Starting /dee2/code/volunteer_pipeline.sh SRR8618255 current disk space = 1543374143488 free memory = 1606119508 SRR8618255 SRAfilesize c86f2f01e706382c38ea2e64e17368c3 SRR8618255.sra SRR8618255.sra file validated SRR8618255 is paired end SRR8618255 is conventional basespace SRR8618255 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618255_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1435 34.0 33.0 34.0 31.0 34.0 2 33.32125 34.0 34.0 34.0 31.0 34.0 3 33.38475 34.0 34.0 34.0 31.0 34.0 4 32.82 37.0 37.0 37.0 2.0 37.0 5 34.70325 37.0 37.0 37.0 19.0 37.0 6 35.9485 37.0 37.0 37.0 32.0 37.0 7 36.29825 37.0 37.0 37.0 35.0 37.0 8 36.4865 37.0 37.0 37.0 35.0 37.0 9 38.481 39.0 39.0 39.0 37.0 39.0 10-11 38.497749999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.507125 39.0 39.0 39.0 37.0 39.0 14-15 40.08475 41.0 40.0 41.0 38.0 41.0 16-17 40.0625 41.0 40.0 41.0 38.0 41.0 18-19 39.96125 41.0 40.0 41.0 38.0 41.0 20-21 39.902375000000006 41.0 40.0 41.0 38.0 41.0 22-23 39.8625 41.0 40.0 41.0 38.0 41.0 24-25 39.780625 41.0 40.0 41.0 37.5 41.0 26-27 39.647625 41.0 40.0 41.0 37.0 41.0 28-29 39.45725 41.0 39.0 41.0 36.0 41.0 30-31 39.266999999999996 40.0 39.0 41.0 36.0 41.0 32-33 39.228750000000005 40.0 39.0 41.0 35.5 41.0 34-35 39.330625 41.0 39.0 41.0 35.0 41.0 36-37 39.303749999999994 41.0 38.5 41.0 35.0 41.0 38-39 39.120625 41.0 38.0 41.0 35.0 41.0 40-41 39.027625 41.0 38.0 41.0 35.0 41.0 42-43 38.77075 40.0 37.0 41.0 35.0 41.0 44-45 38.551874999999995 40.0 37.0 41.0 35.0 41.0 46-47 38.307625 40.0 36.0 41.0 35.0 41.0 48-49 37.952875000000006 39.0 35.0 41.0 34.0 41.0 50-51 37.728625 39.0 35.0 41.0 34.0 41.0 52-53 37.464875 38.5 35.0 41.0 33.5 41.0 54-55 37.132999999999996 37.5 35.0 41.0 33.0 41.0 56-57 36.880375 37.0 35.0 40.5 33.0 41.0 58-59 36.61275 36.0 35.0 40.0 33.0 41.0 60-61 36.304125 35.5 35.0 40.0 33.0 41.0 62-63 35.995125 35.0 35.0 39.0 33.0 41.0 64-65 35.77975 35.0 35.0 39.0 32.5 41.0 66-67 35.423500000000004 35.0 35.0 38.0 32.0 40.5 68-69 35.23125 35.0 34.5 37.0 31.5 40.0 70-71 34.92475 35.0 34.0 36.5 31.0 39.0 72-73 34.528875 35.0 34.0 36.0 31.0 39.0 74-75 34.325125 35.0 34.0 35.5 30.5 38.5 76-77 33.521 34.5 32.5 35.0 29.5 37.0 78-79 34.014375 35.0 33.5 35.0 30.5 37.0 80-81 33.909375 35.0 34.0 35.0 31.0 36.5 82-83 33.724625 35.0 34.0 35.0 30.0 36.0 84-85 33.456875 35.0 33.0 35.0 29.5 36.0 86-87 33.312125 35.0 33.0 35.0 29.5 35.0 88-89 33.141375 35.0 33.0 35.0 29.0 35.0 90-91 32.9585 35.0 33.0 35.0 29.0 35.0 92-93 32.78375 35.0 33.0 35.0 29.0 35.0 94-95 32.615375 35.0 33.0 35.0 29.0 35.0 96-97 32.33475 35.0 33.0 35.0 27.0 35.0 98-99 32.03625 35.0 33.0 35.0 27.0 35.0 100 31.64625 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.006554928642550806 1101 2 0.059602832171698594 1101 3 -0.006637902422831132 1101 4 -4.63671313198363 1101 5 -2.4571302135191964 1101 6 -0.8253125345724115 1101 7 -0.3220765571412798 1101 8 -0.25251687133532386 1101 9 -0.2033134196260633 1101 10-11 -0.10162905188627036 1101 12-13 -0.03858280783272505 1101 14-15 0.07321053213851059 1101 16-17 -0.015363978316187854 1101 18-19 0.0022817789578510883 1101 20-21 0.029248257550612777 1101 22-23 -0.03642548954530156 1101 24-25 -0.10581922779068265 1101 26-27 -0.13069753291293296 1101 28-29 -0.15475992919570558 1101 30-31 -0.20130821993583226 1101 32-33 0.017009624958518543 1101 34-35 -0.1496155548180127 1101 36-37 -0.08488217723199654 1101 38-39 0.10825312534571907 1101 40-41 0.08495132204890155 1101 42-43 0.08030479035291904 1101 44-45 -9.680274366985486E-5 1101 46-47 0.0035263856621270406 1101 48-49 -0.12642438322823324 1101 50-51 -0.03959232215952824 1101 52-53 -0.09493583360990954 1101 54-55 -0.25709425821440846 1101 56-57 -0.11260924881071332 1101 58-59 -0.057362540103994775 1101 60-61 -0.10592985949773492 1101 62-63 0.048429029759923026 1101 64-65 -0.04245491757937714 1101 66-67 -0.1654635468525285 1101 68-69 0.05627005199689705 1101 70-71 0.027491979201236916 1101 72-73 -0.08378968912490592 1101 74-75 -0.11285817015156141 1101 76-77 -0.24365250580816422 1101 78-79 -0.04161135081314171 1101 80-81 -0.14487222037836034 1101 82-83 -0.25914094479477967 1101 84-85 -0.25403805730722695 1101 86-87 -0.11879079544197424 1101 88-89 -0.4036121252350924 1101 90-91 -0.19915090164840876 1101 92-93 0.01731386215289632 1101 94-95 0.17732879743333996 1101 96-97 -0.16325091271158243 1101 98-99 -0.24355570306449792 1101 100 0.08974997234207294 1104 1 0.006554928642550806 1104 2 -0.0596028321717057 1104 3 0.006637902422838238 1104 4 4.636713131983626 1104 5 2.457130213519193 1104 6 0.8253125345724044 1104 7 0.3220765571412727 1104 8 0.25251687133532386 1104 9 0.2033134196260704 1104 10-11 0.10162905188627036 1104 12-13 0.03858280783272505 1104 14-15 -0.07321053213851059 1104 16-17 0.015363978316180749 1104 18-19 -0.0022817789578510883 1104 20-21 -0.029248257550619883 1104 22-23 0.03642548954530156 1104 24-25 0.10581922779068265 1104 26-27 0.13069753291293296 1104 28-29 0.15475992919570558 1104 30-31 0.20130821993583226 1104 32-33 -0.017009624958511438 1104 34-35 0.1496155548180127 1104 36-37 0.08488217723198943 1104 38-39 -0.10825312534572618 1104 40-41 -0.08495132204890155 1104 42-43 -0.08030479035291194 1104 44-45 9.680274366274944E-5 1104 46-47 -0.003526385662134146 1104 48-49 0.12642438322823324 1104 50-51 0.03959232215952824 1104 52-53 0.09493583360991664 1104 54-55 0.25709425821440846 1104 56-57 0.11260924881071332 1104 58-59 0.057362540103994775 1104 60-61 0.10592985949773492 1104 62-63 -0.04842902975993013 1104 64-65 0.04245491757937714 1104 66-67 0.1654635468525285 1104 68-69 -0.05627005199689705 1104 70-71 -0.027491979201236916 1104 72-73 0.08378968912490592 1104 74-75 0.11285817015156141 1104 76-77 0.24365250580816422 1104 78-79 0.04161135081314171 1104 80-81 0.14487222037836034 1104 82-83 0.25914094479477257 1104 84-85 0.25403805730722695 1104 86-87 0.11879079544197424 1104 88-89 0.4036121252350924 1104 90-91 0.19915090164841587 1104 92-93 -0.01731386215289632 1104 94-95 -0.17732879743334706 1104 96-97 0.16325091271158243 1104 98-99 0.24355570306449792 1104 100 -0.08974997234207294 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 8.0 28 17.0 29 41.0 30 65.0 31 85.0 32 128.0 33 164.0 34 239.0 35 415.0 36 832.0 37 990.0 38 858.0 39 156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.675 9.975000000000001 14.799999999999999 47.55 2 26.55 16.225 29.375 27.85 3 29.4 20.1 22.175 28.325 4 31.55380724922731 25.484686709749933 15.903343635852767 27.058162405169995 5 31.574999999999996 27.650000000000002 18.525 22.25 6 23.997995991983966 31.538076152304612 18.386773547094187 26.077154308617235 7 21.875 15.174999999999999 36.875 26.075 8 23.849999999999998 18.4 22.825 34.925 9 24.275 19.900000000000002 25.224999999999998 30.599999999999998 10-11 27.6875 26.1125 17.925 28.275 12-13 25.6 21.475 24.3 28.625 14-15 26.0125 23.125 23.1 27.762500000000003 16-17 26.2625 22.85 22.5 28.3875 18-19 26.8 22.375 23.0625 27.762500000000003 20-21 26.4625 22.5 23.5375 27.500000000000004 22-23 27.0875 22.425 22.25 28.237499999999997 24-25 27.150000000000002 22.9375 22.175 27.737499999999997 26-27 27.1125 22.537499999999998 22.537499999999998 27.8125 28-29 27.05 22.1375 22.825 27.987499999999997 30-31 27.0875 22.2625 22.7 27.950000000000003 32-33 27.525 21.425 22.3625 28.6875 34-35 27.125 22.35 21.9 28.625 36-37 27.625 22.0 22.0875 28.287499999999998 38-39 27.150000000000002 22.475 22.0 28.375 40-41 27.250000000000004 22.1 22.7375 27.9125 42-43 26.400000000000002 23.0 21.75 28.849999999999998 44-45 26.6125 22.075 22.8375 28.475 46-47 27.900000000000002 22.4875 22.125 27.487499999999997 48-49 27.1375 21.725 23.1 28.037499999999998 50-51 27.4125 22.55 22.8 27.237499999999997 52-53 27.6 22.5125 21.9375 27.950000000000003 54-55 27.1125 22.8625 21.925 28.1 56-57 27.737499999999997 22.625 22.3125 27.325 58-59 27.2625 23.2625 21.3875 28.0875 60-61 27.35 22.8875 21.8625 27.900000000000002 62-63 27.275 23.0625 22.275 27.3875 64-65 28.1625 22.537499999999998 21.6 27.700000000000003 66-67 28.1875 21.675 21.825 28.3125 68-69 27.575 21.9375 22.325 28.1625 70-71 27.975 21.8875 21.099999999999998 29.037499999999998 72-73 26.8125 22.4375 22.75 28.000000000000004 74-75 27.075 23.275000000000002 21.6 28.050000000000004 76-77 28.000000000000004 22.125 21.775 28.1 78-79 27.3625 22.8625 21.6125 28.1625 80-81 28.1625 21.8 22.5875 27.450000000000003 82-83 27.8875 22.8625 21.462500000000002 27.787499999999998 84-85 27.250000000000004 22.775000000000002 22.650000000000002 27.325 86-87 26.937499999999996 22.237499999999997 22.625 28.199999999999996 88-89 27.700000000000003 22.8375 20.9125 28.549999999999997 90-91 28.475 21.925 21.7375 27.8625 92-93 27.750000000000004 22.225 23.0125 27.0125 94-95 27.675 22.3625 21.4875 28.475 96-97 27.3125 22.85 21.95 27.8875 98-99 28.812500000000004 22.425 21.3625 27.400000000000002 100 28.549999999999997 22.25 21.825 27.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.0 28 1.5 29 2.5 30 3.5 31 4.5 32 6.0 33 9.0 34 15.0 35 22.0 36 26.5 37 33.0 38 40.5 39 57.0 40 68.0 41 78.5 42 101.5 43 106.0 44 113.5 45 131.0 46 128.0 47 116.0 48 116.5 49 121.0 50 123.0 51 118.5 52 106.0 53 97.0 54 95.0 55 94.0 56 101.0 57 105.0 58 113.0 59 136.0 60 127.5 61 109.0 62 111.0 63 122.0 64 127.5 65 120.0 66 119.5 67 114.0 68 103.5 69 97.0 70 81.5 71 68.0 72 65.5 73 62.0 74 50.0 75 33.5 76 24.0 77 20.0 78 15.5 79 13.5 80 8.5 81 6.0 82 6.0 83 3.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 11.025 5 0.0 6 0.2 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618255 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618255_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.84175 33.0 31.0 34.0 30.0 34.0 2 33.0135 34.0 33.0 34.0 31.0 34.0 3 33.081 34.0 33.0 34.0 31.0 34.0 4 36.52625 37.0 37.0 37.0 35.0 37.0 5 36.60325 37.0 37.0 37.0 35.0 37.0 6 36.58325 37.0 37.0 37.0 35.0 37.0 7 36.57275 37.0 37.0 37.0 35.0 37.0 8 36.58975 37.0 37.0 37.0 35.0 37.0 9 38.46075 39.0 39.0 39.0 37.0 39.0 10-11 38.455 39.0 39.0 39.0 37.0 39.0 12-13 38.377624999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.92875 41.0 40.0 41.0 38.0 41.0 16-17 40.0445 41.0 40.0 41.0 38.0 41.0 18-19 39.8945 41.0 40.0 41.0 38.0 41.0 20-21 39.908625 41.0 40.0 41.0 38.0 41.0 22-23 39.872875 41.0 40.0 41.0 37.5 41.0 24-25 39.71575 41.0 40.0 41.0 37.0 41.0 26-27 39.63125 41.0 40.0 41.0 37.0 41.0 28-29 39.47025 41.0 39.0 41.0 36.5 41.0 30-31 39.45975 41.0 39.0 41.0 36.0 41.0 32-33 39.295500000000004 41.0 39.0 41.0 35.0 41.0 34-35 39.1375 40.5 38.0 41.0 35.0 41.0 36-37 38.993875 40.0 38.0 41.0 35.0 41.0 38-39 38.811125000000004 40.0 38.0 41.0 35.0 41.0 40-41 38.4255 40.0 37.0 41.0 34.0 41.0 42-43 38.214875 40.0 36.5 41.0 34.0 41.0 44-45 37.905375 39.5 35.5 41.0 33.5 41.0 46-47 37.644625000000005 39.0 35.0 41.0 33.0 41.0 48-49 37.463499999999996 39.0 35.0 41.0 33.0 41.0 50-51 37.017875000000004 38.0 35.0 40.0 33.0 41.0 52-53 37.012125 38.0 35.0 40.0 33.0 41.0 54-55 37.13175 37.0 35.0 41.0 33.0 41.0 56-57 36.971875 37.0 35.0 41.0 33.0 41.0 58-59 36.76375 36.0 35.0 40.0 33.0 41.0 60-61 36.518375000000006 35.5 35.0 40.0 33.0 41.0 62-63 36.314625 35.0 35.0 39.5 33.0 41.0 64-65 35.988125 35.0 35.0 39.0 32.5 41.0 66-67 35.684375 35.0 35.0 38.5 33.0 41.0 68-69 35.3815 35.0 35.0 37.0 32.0 40.5 70-71 35.166375 35.0 35.0 37.0 32.0 39.5 72-73 34.83425 35.0 34.5 36.0 31.5 39.0 74-75 34.588625 35.0 34.0 36.0 31.0 39.0 76-77 34.44825 35.0 34.0 35.5 31.0 37.5 78-79 34.06875 35.0 34.0 35.0 31.0 37.0 80-81 33.81075 35.0 34.0 35.0 30.0 36.5 82-83 33.660624999999996 35.0 33.0 35.0 30.0 36.0 84-85 33.479875 35.0 33.0 35.0 30.0 36.0 86-87 33.38275 35.0 33.0 35.0 29.5 35.5 88-89 33.095875 35.0 33.0 35.0 29.0 35.0 90-91 32.903875 35.0 33.0 35.0 29.0 35.0 92-93 32.758625 35.0 33.0 35.0 29.0 35.0 94-95 32.461625 35.0 33.0 35.0 27.0 35.0 96-97 32.22 35.0 33.0 35.0 27.0 35.0 98-99 31.8825 35.0 33.0 35.0 27.0 35.0 100 31.428 35.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.4113286868016388 1101 2 0.1812423940701393 1101 3 0.019388206660025276 1101 4 0.1874654275915475 1101 5 0.08139727846000255 1101 6 0.08507578271932914 1101 7 0.16672198252018688 1101 8 0.11843124239406677 1101 9 0.1202290076335828 1101 10-11 0.05373935169819788 1101 12-13 -0.03522236973116577 1101 14-15 0.18375926540546317 1101 16-17 0.16879632702732295 1101 18-19 0.1611350813143062 1101 20-21 0.12452981524504736 1101 22-23 0.007785706383451441 1101 24-25 -0.04488881513442067 1101 26-27 0.00324980639451411 1101 28-29 0.1842294501604158 1101 30-31 -0.006872994800311005 1101 32-33 0.07908784157539372 1101 34-35 0.14863369841796725 1101 36-37 0.038223254784817584 1101 38-39 0.01435446398938467 1101 40-41 0.004867795110079953 1101 42-43 0.11283051222480367 1101 44-45 -0.15803739351698454 1101 46-47 0.03728288527491941 1101 48-49 -0.06678006416638738 1101 50-51 0.16052660692554355 1101 52-53 0.11919183538002187 1101 54-55 0.11230501161632844 1101 56-57 0.021310432569976 1101 58-59 0.048760924881072754 1101 60-61 -0.10514160858502208 1101 62-63 -0.008587786259539598 1101 64-65 -0.12014603385330247 1101 66-67 -0.15149629383780905 1101 68-69 -0.3815410996791684 1101 70-71 -0.26306837039495434 1101 72-73 -0.35021849762141954 1101 74-75 -0.3418519747759703 1101 76-77 -0.12954972895231975 1101 78-79 -0.23762307777408864 1101 80-81 -0.12845724084522914 1101 82-83 -0.5936220820887286 1101 84-85 -0.4291403916362455 1101 86-87 -0.31955968580595595 1101 88-89 -0.15310045358999247 1101 90-91 -0.51409171368514 1101 92-93 -0.6408065051443721 1101 94-95 -0.5355127779621682 1101 96-97 -0.8144291403916348 1101 98-99 -0.8135302577718768 1101 100 -0.5901648412434994 1104 1 -0.4113286868016388 1104 2 -0.1812423940701393 1104 3 -0.01938820666003238 1104 4 -0.1874654275915475 1104 5 -0.08139727846000966 1104 6 -0.08507578271932914 1104 7 -0.166721982520194 1104 8 -0.11843124239407388 1104 9 -0.1202290076335899 1104 10-11 -0.05373935169819788 1104 12-13 0.03522236973116577 1104 14-15 -0.18375926540546317 1104 16-17 -0.16879632702732295 1104 18-19 -0.1611350813143062 1104 20-21 -0.12452981524504736 1104 22-23 -0.007785706383444335 1104 24-25 0.04488881513441356 1104 26-27 -0.00324980639451411 1104 28-29 -0.1842294501604158 1104 30-31 0.006872994800311005 1104 32-33 -0.07908784157539372 1104 34-35 -0.14863369841796015 1104 36-37 -0.038223254784817584 1104 38-39 -0.01435446398938467 1104 40-41 -0.004867795110079953 1104 42-43 -0.11283051222480367 1104 44-45 0.15803739351698454 1104 46-47 -0.03728288527491941 1104 48-49 0.06678006416638738 1104 50-51 -0.16052660692555065 1104 52-53 -0.11919183538002187 1104 54-55 -0.11230501161632844 1104 56-57 -0.021310432569976 1104 58-59 -0.048760924881072754 1104 60-61 0.10514160858502208 1104 62-63 0.008587786259546704 1104 64-65 0.12014603385330247 1104 66-67 0.15149629383780905 1104 68-69 0.3815410996791684 1104 70-71 0.26306837039495434 1104 72-73 0.35021849762141244 1104 74-75 0.3418519747759703 1104 76-77 0.12954972895231265 1104 78-79 0.23762307777409575 1104 80-81 0.12845724084522914 1104 82-83 0.5936220820887286 1104 84-85 0.4291403916362455 1104 86-87 0.31955968580594885 1104 88-89 0.15310045358999957 1104 90-91 0.51409171368514 1104 92-93 0.6408065051443756 1104 94-95 0.5355127779621682 1104 96-97 0.8144291403916384 1104 98-99 0.8135302577718804 1104 100 0.5901648412434994 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 4.0 27 14.0 28 22.0 29 37.0 30 53.0 31 96.0 32 116.0 33 151.0 34 239.0 35 462.0 36 865.0 37 906.0 38 872.0 39 163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.4 7.35 15.25 49.0 2 28.225 14.774999999999999 29.275000000000002 27.725 3 29.875 19.900000000000002 22.675 27.55 4 30.7 24.0 15.925 29.375 5 31.974999999999998 28.000000000000004 17.299999999999997 22.725 6 22.775000000000002 32.625 18.15 26.450000000000003 7 22.85 14.124999999999998 35.875 27.150000000000002 8 24.025 19.325 23.200000000000003 33.45 9 24.275 18.025 27.200000000000003 30.5 10-11 28.264132066033014 25.71285642821411 18.18409204602301 27.838919459729865 12-13 26.25 20.5 24.6625 28.5875 14-15 27.037499999999998 22.275 23.200000000000003 27.487499999999997 16-17 27.787499999999998 21.8875 22.225 28.1 18-19 26.6 22.2125 21.925 29.262500000000003 20-21 26.724999999999998 22.825 22.912499999999998 27.537499999999998 22-23 27.35 22.775000000000002 21.525 28.349999999999998 24-25 27.175 21.8125 23.1625 27.85 26-27 27.1125 22.5625 22.662499999999998 27.6625 28-29 27.3125 21.95 22.650000000000002 28.0875 30-31 27.625 22.287499999999998 21.925 28.1625 32-33 27.075 22.55 22.4625 27.9125 34-35 28.4125 21.7875 22.0 27.800000000000004 36-37 27.1375 22.325 22.5125 28.025 38-39 27.6875 22.5125 22.1 27.700000000000003 40-41 26.6 22.2125 22.475 28.712500000000002 42-43 27.187499999999996 22.4625 22.15 28.199999999999996 44-45 27.787499999999998 22.8375 21.875 27.500000000000004 46-47 27.8625 21.0375 22.912499999999998 28.1875 48-49 27.1375 22.112499999999997 21.85 28.9 50-51 27.187499999999996 22.2625 22.3625 28.1875 52-53 28.4 21.875 21.825 27.900000000000002 54-55 27.525 21.587500000000002 22.7375 28.15 56-57 27.575 22.5125 22.287499999999998 27.625 58-59 28.025 22.1375 22.3625 27.474999999999998 60-61 26.7625 22.412499999999998 22.425 28.4 62-63 28.525 22.3875 22.025 27.0625 64-65 27.650000000000002 22.650000000000002 21.087500000000002 28.6125 66-67 26.974999999999998 22.025 23.05 27.950000000000003 68-69 27.925 22.2625 22.075 27.737499999999997 70-71 27.900000000000002 21.587500000000002 21.6625 28.849999999999998 72-73 27.6625 22.0625 22.85 27.425 74-75 27.5125 22.8375 21.65 28.000000000000004 76-77 27.6375 22.2 22.025 28.1375 78-79 27.787499999999998 21.7875 21.825 28.599999999999998 80-81 27.737499999999997 22.325 22.112499999999997 27.825 82-83 28.037499999999998 22.175 21.1375 28.65 84-85 27.487499999999997 22.2125 22.275 28.025 86-87 28.599999999999998 21.6875 22.275 27.437499999999996 88-89 28.537499999999998 21.55 22.475 27.437499999999996 90-91 27.8375 22.2125 22.287499999999998 27.6625 92-93 27.925 22.1875 22.662499999999998 27.224999999999998 94-95 28.3375 22.3625 22.225 27.075 96-97 27.875 22.7375 22.2125 27.175 98-99 28.4125 22.7375 22.35 26.5 100 28.875 22.8 20.849999999999998 27.474999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.0 28 2.5 29 2.5 30 2.5 31 3.5 32 6.5 33 9.5 34 11.0 35 10.5 36 19.5 37 37.0 38 42.0 39 55.5 40 71.5 41 81.0 42 104.0 43 120.0 44 119.5 45 121.0 46 124.5 47 120.5 48 122.5 49 127.0 50 115.0 51 104.5 52 101.5 53 95.5 54 89.5 55 84.0 56 86.5 57 100.5 58 111.0 59 113.5 60 117.0 61 117.5 62 117.5 63 117.0 64 120.0 65 122.5 66 120.5 67 121.5 68 123.0 69 106.5 70 87.0 71 82.5 72 71.0 73 62.0 74 51.5 75 42.5 76 35.0 77 21.5 78 14.5 79 10.5 80 8.5 81 7.0 82 4.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.05 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.86162408297496 97.7 2 1.0877814318239312 2.15 3 0.05059448520111307 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra Read 563518 spots for SRR8618255.sra Written 563518 spots for SRR8618255.sra SRR ids: ['SRR8618255.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_og8x7ncs SRR8618255.sra spots: 11270360 blocks: [[1, 563518], [563519, 1127036], [1127037, 1690554], [1690555, 2254072], [2254073, 2817590], [2817591, 3381108], [3381109, 3944626], [3944627, 4508144], [4508145, 5071662], [5071663, 5635180], [5635181, 6198698], [6198699, 6762216], [6762217, 7325734], [7325735, 7889252], [7889253, 8452770], [8452771, 9016288], [9016289, 9579806], [9579807, 10143324], [10143325, 10706842], [10706843, 11270360]] SRR8618255 file size 2933126 SRR8618255 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618255 SRR8618255_1.fastq SRR8618255_2.fastq Input file: SRR8618255_1.fastq Paired file: SRR8618255_2.fastq trimmed: SRR8618255-trimmed-pair1.fastq, SRR8618255-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:01:51 2024 >> started Sat Dec 7 11:02:01 2024 >> done (10.262s) 11270360 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11270360 (100.00%) read pairs available; of these: 1414301 (12.55%) trimmed read pairs available after processing 9856059 (87.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 7 0.00% 82 26 0.00% 83 104 0.00% 84 4254 0.04% 85 4557 0.04% 86 4867 0.04% 87 5421 0.05% 88 6536 0.06% 89 8416 0.07% 90 15173 0.13% 91 30526 0.27% 92 43684 0.39% 93 61743 0.55% 94 83863 0.74% 95 106775 0.95% 96 140910 1.25% 97 199022 1.77% 98 291088 2.58% 99 407328 3.61% 100 9856059 87.45% 11270360 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=40 prefix-density=0.47 prefix-fanout=2.0 sequence=ACCCGAACATGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=25.37 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.0 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=40 prefix-density=0.47 prefix-fanout=1.9 sequence=ACCCGAACATGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=27.72 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.2 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR8618255 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:02:28 Started mapping on | Dec 07 11:02:29 Finished on | Dec 07 11:02:54 Mapping speed, Million of reads per hour | 1622.93 Number of input reads | 11270360 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11088153 Uniquely mapped reads % | 98.38% Average mapped length | 198.47 Number of splices: Total | 6332881 Number of splices: Annotated (sjdb) | 6053708 Number of splices: GT/AG | 6252390 Number of splices: GC/AG | 70326 Number of splices: AT/AC | 1712 Number of splices: Non-canonical | 8453 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 84568 % of reads mapped to multiple loci | 0.75% Number of reads mapped to too many loci | 6256 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 97639 97639 97639 N_multimapping 84568 84568 84568 N_noFeature 198069 5519290 5582333 N_ambiguous 228325 21379 23152 UnstrandedReadsAssigned:10661759 PositiveStrandReadsAssigned:5547484 NegativeStrandReadsAssigned:5482668 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618255 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618255-trimmed-pair1.fastq SRR8618255-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,270,360 reads, 10,889,065 reads pseudoaligned [quant] estimated average fragment length: 167.315 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52973 SRR8618255.ke.tsv 35125 SRR8618255.se.tsv 88098 total ==> SRR8618255.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.732 0 0 PNS24247 1044 877.685 13.3283 1.824 PNS24249 1928 1761.69 63.6878 4.34225 PNS24246 1044 877.685 13.3283 1.824 PNS24248 1044 877.685 13.3283 1.824 PNS24244 1471 1304.69 12.3271 1.13486 PNS24243 293 133.841 18 16.1537 KQK14069 1603 1436.69 2119.18 177.171 KQK14071 474 308.84 185.258 72.0492 ==> SRR8618255.se.tsv <== BRADI_1g14170v3 2428 BRADI_1g53295v3 11 BRADI_1g59795v3 124 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 105 BRADI_1g74790v3 28 BRADI_1g09890v3 0 BRADI_1g77505v3 110 BRADI_1g48960v3 0 SRR8618255 completed mapping pipeline successfully