 33.053875000000005 35.0 33.0 35.0 29.0 35.0 90-91 32.7465 35.0 33.0 35.0 29.0 35.0 92-93 32.462625 35.0 33.0 35.0 27.0 35.0 94-95 32.197625 35.0 33.0 35.0 27.0 35.0 96-97 31.8625 35.0 32.5 35.0 27.0 35.0 98-99 31.578 35.0 32.0 35.0 25.0 35.0 100 31.14275 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 0.10598545398472936 1101 2 0.03960319703939774 1101 3 0.057670067590144924 1101 4 -5.889953997584232 1101 5 -2.9681452545552673 1101 6 -0.7265683225823025 1101 7 -0.18809591118192515 1101 8 -0.12537585772660265 1101 9 0.0060651229729415945 1101 10-11 0.01649276554187651 1101 12-13 0.04009791575646915 1101 14-15 0.16090565649816568 1101 16-17 0.07120737066639293 1101 18-19 0.027922695381768392 1101 20-21 0.24293258975610854 1101 22-23 0.1498419470072747 1101 24-25 -0.010132096322372774 1101 26-27 0.16994551669193925 1101 28-29 0.2611215337565156 1101 30-31 0.03614659093829431 1101 32-33 -0.01347305389221276 1101 34-35 -0.09137518953509272 1101 36-37 -0.050069389118753804 1101 38-39 -0.029027781347174653 1101 40-41 0.12745110637094825 1101 42-43 0.023547325948960918 1101 44-45 0.011352830819042481 1101 46-47 -0.08309346971292797 1101 48-49 -0.10086479401712012 1101 50-51 0.13485903729022652 1101 52-53 0.06178201536840078 1101 54-55 -0.03810619105137647 1101 56-57 -0.13270668962503862 1101 58-59 0.013299581095317592 1101 60-61 -0.046824805324973795 1101 62-63 -0.04165274601012925 1101 64-65 0.013877823751634821 1101 66-67 -0.2522037470124161 1101 68-69 -0.0685795790393442 1101 70-71 -0.13496183598468292 1101 72-73 -0.10146231142864082 1101 74-75 -0.20266762612114775 1101 76-77 -0.18093855208038434 1101 78-79 -0.36544935879314266 1101 80-81 -0.21664182364883544 1101 82-83 -0.37101976304901285 1101 84-85 -0.2521844722572055 1101 86-87 -0.2598301251574071 1101 88-89 -0.308858677494797 1101 90-91 -0.4229716532599994 1101 92-93 -0.36107398936033164 1101 94-95 -0.2375292333787371 1101 96-97 -0.3353678908277864 1101 98-99 0.0364806866952776 1101 100 -0.0992007401506001 1103 1 -0.10598545398473647 1103 2 -0.03960319703939774 1103 3 -0.05767006759013782 1103 4 5.889953997584229 1103 5 2.9681452545552673 1103 6 0.7265683225823025 1103 7 0.18809591118192515 1103 8 0.12537585772660975 1103 9 -0.006065122972934489 1103 10-11 -0.01649276554187651 1103 12-13 -0.04009791575646915 1103 14-15 -0.16090565649815858 1103 16-17 -0.07120737066639293 1103 18-19 -0.027922695381768392 1103 20-21 -0.24293258975611565 1103 22-23 -0.1498419470072747 1103 24-25 0.01013209632237988 1103 26-27 -0.16994551669193925 1103 28-29 -0.2611215337565227 1103 30-31 -0.03614659093829431 1103 32-33 0.01347305389221276 1103 34-35 0.09137518953509272 1103 36-37 0.05006938911876091 1103 38-39 0.029027781347174653 1103 40-41 -0.12745110637094825 1103 42-43 -0.023547325948960918 1103 44-45 -0.011352830819049586 1103 46-47 0.08309346971293508 1103 48-49 0.10086479401712012 1103 50-51 -0.13485903729022652 1103 52-53 -0.06178201536840788 1103 54-55 0.03810619105137647 1103 56-57 0.13270668962504573 1103 58-59 -0.013299581095324697 1103 60-61 0.046824805324973795 1103 62-63 0.04165274601012925 1103 64-65 -0.013877823751634821 1103 66-67 0.252203747012409 1103 68-69 0.0685795790393442 1103 70-71 0.13496183598468292 1103 72-73 0.10146231142864082 1103 74-75 0.20266762612114775 1103 76-77 0.18093855208039145 1103 78-79 0.36544935879314266 1103 80-81 0.21664182364884255 1103 82-83 0.37101976304901285 1103 84-85 0.2521844722572055 1103 86-87 0.2598301251574142 1103 88-89 0.308858677494797 1103 90-91 0.4229716532599994 1103 92-93 0.3610739893603352 1103 94-95 0.2375292333787371 1103 96-97 0.33536789082778995 1103 98-99 -0.03648068669528115 1103 100 0.0992007401506001 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 10.0 28 32.0 29 40.0 30 67.0 31 85.0 32 111.0 33 174.0 34 270.0 35 461.0 36 798.0 37 965.0 38 846.0 39 139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.75 10.475 14.625 45.15 2 26.174999999999997 16.825000000000003 30.7 26.3 3 28.65 20.1 23.325000000000003 27.925 4 31.181556195965417 26.39769452449568 16.42651296829971 25.994236311239195 5 29.725 28.225 19.575 22.475 6 24.524524524524523 31.48148148148148 19.61961961961962 24.374374374374376 7 21.775 13.4 37.775 27.05 8 22.975 19.775000000000002 24.175 33.074999999999996 9 23.849999999999998 18.2 28.325 29.625 10-11 27.6 26.275 19.2 26.924999999999997 12-13 25.0625 21.55 25.2375 28.15 14-15 26.275 22.1375 23.8375 27.750000000000004 16-17 26.6625 23.125 21.85 28.3625 18-19 26.0375 23.1 22.6125 28.249999999999996 20-21 27.3 23.1 22.275 27.325 22-23 27.200000000000003 23.4375 21.525 27.8375 24-25 26.5625 23.6375 22.75 27.05 26-27 26.8375 23.275000000000002 22.7 27.187499999999996 28-29 27.0625 22.8875 22.4625 27.5875 30-31 26.1625 23.849999999999998 22.0 27.987499999999997 32-33 27.075 22.325 23.125 27.474999999999998 34-35 26.174999999999997 23.575 22.3875 27.8625 36-37 27.1375 23.1625 21.825 27.875 38-39 26.5125 22.825 22.7625 27.900000000000002 40-41 27.0625 22.175 22.875 27.8875 42-43 26.05 22.787499999999998 23.4125 27.750000000000004 44-45 26.6 22.8625 22.9375 27.6 46-47 26.887499999999996 22.412499999999998 23.0 27.700000000000003 48-49 27.0875 22.3625 22.412499999999998 28.1375 50-51 25.95 22.55 23.2375 28.262500000000003 52-53 27.3 22.537499999999998 22.025 28.1375 54-55 25.275 22.85 22.4625 29.4125 56-57 27.237499999999997 22.2125 22.900000000000002 27.650000000000002 58-59 27.762500000000003 22.35 22.575 27.3125 60-61 27.6125 23.0375 21.2625 28.0875 62-63 26.337500000000002 22.537499999999998 22.9875 28.1375 64-65 27.0 22.4375 22.8875 27.675 66-67 26.887499999999996 22.775000000000002 23.425 26.9125 68-69 26.9625 23.575 22.55 26.9125 70-71 26.875 23.4875 22.025 27.6125 72-73 26.200000000000003 22.6375 22.625 28.537499999999998 74-75 27.525 22.912499999999998 22.425 27.1375 76-77 27.575 22.2 22.7375 27.487499999999997 78-79 26.5625 22.875 23.1125 27.450000000000003 80-81 28.000000000000004 22.825 22.275 26.900000000000002 82-83 26.775 22.9625 22.725 27.537499999999998 84-85 27.675 22.05 22.650000000000002 27.625 86-87 26.937499999999996 23.1375 22.925 27.0 88-89 27.712500000000002 21.55 22.912499999999998 27.825 90-91 27.1125 22.7125 22.9375 27.237499999999997 92-93 27.8625 22.85 22.475 26.8125 94-95 27.375 22.55 22.125 27.950000000000003 96-97 26.6125 23.6375 22.3375 27.4125 98-99 28.037499999999998 22.75 22.725 26.487500000000004 100 27.55 22.175 22.525000000000002 27.750000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.5 30 2.0 31 2.0 32 4.0 33 10.0 34 13.0 35 18.0 36 28.0 37 39.0 38 49.0 39 55.0 40 74.0 41 113.5 42 126.0 43 121.0 44 137.5 45 139.5 46 135.5 47 130.5 48 130.0 49 130.5 50 112.5 51 118.0 52 117.0 53 99.0 54 95.0 55 96.0 56 93.0 57 98.5 58 111.0 59 119.0 60 122.5 61 116.5 62 114.0 63 116.5 64 107.5 65 96.0 66 106.5 67 102.5 68 78.5 69 81.0 70 80.0 71 64.0 72 60.5 73 48.0 74 41.5 75 44.0 76 35.5 77 24.0 78 13.5 79 10.5 80 8.0 81 4.5 82 3.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 13.25 5 0.0 6 0.1 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618254 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618254_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09725 34.0 31.0 34.0 30.0 34.0 2 32.91775 34.0 33.0 34.0 31.0 34.0 3 33.031 34.0 33.0 34.0 31.0 34.0 4 36.5295 37.0 37.0 37.0 35.0 37.0 5 36.4915 37.0 37.0 37.0 35.0 37.0 6 36.491 37.0 37.0 37.0 35.0 37.0 7 36.4735 37.0 37.0 37.0 35.0 37.0 8 36.49075 37.0 37.0 37.0 35.0 37.0 9 38.39725 39.0 39.0 39.0 37.0 39.0 10-11 38.331875 39.0 39.0 39.0 37.0 39.0 12-13 38.309124999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.965625 41.0 40.0 41.0 38.0 41.0 16-17 39.877624999999995 41.0 40.0 41.0 38.0 41.0 18-19 39.90575 41.0 40.0 41.0 38.0 41.0 20-21 39.874375 41.0 40.0 41.0 38.0 41.0 22-23 39.748625000000004 41.0 40.0 41.0 37.5 41.0 24-25 39.598 41.0 40.0 41.0 37.0 41.0 26-27 39.504999999999995 41.0 39.0 41.0 36.5 41.0 28-29 39.418375 41.0 39.0 41.0 36.5 41.0 30-31 39.305625 40.5 39.0 41.0 36.0 41.0 32-33 39.2695 40.5 39.0 41.0 35.0 41.0 34-35 39.11625 40.0 38.0 41.0 35.0 41.0 36-37 38.933499999999995 40.0 38.0 41.0 35.0 41.0 38-39 38.752625 40.0 38.0 41.0 35.0 41.0 40-41 38.4345 40.0 37.0 41.0 34.0 41.0 42-43 38.311875 40.0 36.5 41.0 34.0 41.0 44-45 38.015375000000006 40.0 35.5 41.0 33.5 41.0 46-47 37.73075 39.0 35.0 41.0 33.0 41.0 48-49 37.54375 39.0 35.0 41.0 33.0 41.0 50-51 37.045125 38.5 34.5 40.5 32.5 40.5 52-53 37.135999999999996 38.0 35.0 40.0 33.0 41.0 54-55 37.2415 38.0 35.0 41.0 33.0 41.0 56-57 37.02525 37.0 35.0 41.0 33.0 41.0 58-59 36.745875 37.0 35.0 40.0 33.0 41.0 60-61 36.513000000000005 36.0 35.0 40.0 33.0 41.0 62-63 36.328500000000005 35.5 35.0 39.5 33.0 41.0 64-65 36.06575 35.0 35.0 39.0 32.5 41.0 66-67 35.775875 35.0 35.0 39.0 32.0 41.0 68-69 35.4935 35.0 35.0 37.5 32.0 40.5 70-71 35.133375 35.0 34.5 37.0 31.5 39.5 72-73 34.824375 35.0 34.0 36.5 31.0 39.0 74-75 34.56675 35.0 34.0 36.0 31.0 39.0 76-77 34.35025 35.0 34.0 36.0 31.0 37.5 78-79 34.0695 35.0 34.0 35.0 30.0 37.0 80-81 33.79325 35.0 33.5 35.0 30.0 37.0 82-83 33.594125 35.0 33.0 35.0 29.5 36.0 84-85 33.301625 35.0 33.0 35.0 29.0 36.0 86-87 33.10275 35.0 33.0 35.0 29.0 35.5 88-89 33.02575 35.0 33.0 35.0 29.0 35.0 90-91 32.77675 35.0 33.0 35.0 28.5 35.0 92-93 32.417875 35.0 33.0 35.0 27.0 35.0 94-95 32.26175 35.0 33.0 35.0 27.0 35.0 96-97 31.891875 35.0 32.5 35.0 26.0 35.0 98-99 31.344 34.0 32.0 35.0 25.0 35.0 100 30.9405 34.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.13042584359178733 1101 2 0.21687954562976586 1101 3 0.16167664670658866 1101 4 0.08086402302691198 1101 5 0.03410346688596633 1101 6 0.047929891290380056 1101 7 0.10187350620647351 1101 8 0.1721364138675483 1101 9 0.027922695381768392 1101 10-11 0.10724473799182732 1101 12-13 0.0299722443524999 1101 14-15 0.004587391740130897 1101 16-17 0.06281000231297185 1101 18-19 0.17838143455578148 1101 20-21 0.12348693171597347 1101 22-23 0.2675593019968616 1101 24-25 0.11319421243350547 1101 26-27 0.052716455501013115 1101 28-29 0.1688725553185506 1101 30-31 0.20636837912158512 1101 32-33 0.14860836267379085 1101 34-35 0.3042648608362697 1101 36-37 0.30542134614890415 1101 38-39 0.3855722032330178 1101 40-41 0.25947032972681683 1101 42-43 0.3809591118192799 1101 44-45 0.26248361645806995 1101 46-47 0.3318598853794512 1101 48-49 0.3085181568194102 1101 50-51 0.17266325717663733 1101 52-53 0.3852895068232698 1101 54-55 0.35943563516742927 1101 56-57 0.11523733648582635 1101 58-59 0.37685358895942045 1101 60-61 0.12380817763614971 1101 62-63 0.08601680758654595 1101 64-65 0.10047929891290153 1101 66-67 0.25431754516717575 1101 68-69 0.09646372491069855 1101 70-71 -0.08209118244198521 1101 72-73 0.011063709490890972 1101 74-75 0.19022898409190248 1101 76-77 0.10700059109249338 1101 78-79 0.13915088278378818 1101 80-81 0.19281180129011943 1101 82-83 0.07260800287836133 1101 84-85 0.03026136568065141 1101 86-87 0.21179101025416713 1101 88-89 0.16866695792963782 1101 90-91 0.3599560535581219 1101 92-93 0.24817532317339897 1101 94-95 0.10802857803706445 1101 96-97 0.2118359846829918 1101 98-99 -0.029323327593740345 1101 100 0.2290097915756455 1103 1 -0.13042584359178733 1103 2 -0.21687954562977296 1103 3 -0.16167664670658155 1103 4 -0.08086402302690487 1103 5 -0.03410346688597343 1103 6 -0.047929891290380056 1103 7 -0.1018735062064664 1103 8 -0.1721364138675412 1103 9 -0.027922695381768392 1103 10-11 -0.10724473799182732 1103 12-13 -0.029972244352492794 1103 14-15 -0.004587391740123792 1103 16-17 -0.06281000231297185 1103 18-19 -0.17838143455578148 1103 20-21 -0.12348693171596636 1103 22-23 -0.2675593019968687 1103 24-25 -0.11319421243349836 1103 26-27 -0.052716455501013115 1103 28-29 -0.1688725553185506 1103 30-31 -0.20636837912158512 1103 32-33 -0.14860836267379796 1103 34-35 -0.3042648608362697 1103 36-37 -0.30542134614890415 1103 38-39 -0.3855722032330178 1103 40-41 -0.2594703297268097 1103 42-43 -0.3809591118192799 1103 44-45 -0.26248361645806995 1103 46-47 -0.3318598853794512 1103 48-49 -0.3085181568194102 1103 50-51 -0.17266325717663733 1103 52-53 -0.3852895068232627 1103 54-55 -0.3594356351674364 1103 56-57 -0.11523733648582635 1103 58-59 -0.37685358895942755 1103 60-61 -0.12380817763614971 1103 62-63 -0.08601680758654595 1103 64-65 -0.10047929891290153 1103 66-67 -0.25431754516717575 1103 68-69 -0.09646372491069144 1103 70-71 0.0820911824419781 1103 72-73 -0.011063709490883866 1103 74-75 -0.19022898409190248 1103 76-77 -0.10700059109249338 1103 78-79 -0.13915088278378818 1103 80-81 -0.19281180129012654 1103 82-83 -0.07260800287836133 1103 84-85 -0.030261365680658514 1103 86-87 -0.21179101025417424 1103 88-89 -0.1686669579296307 1103 90-91 -0.3599560535581148 1103 92-93 -0.24817532317339186 1103 94-95 -0.10802857803705734 1103 96-97 -0.2118359846829989 1103 98-99 0.029323327593740345 1103 100 -0.22900979157564905 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 22.0 28 27.0 29 48.0 30 64.0 31 81.0 32 111.0 33 181.0 34 265.0 35 469.0 36 749.0 37 916.0 38 919.0 39 145.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.950000000000003 9.5 14.025000000000002 48.525 2 27.875 17.45 30.049999999999997 24.625 3 27.474999999999998 22.275 22.55 27.700000000000003 4 30.575000000000003 25.95 15.1 28.375 5 30.575000000000003 28.325 19.45 21.65 6 23.25 31.424999999999997 20.175 25.15 7 21.725 14.799999999999999 36.325 27.150000000000002 8 23.325000000000003 19.400000000000002 24.525 32.75 9 23.65 18.675 27.800000000000004 29.875 10-11 27.60690172543136 26.60665166291573 18.079519879969993 27.70692673168292 12-13 25.2 20.7 25.224999999999998 28.875 14-15 25.35 23.1 24.1375 27.4125 16-17 27.187499999999996 22.5125 22.3 28.000000000000004 18-19 27.462500000000002 22.9625 21.5 28.075 20-21 27.0875 22.85 22.8 27.2625 22-23 27.3625 23.3125 21.4875 27.8375 24-25 27.462500000000002 22.975 21.4375 28.125 26-27 26.187500000000004 23.1125 22.8875 27.8125 28-29 27.1125 23.3875 21.4375 28.0625 30-31 26.5125 23.025000000000002 22.0625 28.4 32-33 26.75 23.599999999999998 22.8875 26.7625 34-35 26.424999999999997 22.325 23.1125 28.1375 36-37 27.575 22.125 22.6875 27.6125 38-39 26.6625 23.425 22.5625 27.35 40-41 28.012500000000003 22.5875 22.3375 27.0625 42-43 27.125 22.537499999999998 22.3125 28.025 44-45 26.450000000000003 23.3375 22.825 27.3875 46-47 27.6125 23.5625 21.7875 27.037499999999998 48-49 26.825 22.55 22.237499999999997 28.3875 50-51 26.9125 23.200000000000003 23.200000000000003 26.687499999999996 52-53 26.987499999999997 22.525000000000002 22.825 27.6625 54-55 26.6625 22.900000000000002 22.3625 28.075 56-57 27.8875 22.875 23.0125 26.224999999999998 58-59 27.537499999999998 22.537499999999998 23.150000000000002 26.775 60-61 27.325 23.1375 22.3375 27.200000000000003 62-63 26.5375 23.4875 23.0125 26.9625 64-65 26.6625 22.8125 22.4375 28.0875 66-67 26.25 23.0 23.2125 27.537499999999998 68-69 27.250000000000004 22.6875 23.2125 26.85 70-71 27.725 23.1125 22.15 27.0125 72-73 27.900000000000002 23.275000000000002 22.1875 26.637499999999996 74-75 27.962500000000002 22.4625 22.7 26.875 76-77 27.825 22.25 22.225 27.700000000000003 78-79 26.950000000000003 22.6875 22.85 27.5125 80-81 28.462500000000002 22.8875 21.987499999999997 26.6625 82-83 28.012500000000003 22.1875 22.775000000000002 27.025 84-85 27.3625 22.8375 22.975 26.825 86-87 27.437499999999996 22.9625 22.925 26.674999999999997 88-89 27.650000000000002 22.787499999999998 22.237499999999997 27.325 90-91 27.5875 22.75 21.975 27.6875 92-93 27.525 23.1375 22.75 26.5875 94-95 28.249999999999996 22.1 22.5125 27.1375 96-97 28.349999999999998 22.625 22.6375 26.387500000000003 98-99 27.3375 23.6125 21.837500000000002 27.212500000000002 100 28.475 22.6 21.925 27.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.0 28 0.5 29 0.5 30 0.5 31 2.5 32 5.5 33 11.0 34 17.0 35 22.5 36 27.0 37 35.0 38 47.5 39 67.5 40 88.5 41 99.0 42 110.0 43 119.0 44 127.0 45 127.5 46 125.0 47 130.5 48 138.5 49 143.0 50 130.0 51 121.0 52 106.0 53 95.0 54 97.5 55 94.5 56 94.0 57 105.5 58 119.5 59 112.5 60 100.5 61 93.0 62 104.0 63 106.0 64 106.0 65 106.0 66 106.5 67 112.0 68 102.0 69 84.5 70 72.5 71 71.0 72 63.5 73 55.5 74 44.0 75 36.0 76 31.5 77 26.5 78 22.0 79 16.0 80 9.5 81 4.0 82 1.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06612821807168 98.125 2 0.9086320040383644 1.7999999999999998 3 0.025239777889954566 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0125 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.1375 0.0 0.0 0.0 0.025 88 0.15 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561517 spots for SRR8618254.sra Written 561517 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra Read 561505 spots for SRR8618254.sra Written 561505 spots for SRR8618254.sra SRR ids: ['SRR8618254.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dmubsdsq SRR8618254.sra spots: 11230112 blocks: [[1, 561505], [561506, 1123010], [1123011, 1684515], [1684516, 2246020], [2246021, 2807525], [2807526, 3369030], [3369031, 3930535], [3930536, 4492040], [4492041, 5053545], [5053546, 5615050], [5615051, 6176555], [6176556, 6738060], [6738061, 7299565], [7299566, 7861070], [7861071, 8422575], [8422576, 8984080], [8984081, 9545585], [9545586, 10107090], [10107091, 10668595], [10668596, 11230112]] SRR8618254 file size 2922598 SRR8618254 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618254 SRR8618254_1.fastq SRR8618254_2.fastq Input file: SRR8618254_1.fastq Paired file: SRR8618254_2.fastq trimmed: SRR8618254-trimmed-pair1.fastq, SRR8618254-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:55:48 2024 >> started Sat Dec 7 10:55:58 2024 >> done (10.065s) 11230112 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11230112 (100.00%) read pairs available; of these: 1420711 (12.65%) trimmed read pairs available after processing 9809401 (87.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 66 1 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 0 0.00% 78 1 0.00% 79 0 0.00% 80 0 0.00% 81 8 0.00% 82 19 0.00% 83 89 0.00% 84 4836 0.04% 85 5313 0.05% 86 5437 0.05% 87 6142 0.05% 88 7395 0.07% 89 9280 0.08% 90 15964 0.14% 91 30519 0.27% 92 44151 0.39% 93 62038 0.55% 94 83718 0.75% 95 106413 0.95% 96 140104 1.25% 97 197207 1.76% 98 288327 2.57% 99 413749 3.68% 100 9809401 87.35% 11230112 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=28 prefix-density=0.35 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=34 fanout-score=24.41 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=7.5 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=28 prefix-density=0.34 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=30 fanout-score=21.52 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=7.1 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR8618254 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:56:27 Started mapping on | Dec 07 10:56:27 Finished on | Dec 07 10:56:52 Mapping speed, Million of reads per hour | 1617.14 Number of input reads | 11230112 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11034656 Uniquely mapped reads % | 98.26% Average mapped length | 198.44 Number of splices: Total | 6828683 Number of splices: Annotated (sjdb) | 6519249 Number of splices: GT/AG | 6736679 Number of splices: GC/AG | 80543 Number of splices: AT/AC | 2116 Number of splices: Non-canonical | 9345 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 90649 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 5443 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.69% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104807 104807 104807 N_multimapping 90649 90649 90649 N_noFeature 224035 5509236 5566408 N_ambiguous 222630 19441 21030 UnstrandedReadsAssigned:10587991 PositiveStrandReadsAssigned:5505979 NegativeStrandReadsAssigned:5447218 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618254 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618254-trimmed-pair1.fastq SRR8618254-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,230,112 reads, 10,829,501 reads pseudoaligned [quant] estimated average fragment length: 166.511 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52973 SRR8618254.ke.tsv 35125 SRR8618254.se.tsv 88098 total ==> SRR8618254.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.651 0 0 PNS24247 1044 878.489 13.426 1.93306 PNS24249 1928 1762.49 57.9409 4.15809 PNS24246 1044 878.489 13.426 1.93306 PNS24248 1044 878.489 13.426 1.93306 PNS24244 1471 1305.49 4.78114 0.463227 PNS24243 293 134.273 11 10.3619 KQK14069 1603 1437.49 1256.62 110.57 KQK14071 474 309.73 108.826 44.4411 ==> SRR8618254.se.tsv <== BRADI_1g14170v3 1431 BRADI_1g53295v3 16 BRADI_1g59795v3 151 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 158 BRADI_1g74790v3 56 BRADI_1g09890v3 0 BRADI_1g77505v3 148 BRADI_1g48960v3 0 SRR8618254 completed mapping pipeline successfully