Starting /dee2/code/volunteer_pipeline.sh SRR8618256 current disk space = 1543254282240 free memory = 1597829572 SRR8618256 SRAfilesize 662eee9155532291e7cd09e35d645fcb SRR8618256.sra SRR8618256.sra file validated SRR8618256 is paired end SRR8618256 is conventional basespace SRR8618256 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618256_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1405 34.0 33.0 34.0 31.0 34.0 2 33.31125 34.0 34.0 34.0 31.0 34.0 3 33.35375 34.0 34.0 34.0 31.0 34.0 4 32.33075 37.0 37.0 37.0 2.0 37.0 5 34.417 37.0 37.0 37.0 19.0 37.0 6 35.9315 37.0 37.0 37.0 32.0 37.0 7 36.33825 37.0 36.0 37.0 35.0 37.0 8 36.43425 37.0 37.0 37.0 35.0 37.0 9 38.4285 39.0 39.0 39.0 37.0 39.0 10-11 38.3955 39.0 39.0 39.0 37.0 39.0 12-13 38.41675 39.0 39.0 39.0 37.0 39.0 14-15 40.030625 41.0 40.0 41.0 38.0 41.0 16-17 39.945375 41.0 40.0 41.0 38.0 41.0 18-19 39.862624999999994 41.0 40.0 41.0 38.0 41.0 20-21 39.875125 41.0 40.0 41.0 38.0 41.0 22-23 39.831625 41.0 40.0 41.0 38.0 41.0 24-25 39.7335 41.0 40.0 41.0 37.0 41.0 26-27 39.534000000000006 41.0 39.0 41.0 37.0 41.0 28-29 39.38775 40.0 39.0 41.0 36.0 41.0 30-31 39.230500000000006 40.0 38.5 41.0 36.0 41.0 32-33 39.167125 40.0 38.5 41.0 35.0 41.0 34-35 39.308 40.5 39.0 41.0 35.0 41.0 36-37 39.270875 41.0 39.0 41.0 35.0 41.0 38-39 39.193875000000006 41.0 38.5 41.0 35.0 41.0 40-41 39.035 40.0 38.0 41.0 35.0 41.0 42-43 38.7985 40.0 37.5 41.0 35.0 41.0 44-45 38.621624999999995 40.0 37.0 41.0 35.0 41.0 46-47 38.373000000000005 40.0 36.0 41.0 34.5 41.0 48-49 38.129374999999996 40.0 35.5 41.0 34.5 41.0 50-51 37.893875 39.5 35.0 41.0 34.0 41.0 52-53 37.678375 39.0 35.0 41.0 34.0 41.0 54-55 37.386875 38.5 35.0 41.0 33.0 41.0 56-57 37.130624999999995 38.0 35.0 41.0 33.0 41.0 58-59 36.80175 37.0 35.0 40.0 33.0 41.0 60-61 36.619749999999996 36.5 35.0 40.0 33.0 41.0 62-63 36.35225 36.0 35.0 40.0 33.0 41.0 64-65 35.988 35.5 35.0 39.0 32.5 41.0 66-67 35.676375 35.0 35.0 39.0 31.5 41.0 68-69 35.350625 35.0 34.5 38.0 31.0 40.0 70-71 35.065625 35.0 34.0 37.0 31.0 39.5 72-73 34.7405 35.0 34.0 37.0 31.0 39.0 74-75 34.515875 35.0 34.0 36.0 31.0 39.0 76-77 33.578 34.5 32.5 35.0 29.5 37.0 78-79 33.983125 35.0 33.5 35.0 30.0 37.0 80-81 33.93025 35.0 34.0 35.0 30.5 37.0 82-83 33.637375 35.0 33.0 35.0 30.0 36.0 84-85 33.460750000000004 35.0 33.0 35.0 29.0 36.0 86-87 33.347125000000005 35.0 33.0 35.0 29.5 36.0 88-89 33.12575 35.0 33.0 35.0 29.0 35.0 90-91 32.793625 35.0 33.0 35.0 28.5 35.0 92-93 32.573499999999996 35.0 33.0 35.0 28.0 35.0 94-95 32.46625 35.0 33.0 35.0 27.0 35.0 96-97 32.24075 35.0 33.0 35.0 27.0 35.0 98-99 31.84825 35.0 33.0 35.0 27.0 35.0 100 31.483 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.058847402597400844 1101 2 0.028814935064936265 1101 3 0.04099025974026205 1101 4 -4.0762987012987 1101 5 -2.101461038961041 1101 6 -0.615259740259738 1101 7 -0.24452110389610482 1101 8 -0.13291396103895892 1101 9 0.012784090909093493 1101 10-11 -0.01775568181817988 1101 12-13 0.0357142857142847 1101 14-15 -0.023133116883116145 1101 16-17 0.052658279220779036 1101 18-19 0.24320211038961048 1101 20-21 0.10318587662337109 1101 22-23 0.08340097402597735 1101 24-25 0.01775568181817988 1101 26-27 0.16883116883116855 1101 28-29 0.005478896103895181 1101 30-31 0.18607954545454675 1101 32-33 0.2511160714285765 1101 34-35 0.22778003246753542 1101 36-37 0.12855113636364024 1101 38-39 0.11241883116883145 1101 40-41 0.2528409090909065 1101 42-43 0.23001217532467422 1101 44-45 0.30661525974026205 1101 46-47 0.34070616883116855 1101 48-49 0.2962662337662323 1101 50-51 0.43506493506493626 1101 52-53 0.4474431818181799 1101 54-55 0.32010957792208217 1101 56-57 0.4816355519480524 1101 58-59 0.4107142857142847 1101 60-61 0.39549512987012747 1101 62-63 0.4223823051948088 1101 64-65 0.5009131493506516 1101 66-67 0.3934659090909065 1101 68-69 0.3542004870129887 1101 70-71 0.3224431818181799 1101 72-73 0.1211444805194759 1101 74-75 0.3271103896103895 1101 76-77 0.26369724025973795 1101 78-79 0.40046672077922096 1101 80-81 0.32944399350649434 1101 82-83 0.19906655844155807 1101 84-85 0.4966517857142847 1101 86-87 0.1417410714285694 1101 88-89 0.33005275974026205 1101 90-91 0.32964691558441217 1101 92-93 0.18334009740259916 1101 94-95 0.17562905844155807 1101 96-97 0.22899756493507084 1101 98-99 0.10054788961038952 1101 100 0.23681006493506374 1104 1 -0.05884740259740795 1104 2 -0.028814935064936265 1104 3 -0.04099025974026205 1104 4 4.076298701298704 1104 5 2.101461038961041 1104 6 0.615259740259738 1104 7 0.2445211038960977 1104 8 0.13291396103895892 1104 9 -0.012784090909086387 1104 10-11 0.01775568181817988 1104 12-13 -0.0357142857142847 1104 14-15 0.023133116883116145 1104 16-17 -0.05265827922078614 1104 18-19 -0.24320211038961048 1104 20-21 -0.10318587662337819 1104 22-23 -0.08340097402597735 1104 24-25 -0.01775568181817988 1104 26-27 -0.16883116883116855 1104 28-29 -0.005478896103895181 1104 30-31 -0.18607954545454675 1104 32-33 -0.2511160714285694 1104 34-35 -0.22778003246753542 1104 36-37 -0.12855113636363313 1104 38-39 -0.11241883116883145 1104 40-41 -0.2528409090909136 1104 42-43 -0.23001217532467422 1104 44-45 -0.30661525974026205 1104 46-47 -0.34070616883116855 1104 48-49 -0.2962662337662323 1104 50-51 -0.43506493506494337 1104 52-53 -0.4474431818181799 1104 54-55 -0.32010957792208217 1104 56-57 -0.4816355519480453 1104 58-59 -0.4107142857142847 1104 60-61 -0.39549512987012747 1104 62-63 -0.4223823051948088 1104 64-65 -0.5009131493506445 1104 66-67 -0.3934659090909136 1104 68-69 -0.3542004870129887 1104 70-71 -0.3224431818181799 1104 72-73 -0.1211444805194759 1104 74-75 -0.3271103896103895 1104 76-77 -0.26369724025973795 1104 78-79 -0.40046672077921386 1104 80-81 -0.32944399350649434 1104 82-83 -0.19906655844155807 1104 84-85 -0.4966517857142847 1104 86-87 -0.1417410714285694 1104 88-89 -0.33005275974026205 1104 90-91 -0.3296469155844193 1104 92-93 -0.18334009740259205 1104 94-95 -0.17562905844155807 1104 96-97 -0.22899756493506374 1104 98-99 -0.10054788961038952 1104 100 -0.23681006493506374 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 7.0 28 19.0 29 38.0 30 56.0 31 98.0 32 121.0 33 173.0 34 248.0 35 432.0 36 781.0 37 937.0 38 930.0 39 158.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.575 11.55 15.9 45.975 2 27.0 16.375 29.825000000000003 26.8 3 29.325000000000003 20.474999999999998 22.725 27.474999999999998 4 30.56269637246501 26.078263353327618 16.452442159383033 26.906598114824337 5 30.325000000000003 28.549999999999997 20.125 21.0 6 23.39254440830623 33.62521891418564 17.988491368526393 24.993745308981737 7 21.6 15.6 37.0 25.8 8 24.349999999999998 19.675 24.05 31.924999999999997 9 23.525 19.875 27.275 29.325000000000003 10-11 27.462500000000002 27.375 18.125 27.037499999999998 12-13 25.6125 21.7375 24.875 27.775 14-15 25.9625 23.1875 23.9125 26.937499999999996 16-17 27.224999999999998 23.225 23.1125 26.437500000000004 18-19 26.4125 23.4375 22.8875 27.2625 20-21 25.9625 23.674999999999997 23.925 26.437500000000004 22-23 26.2125 24.3625 22.825 26.6 24-25 25.7875 23.5625 23.7875 26.8625 26-27 26.5625 23.75 22.775000000000002 26.9125 28-29 26.087500000000002 23.7875 22.537499999999998 27.5875 30-31 26.237500000000004 23.3 23.375 27.0875 32-33 26.775 23.599999999999998 22.5 27.125 34-35 27.400000000000002 23.0875 23.45 26.0625 36-37 25.825 22.9625 23.9875 27.224999999999998 38-39 26.700000000000003 23.962500000000002 22.3875 26.950000000000003 40-41 25.937500000000004 23.799999999999997 23.225 27.037499999999998 42-43 26.2625 23.0125 23.3875 27.3375 44-45 26.1125 23.549999999999997 23.4125 26.924999999999997 46-47 26.8125 22.6125 23.775 26.8 48-49 26.2625 23.525 23.825 26.387500000000003 50-51 27.450000000000003 23.0 23.0 26.55 52-53 26.275 23.200000000000003 24.075 26.450000000000003 54-55 25.575 23.625 23.2125 27.5875 56-57 26.150000000000002 22.8875 23.400000000000002 27.5625 58-59 26.950000000000003 23.0 23.75 26.3 60-61 26.3 22.912499999999998 22.900000000000002 27.8875 62-63 26.337500000000002 23.9125 22.825 26.924999999999997 64-65 27.125 23.549999999999997 22.787499999999998 26.5375 66-67 26.2125 23.6625 22.412499999999998 27.712500000000002 68-69 26.7625 23.5 23.05 26.687499999999996 70-71 27.35 23.25 22.625 26.775 72-73 26.5875 23.7 23.5625 26.150000000000002 74-75 26.974999999999998 23.8625 22.7375 26.424999999999997 76-77 26.6625 22.8375 22.825 27.675 78-79 26.5625 23.3 23.599999999999998 26.5375 80-81 26.950000000000003 23.1 22.787499999999998 27.1625 82-83 26.737499999999997 23.025000000000002 23.599999999999998 26.637499999999996 84-85 25.874999999999996 23.724999999999998 23.775 26.625 86-87 26.637499999999996 23.3125 22.900000000000002 27.150000000000002 88-89 27.025 23.474999999999998 22.325 27.175 90-91 27.1 22.8875 23.3 26.7125 92-93 26.4125 23.8375 23.25 26.5 94-95 26.137500000000003 23.6875 23.4375 26.737499999999997 96-97 26.924999999999997 23.674999999999997 23.65 25.75 98-99 26.974999999999998 23.5875 22.4375 27.0 100 26.75 23.65 22.6 27.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 1.5 29 2.0 30 3.0 31 6.0 32 8.5 33 12.0 34 17.0 35 19.5 36 30.0 37 45.5 38 54.0 39 66.5 40 88.5 41 108.0 42 133.0 43 136.5 44 138.5 45 151.5 46 153.5 47 167.5 48 165.5 49 147.5 50 140.0 51 132.5 52 116.0 53 99.5 54 91.0 55 89.0 56 91.0 57 88.5 58 93.0 59 97.0 60 91.0 61 89.5 62 86.0 63 93.5 64 101.0 65 102.5 66 89.5 67 76.0 68 79.0 69 74.0 70 69.5 71 67.0 72 57.5 73 49.5 74 38.0 75 31.5 76 33.5 77 28.0 78 20.5 79 12.5 80 6.0 81 4.5 82 2.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 12.475 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618256 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618256_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23875 33.0 31.0 34.0 31.0 34.0 2 32.91075 34.0 31.0 34.0 31.0 34.0 3 33.085 34.0 33.0 34.0 31.0 34.0 4 36.5575 37.0 37.0 37.0 35.0 37.0 5 36.59975 37.0 37.0 37.0 35.0 37.0 6 36.55825 37.0 37.0 37.0 35.0 37.0 7 36.54375 37.0 37.0 37.0 35.0 37.0 8 36.5445 37.0 37.0 37.0 35.0 37.0 9 38.45775 39.0 39.0 39.0 37.0 39.0 10-11 38.44925 39.0 39.0 39.0 37.0 39.0 12-13 38.305 39.0 39.0 39.0 37.0 39.0 14-15 39.956125 41.0 40.0 41.0 38.0 41.0 16-17 39.88425 41.0 40.0 41.0 38.0 41.0 18-19 39.923 41.0 40.0 41.0 38.0 41.0 20-21 39.935249999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.784875 41.0 40.0 41.0 37.5 41.0 24-25 39.65175 41.0 39.5 41.0 37.0 41.0 26-27 39.536125 41.0 39.0 41.0 36.5 41.0 28-29 39.454125000000005 41.0 39.0 41.0 36.0 41.0 30-31 39.337625 40.0 39.0 41.0 36.0 41.0 32-33 39.305875 41.0 39.0 41.0 35.5 41.0 34-35 39.176375 40.0 38.0 41.0 35.0 41.0 36-37 39.046125 40.0 38.0 41.0 35.0 41.0 38-39 38.837875 40.0 38.0 41.0 35.0 41.0 40-41 38.477125 40.0 37.0 41.0 34.0 41.0 42-43 38.2515 40.0 36.5 41.0 34.0 41.0 44-45 38.047875000000005 40.0 35.5 41.0 33.5 41.0 46-47 37.753 39.0 35.0 41.0 33.0 41.0 48-49 37.5835 39.0 35.0 41.0 33.0 41.0 50-51 37.163125 38.5 35.0 40.5 32.5 41.0 52-53 37.347625 38.5 35.0 40.5 33.0 41.0 54-55 37.41974999999999 38.5 35.0 41.0 34.0 41.0 56-57 37.161 38.0 35.0 41.0 33.0 41.0 58-59 36.907250000000005 37.0 35.0 41.0 33.0 41.0 60-61 36.772999999999996 36.5 35.0 40.0 33.0 41.0 62-63 36.565 36.0 35.0 40.0 33.0 41.0 64-65 36.243625 35.5 35.0 39.0 33.0 41.0 66-67 35.899375 35.0 35.0 39.0 32.5 41.0 68-69 35.614374999999995 35.0 35.0 38.5 32.0 41.0 70-71 35.318375 35.0 34.5 37.0 32.0 40.0 72-73 35.042874999999995 35.0 34.0 37.0 31.0 39.0 74-75 34.77225 35.0 34.0 36.5 31.0 39.0 76-77 34.517625 35.0 34.0 36.0 31.0 38.5 78-79 34.229875 35.0 34.0 35.5 30.5 37.0 80-81 34.01 35.0 34.0 35.0 30.0 37.0 82-83 33.749625 35.0 34.0 35.0 30.0 36.5 84-85 33.503375000000005 35.0 33.0 35.0 29.5 36.0 86-87 33.365375 35.0 33.0 35.0 29.0 36.0 88-89 33.161625 35.0 33.0 35.0 29.0 35.5 90-91 32.933125 35.0 33.0 35.0 29.0 35.0 92-93 32.641625 35.0 33.0 35.0 27.0 35.0 94-95 32.424375 35.0 33.0 35.0 27.0 35.0 96-97 32.133625 35.0 33.0 35.0 27.0 35.0 98-99 31.759500000000003 35.0 32.0 35.0 27.0 35.0 100 31.4125 35.0 32.0 35.0 24.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.17755681818182012 1101 2 0.34618506493506374 1101 3 0.2838879870129887 1101 4 0.024756493506494337 1101 5 0.016639610389610482 1101 6 0.046875 1101 7 0.14975649350649434 1101 8 0.023944805194801688 1101 9 0.17228084415584277 1101 10-11 0.03652597402597735 1101 12-13 0.0479910714285694 1101 14-15 0.20606737012987253 1101 16-17 0.30336850649350566 1101 18-19 0.21631493506492916 1101 20-21 0.17258522727272663 1101 22-23 0.29261363636364024 1101 24-25 -0.029322240259737953 1101 26-27 0.2304180194805241 1101 28-29 0.15696022727272663 1101 30-31 0.18060064935065157 1101 32-33 0.1969358766233711 1101 34-35 0.011059253246756384 1101 36-37 -9.131493506515653E-4 1101 38-39 0.025263798701296025 1101 40-41 0.020292207792209638 1101 42-43 0.002333603896104819 1101 44-45 0.03591720779220964 1101 46-47 0.15553977272727337 1101 48-49 0.20687905844155807 1101 50-51 0.13474025974026205 1101 52-53 -0.027800324675325783 1101 54-55 -0.08806818181817988 1101 56-57 -2.0292207791783312E-4 1101 58-59 0.10349025974026205 1101 60-61 -0.010146103896104819 1101 62-63 -0.027191558441558072 1101 64-65 -0.0865462662337606 1101 66-67 0.03196022727272663 1101 68-69 -0.002536525974022652 1101 70-71 -7.102272727266268E-4 1101 72-73 0.1741071428571459 1101 74-75 -0.01734983766233711 1101 76-77 0.0345982142857153 1101 78-79 -0.09090909090909349 1101 80-81 -0.020900974025977348 1101 82-83 -0.00984172077922807 1101 84-85 0.023133116883116145 1101 86-87 -0.14377029220779036 1101 88-89 -0.13890016233767 1101 90-91 0.08959009740259916 1101 92-93 -0.042106331168831446 1101 94-95 -0.01887175324674928 1101 96-97 0.2545657467532507 1101 98-99 0.13869724025973795 1101 100 -0.15280032467532578 1104 1 -0.17755681818181657 1104 2 -0.34618506493506374 1104 3 -0.2838879870129887 1104 4 -0.024756493506494337 1104 5 -0.016639610389610482 1104 6 -0.046875 1104 7 -0.14975649350649434 1104 8 -0.023944805194808794 1104 9 -0.17228084415584988 1104 10-11 -0.03652597402597735 1104 12-13 -0.0479910714285694 1104 14-15 -0.20606737012987253 1104 16-17 -0.30336850649350566 1104 18-19 -0.21631493506493626 1104 20-21 -0.17258522727272663 1104 22-23 -0.29261363636363313 1104 24-25 0.029322240259737953 1104 26-27 -0.2304180194805241 1104 28-29 -0.15696022727272663 1104 30-31 -0.18060064935064446 1104 32-33 -0.1969358766233782 1104 34-35 -0.011059253246749279 1104 36-37 9.131493506444599E-4 1104 38-39 -0.02526379870130313 1104 40-41 -0.020292207792209638 1104 42-43 -0.002333603896104819 1104 44-45 -0.03591720779220253 1104 46-47 -0.15553977272727337 1104 48-49 -0.20687905844155807 1104 50-51 -0.13474025974026205 1104 52-53 0.027800324675325783 1104 54-55 0.08806818181817988 1104 56-57 2.0292207792493855E-4 1104 58-59 -0.10349025974026205 1104 60-61 0.010146103896104819 1104 62-63 0.027191558441558072 1104 64-65 0.08654626623376771 1104 66-67 -0.03196022727272663 1104 68-69 0.002536525974022652 1104 70-71 7.102272727266268E-4 1104 72-73 -0.1741071428571388 1104 74-75 0.01734983766233711 1104 76-77 -0.0345982142857153 1104 78-79 0.09090909090908639 1104 80-81 0.020900974025977348 1104 82-83 0.009841720779220964 1104 84-85 -0.023133116883116145 1104 86-87 0.14377029220779036 1104 88-89 0.1389001623376629 1104 90-91 -0.08959009740259205 1104 92-93 0.042106331168831446 1104 94-95 0.018871753246756384 1104 96-97 -0.25456574675324717 1104 98-99 -0.13869724025973795 1104 100 0.15280032467532223 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 11.0 28 28.0 29 36.0 30 60.0 31 74.0 32 118.0 33 158.0 34 256.0 35 461.0 36 761.0 37 876.0 38 951.0 39 208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.900000000000002 10.05 15.775 47.275 2 26.075 16.825000000000003 30.9 26.200000000000003 3 28.575 20.525 22.675 28.225 4 29.975 25.924999999999997 15.1 28.999999999999996 5 30.525000000000002 29.049999999999997 19.525000000000002 20.9 6 23.35 32.6 18.925 25.124999999999996 7 21.45 15.55 37.625 25.374999999999996 8 22.275 18.9 25.4 33.425 9 23.925 19.725 26.650000000000002 29.7 10-11 26.828353544193025 26.96587073384173 18.639829978747343 27.565945743217902 12-13 25.074999999999996 21.575 25.25 28.1 14-15 25.3125 23.549999999999997 24.4875 26.650000000000002 16-17 26.474999999999998 22.2625 22.825 28.4375 18-19 25.7375 23.5375 23.35 27.375 20-21 25.924999999999997 23.5875 22.775000000000002 27.712500000000002 22-23 26.0 23.6125 23.025000000000002 27.3625 24-25 27.0125 22.8125 22.900000000000002 27.275 26-27 26.900000000000002 23.2125 22.85 27.037499999999998 28-29 25.35 23.125 23.674999999999997 27.85 30-31 24.3 23.8625 23.0 28.8375 32-33 25.7 23.9125 22.8875 27.500000000000004 34-35 27.1 23.2375 22.6375 27.025 36-37 26.450000000000003 23.2375 22.125 28.1875 38-39 26.650000000000002 23.3 23.549999999999997 26.5 40-41 26.424999999999997 24.337500000000002 23.05 26.187500000000004 42-43 24.975 23.425 24.462500000000002 27.1375 44-45 26.150000000000002 23.5 23.4625 26.887499999999996 46-47 26.625 23.2125 22.8125 27.35 48-49 26.3 22.475 23.6125 27.6125 50-51 27.3625 22.9375 23.2125 26.487500000000004 52-53 27.125 23.0125 22.8 27.0625 54-55 26.887499999999996 23.1625 22.9625 26.987499999999997 56-57 26.450000000000003 24.0 22.925 26.625 58-59 26.487500000000004 23.6625 22.925 26.924999999999997 60-61 26.35 23.3875 22.825 27.437499999999996 62-63 26.075 23.2375 24.224999999999998 26.4625 64-65 26.687499999999996 22.875 22.662499999999998 27.775 66-67 26.674999999999997 23.849999999999998 22.975 26.5 68-69 26.525 23.9125 23.225 26.337500000000002 70-71 25.9875 22.6 24.05 27.3625 72-73 26.400000000000002 23.5625 23.7125 26.325 74-75 26.7625 22.9625 22.7375 27.537499999999998 76-77 26.637499999999996 23.775 22.875 26.7125 78-79 26.25 23.7375 23.1 26.9125 80-81 27.950000000000003 22.8 23.8125 25.4375 82-83 26.525 23.674999999999997 23.425 26.375 84-85 25.937500000000004 22.6125 24.3125 27.1375 86-87 26.887499999999996 23.2625 23.35 26.5 88-89 26.9125 22.900000000000002 23.3625 26.825 90-91 27.537499999999998 23.65 22.525000000000002 26.2875 92-93 26.637499999999996 23.575 23.425 26.3625 94-95 27.9125 23.0 22.25 26.8375 96-97 27.6 22.3875 23.3375 26.674999999999997 98-99 27.224999999999998 22.55 23.225 27.0 100 27.35 22.075 23.200000000000003 27.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 1.5 28 1.0 29 2.0 30 4.0 31 5.0 32 6.0 33 7.0 34 10.0 35 23.0 36 39.0 37 45.5 38 56.0 39 80.5 40 90.5 41 101.5 42 124.0 43 146.0 44 149.5 45 137.0 46 145.0 47 150.5 48 149.5 49 145.0 50 139.5 51 137.0 52 116.5 53 101.0 54 95.5 55 85.5 56 91.5 57 101.5 58 96.0 59 88.0 60 85.5 61 81.0 62 84.5 63 90.0 64 94.5 65 101.5 66 96.0 67 88.0 68 87.0 69 82.0 70 74.0 71 65.0 72 54.0 73 51.5 74 50.0 75 44.0 76 33.0 77 20.0 78 15.0 79 11.0 80 7.5 81 4.5 82 2.0 83 2.0 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.15 0.0 0.0 0.0 0.025 88 0.15 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569441 spots for SRR8618256.sra Written 569441 spots for SRR8618256.sra Read 569448 spots for SRR8618256.sra Written 569448 spots for SRR8618256.sra SRR ids: ['SRR8618256.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vg4u9owv SRR8618256.sra spots: 11388827 blocks: [[1, 569441], [569442, 1138882], [1138883, 1708323], [1708324, 2277764], [2277765, 2847205], [2847206, 3416646], [3416647, 3986087], [3986088, 4555528], [4555529, 5124969], [5124970, 5694410], [5694411, 6263851], [6263852, 6833292], [6833293, 7402733], [7402734, 7972174], [7972175, 8541615], [8541616, 9111056], [9111057, 9680497], [9680498, 10249938], [10249939, 10819379], [10819380, 11388827]] SRR8618256 file size 2964052 SRR8618256 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618256 SRR8618256_1.fastq SRR8618256_2.fastq Input file: SRR8618256_1.fastq Paired file: SRR8618256_2.fastq trimmed: SRR8618256-trimmed-pair1.fastq, SRR8618256-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:07:44 2024 >> started Sat Dec 7 11:07:54 2024 >> done (10.115s) 11388827 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11388827 (100.00%) read pairs available; of these: 1353841 (11.89%) trimmed read pairs available after processing 10034986 (88.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 80 1 0.00% 81 6 0.00% 82 27 0.00% 83 67 0.00% 84 4393 0.04% 85 4685 0.04% 86 5048 0.04% 87 5472 0.05% 88 6526 0.06% 89 8175 0.07% 90 14758 0.13% 91 28750 0.25% 92 42286 0.37% 93 58455 0.51% 94 79361 0.70% 95 102296 0.90% 96 134210 1.18% 97 187721 1.65% 98 277165 2.43% 99 394439 3.46% 100 10034986 88.11% 11388827 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=1.9 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=255.95 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=25.7 sequence=CGCCGCCGCCGG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=97.66 fanout-score-rank=6 prefix-density=1.03 prefix-fanout=16.6 sequence=GGCGGCGGCGGCCTCG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=256.81 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=25.3 sequence=CGCCGCCGCCGG SRR8618256 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:08:25 Started mapping on | Dec 07 11:08:26 Finished on | Dec 07 11:08:59 Mapping speed, Million of reads per hour | 1242.42 Number of input reads | 11388827 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11165081 Uniquely mapped reads % | 98.04% Average mapped length | 198.49 Number of splices: Total | 6985442 Number of splices: Annotated (sjdb) | 6639665 Number of splices: GT/AG | 6891323 Number of splices: GC/AG | 81674 Number of splices: AT/AC | 2712 Number of splices: Non-canonical | 9733 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.13 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 113315 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 6126 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 110431 110431 110431 N_multimapping 113315 113315 113315 N_noFeature 281826 5587878 5669145 N_ambiguous 220965 15761 16314 UnstrandedReadsAssigned:10662290 PositiveStrandReadsAssigned:5561442 NegativeStrandReadsAssigned:5479622 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618256 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618256-trimmed-pair1.fastq SRR8618256-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,388,827 reads, 10,932,308 reads pseudoaligned [quant] estimated average fragment length: 167.163 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 SRR8618256.ke.tsv 35125 SRR8618256.se.tsv 88098 total ==> SRR8618256.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.015 0 0 PNS24247 1044 877.837 22.1612 3.26854 PNS24249 1928 1761.84 95.0901 6.98787 PNS24246 1044 877.837 22.1612 3.26854 PNS24248 1044 877.837 22.1612 3.26854 PNS24244 1471 1304.84 12.4264 1.233 PNS24243 293 134.328 12 11.5662 KQK14069 1603 1436.84 1738.58 156.661 KQK14071 474 309.419 156.857 65.6346 ==> SRR8618256.se.tsv <== BRADI_1g14170v3 2008 BRADI_1g53295v3 28 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 296 BRADI_1g74790v3 94 BRADI_1g09890v3 0 BRADI_1g77505v3 155 BRADI_1g48960v3 0 SRR8618256 completed mapping pipeline successfully