Starting /dee2/code/volunteer_pipeline.sh SRR8618257 current disk space = 1543219462144 free memory = 1603012004 SRR8618257 SRAfilesize a6436705cee9d06d2401ed6a4afcab97 SRR8618257.sra SRR8618257.sra file validated SRR8618257 is paired end SRR8618257 is conventional basespace SRR8618257 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618257_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06475 34.0 31.0 34.0 31.0 34.0 2 33.25325 34.0 34.0 34.0 31.0 34.0 3 33.30725 34.0 34.0 34.0 31.0 34.0 4 32.01875 37.0 37.0 37.0 2.0 37.0 5 34.206 37.0 35.0 37.0 19.0 37.0 6 35.79525 37.0 35.0 37.0 32.0 37.0 7 36.218 37.0 35.0 37.0 35.0 37.0 8 36.427 37.0 37.0 37.0 35.0 37.0 9 38.415 39.0 39.0 39.0 37.0 39.0 10-11 38.4215 39.0 39.0 39.0 37.0 39.0 12-13 38.411874999999995 39.0 39.0 39.0 37.0 39.0 14-15 39.99325 41.0 40.0 41.0 38.0 41.0 16-17 40.0015 41.0 40.0 41.0 38.0 41.0 18-19 39.912 41.0 40.0 41.0 38.0 41.0 20-21 39.866749999999996 41.0 40.0 41.0 38.0 41.0 22-23 39.777125 41.0 40.0 41.0 37.5 41.0 24-25 39.664500000000004 41.0 40.0 41.0 37.0 41.0 26-27 39.554 41.0 39.0 41.0 37.0 41.0 28-29 39.3845 40.5 39.0 41.0 36.0 41.0 30-31 39.158874999999995 40.0 38.5 41.0 35.5 41.0 32-33 39.16 40.0 38.5 41.0 35.0 41.0 34-35 39.3775 41.0 39.0 41.0 36.0 41.0 36-37 39.447500000000005 41.0 39.0 41.0 35.5 41.0 38-39 39.26575 41.0 39.0 41.0 35.0 41.0 40-41 39.146125 40.5 38.0 41.0 35.0 41.0 42-43 38.956625 40.0 38.0 41.0 35.0 41.0 44-45 38.787625000000006 40.0 37.5 41.0 35.0 41.0 46-47 38.617125 40.0 37.0 41.0 35.0 41.0 48-49 38.432375 40.0 36.5 41.0 35.0 41.0 50-51 38.192625 40.0 35.5 41.0 34.0 41.0 52-53 38.037625000000006 40.0 35.0 41.0 34.0 41.0 54-55 37.80375 39.0 35.0 41.0 34.0 41.0 56-57 37.61 39.0 35.0 41.0 33.5 41.0 58-59 37.384625 38.5 35.0 41.0 33.0 41.0 60-61 37.172375 38.0 35.0 40.5 33.0 41.0 62-63 36.849375 37.0 35.0 40.0 33.0 41.0 64-65 36.516125 37.0 35.0 40.0 33.0 41.0 66-67 36.234750000000005 36.0 35.0 39.0 33.0 41.0 68-69 35.914500000000004 35.0 35.0 39.0 32.0 41.0 70-71 35.57 35.0 35.0 38.5 32.0 40.0 72-73 35.17575 35.0 34.0 37.0 31.5 39.5 74-75 34.872749999999996 35.0 34.0 37.0 31.0 39.0 76-77 34.088750000000005 35.0 33.5 36.0 30.0 39.0 78-79 34.460499999999996 35.0 34.0 36.0 31.0 37.0 80-81 34.271625 35.0 34.0 35.5 31.0 37.0 82-83 34.085625 35.0 34.0 35.0 31.0 36.5 84-85 33.77612499999999 35.0 34.0 35.0 30.5 36.0 86-87 33.6185 35.0 34.0 35.0 30.0 36.0 88-89 33.40975 35.0 33.5 35.0 30.0 36.0 90-91 33.166875000000005 35.0 33.0 35.0 29.0 35.0 92-93 33.073625 35.0 33.0 35.0 29.0 35.0 94-95 32.89725 35.0 33.0 35.0 29.0 35.0 96-97 32.684625 35.0 33.0 35.0 29.0 35.0 98-99 32.40325 35.0 33.0 35.0 29.0 35.0 100 32.10325 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 0.14054774662835712 1101 2 0.032745722347343076 1101 3 0.009538971292485598 1101 4 -5.247417876834664 1101 5 -2.698726411431238 1101 6 -0.8697030881934182 1101 7 -0.260995055784214 1101 8 -0.14694157541870112 1101 9 -0.10034687168336376 1101 10-11 -0.04964924542466065 1101 12-13 0.12205870932670138 1101 14-15 0.008451761538658786 1101 16-17 0.053305635370556104 1101 18-19 0.09838601123450275 1101 20-21 0.061776811369107065 1101 22-23 -0.05496880743444166 1101 24-25 -0.04173461727628336 1101 26-27 -0.07930159716290319 1101 28-29 -0.06787295177448271 1101 30-31 -0.07759312469260493 1101 32-33 -0.2014638502756867 1101 34-35 0.04383785043099664 1101 36-37 0.14190675882063175 1101 38-39 0.00570137972094642 1101 40-41 -0.1281289637855636 1101 42-43 -0.14997670264813223 1101 44-45 -0.14611969661670798 1101 46-47 -0.024533405813983222 1101 48-49 0.07754782428619222 1101 50-51 -0.01043850793404033 1101 52-53 0.13599182004089272 1101 54-55 -0.09337060909631845 1101 56-57 -0.039747870880901814 1101 58-59 0.0259636043591982 1101 60-61 0.09091144417695318 1101 62-63 -0.06272811990370286 1101 64-65 -0.07112163806269933 1101 66-67 0.03357407263596457 1101 68-69 0.15362662110740644 1101 70-71 0.0918756956848128 1101 72-73 -0.1332349667365591 1101 74-75 0.10537521679480477 1101 76-77 0.11866117884600413 1101 78-79 -0.08427817038129604 1101 80-81 -0.08479588931168536 1101 82-83 -0.09712407134166767 1101 84-85 -0.1453948901141615 1101 86-87 -0.3352035929693784 1101 88-89 -0.14747870880898262 1101 90-91 -0.1411625378582002 1101 92-93 -0.4278299811032582 1101 94-95 -0.5176348010664995 1101 96-97 -0.4218956278636341 1101 98-99 -0.501960860448861 1101 100 -0.24006626802308872 1104 1 -0.14054774662835712 1104 2 -0.03274572234733597 1104 3 -0.009538971292485598 1104 4 5.2474178768346675 1104 5 2.698726411431231 1104 6 0.8697030881934182 1104 7 0.260995055784214 1104 8 0.14694157541870823 1104 9 0.10034687168336376 1104 10-11 0.04964924542465354 1104 12-13 -0.12205870932670848 1104 14-15 -0.008451761538658786 1104 16-17 -0.053305635370556104 1104 18-19 -0.09838601123450275 1104 20-21 -0.061776811369107065 1104 22-23 0.05496880743444166 1104 24-25 0.04173461727628336 1104 26-27 0.07930159716289609 1104 28-29 0.06787295177447561 1104 30-31 0.07759312469260493 1104 32-33 0.2014638502756867 1104 34-35 -0.04383785043099664 1104 36-37 -0.14190675882063886 1104 38-39 -0.00570137972094642 1104 40-41 0.1281289637855636 1104 42-43 0.14997670264813223 1104 44-45 0.14611969661670798 1104 46-47 0.024533405813990328 1104 48-49 -0.07754782428619933 1104 50-51 0.01043850793404033 1104 52-53 -0.13599182004089982 1104 54-55 0.09337060909632555 1104 56-57 0.039747870880901814 1104 58-59 -0.025963604359191095 1104 60-61 -0.09091144417696029 1104 62-63 0.06272811990370286 1104 64-65 0.07112163806269933 1104 66-67 -0.03357407263596457 1104 68-69 -0.15362662110739933 1104 70-71 -0.0918756956848128 1104 72-73 0.1332349667365591 1104 74-75 -0.10537521679479767 1104 76-77 -0.11866117884600413 1104 78-79 0.08427817038129604 1104 80-81 0.08479588931169246 1104 82-83 0.09712407134167478 1104 84-85 0.1453948901141544 1104 86-87 0.3352035929693784 1104 88-89 0.14747870880898972 1104 90-91 0.1411625378581931 1104 92-93 0.4278299811032653 1104 94-95 0.5176348010664995 1104 96-97 0.4218956278636341 1104 98-99 0.501960860448861 1104 100 0.24006626802308872 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 5.0 27 8.0 28 14.0 29 32.0 30 42.0 31 65.0 32 126.0 33 150.0 34 225.0 35 365.0 36 686.0 37 979.0 38 1100.0 39 203.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.125 11.899999999999999 14.274999999999999 45.7 2 26.325 17.424999999999997 32.9 23.35 3 26.174999999999997 22.825 24.975 26.025 4 28.18443804034582 26.829971181556196 16.97406340057637 28.01152737752161 5 29.225 30.475 19.45 20.849999999999998 6 22.789882294014525 33.33333333333333 20.235411970949162 23.64137240170298 7 20.549999999999997 15.725 38.9 24.825 8 21.925 21.3 25.874999999999996 30.9 9 23.974999999999998 20.375 28.449999999999996 27.200000000000003 10-11 25.937500000000004 28.4 19.9875 25.674999999999997 12-13 23.6625 23.1875 26.6125 26.5375 14-15 25.2375 24.0125 24.725 26.025 16-17 25.937500000000004 23.65 24.675 25.7375 18-19 25.624999999999996 24.587500000000002 23.5625 26.224999999999998 20-21 25.4 24.25 24.099999999999998 26.25 22-23 25.687500000000004 24.587500000000002 24.425 25.3 24-25 25.4 23.8125 24.3 26.487500000000004 26-27 25.874999999999996 24.6625 23.8375 25.624999999999996 28-29 25.95 23.7375 24.762500000000003 25.55 30-31 24.725 25.1875 23.65 26.437500000000004 32-33 25.025 25.5 23.9375 25.5375 34-35 25.900000000000002 24.1625 24.1375 25.8 36-37 25.412499999999998 24.1375 24.2 26.25 38-39 25.124999999999996 25.3125 23.8125 25.75 40-41 25.275 25.2625 23.4125 26.05 42-43 24.7 25.0375 24.6 25.662499999999998 44-45 26.1 24.125 23.5125 26.2625 46-47 25.7375 24.087500000000002 24.4 25.775 48-49 25.2375 23.6625 25.124999999999996 25.974999999999998 50-51 25.4375 23.549999999999997 25.0625 25.95 52-53 25.525 23.5375 24.825 26.1125 54-55 24.125 25.074999999999996 24.95 25.85 56-57 26.137500000000003 24.6 23.4375 25.825 58-59 25.974999999999998 24.1375 24.212500000000002 25.674999999999997 60-61 25.124999999999996 23.799999999999997 24.575 26.5 62-63 25.5 25.2875 24.275 24.9375 64-65 25.387500000000003 23.974999999999998 24.337500000000002 26.3 66-67 25.4625 24.2625 24.6 25.674999999999997 68-69 25.5375 23.775 25.1875 25.5 70-71 25.874999999999996 24.775 23.425 25.924999999999997 72-73 25.5125 23.6625 25.074999999999996 25.75 74-75 25.825 24.087500000000002 24.875 25.2125 76-77 25.174999999999997 24.45 24.7875 25.587500000000002 78-79 25.7625 24.25 24.15 25.837500000000002 80-81 25.887500000000003 23.575 24.9375 25.6 82-83 24.6875 24.975 24.2 26.137500000000003 84-85 26.05 24.5375 24.762500000000003 24.65 86-87 26.0625 24.1375 24.0 25.8 88-89 26.1625 24.025 23.7125 26.1 90-91 26.325 24.6625 23.925 25.087500000000002 92-93 25.412499999999998 24.625 24.3125 25.650000000000002 94-95 24.925 24.587500000000002 24.425 26.0625 96-97 25.7375 24.25 24.5125 25.5 98-99 26.5125 23.6375 24.575 25.275 100 26.3 24.2 23.825 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 1.0 28 2.0 29 4.0 30 5.5 31 8.0 32 9.5 33 16.0 34 21.5 35 27.5 36 37.5 37 57.0 38 75.0 39 91.0 40 110.0 41 120.5 42 135.5 43 165.0 44 173.5 45 173.0 46 196.0 47 185.5 48 164.0 49 171.5 50 173.0 51 152.0 52 129.0 53 108.0 54 95.0 55 96.5 56 89.0 57 75.5 58 70.5 59 74.5 60 78.5 61 82.0 62 78.0 63 61.5 64 59.0 65 67.0 66 69.5 67 68.5 68 57.0 69 49.5 70 54.0 71 51.0 72 44.5 73 43.0 74 34.5 75 23.0 76 18.5 77 15.5 78 11.5 79 8.5 80 5.0 81 2.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 13.25 5 0.0 6 0.17500000000000002 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618257 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618257_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.893 33.0 31.0 34.0 30.0 34.0 2 32.889 34.0 31.0 34.0 31.0 34.0 3 33.0585 34.0 33.0 34.0 31.0 34.0 4 36.50425 37.0 37.0 37.0 35.0 37.0 5 36.533 37.0 37.0 37.0 35.0 37.0 6 36.5265 37.0 37.0 37.0 35.0 37.0 7 36.4925 37.0 37.0 37.0 35.0 37.0 8 36.56075 37.0 37.0 37.0 35.0 37.0 9 38.39375 39.0 39.0 39.0 37.0 39.0 10-11 38.375125 39.0 39.0 39.0 37.0 39.0 12-13 38.3085 39.0 39.0 39.0 37.0 39.0 14-15 39.938874999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.9045 41.0 40.0 41.0 38.0 41.0 18-19 39.88425 41.0 40.0 41.0 38.0 41.0 20-21 39.8775 41.0 40.0 41.0 38.0 41.0 22-23 39.779625 41.0 40.0 41.0 37.5 41.0 24-25 39.666624999999996 41.0 40.0 41.0 37.0 41.0 26-27 39.636750000000006 41.0 40.0 41.0 37.0 41.0 28-29 39.473124999999996 41.0 39.0 41.0 36.5 41.0 30-31 39.414 41.0 39.0 41.0 36.0 41.0 32-33 39.384875 41.0 39.0 41.0 36.0 41.0 34-35 39.283125 41.0 39.0 41.0 35.5 41.0 36-37 39.216 40.5 38.5 41.0 35.0 41.0 38-39 38.999624999999995 40.0 38.0 41.0 35.0 41.0 40-41 38.748625 40.0 38.0 41.0 35.0 41.0 42-43 38.651624999999996 40.0 38.0 41.0 35.0 41.0 44-45 38.34825 40.0 36.5 41.0 34.5 41.0 46-47 38.213125000000005 40.0 36.5 41.0 34.0 41.0 48-49 38.114625 40.0 36.0 41.0 33.5 41.0 50-51 37.679 39.0 35.5 40.5 33.5 41.0 52-53 37.743125 39.0 35.0 40.5 33.5 41.0 54-55 37.948125000000005 39.0 35.0 41.0 34.0 41.0 56-57 37.769875 39.0 35.0 41.0 34.0 41.0 58-59 37.589875 39.0 35.0 41.0 34.0 41.0 60-61 37.3375 38.0 35.0 41.0 33.5 41.0 62-63 37.102500000000006 37.5 35.0 41.0 33.0 41.0 64-65 36.7705 37.0 35.0 40.0 33.0 41.0 66-67 36.51075 36.5 35.0 39.5 33.0 41.0 68-69 36.107875 36.0 35.0 39.0 32.5 41.0 70-71 35.780125 35.0 35.0 39.0 32.0 40.5 72-73 35.531875 35.0 35.0 37.5 32.0 39.5 74-75 35.128 35.0 34.5 37.0 31.5 39.0 76-77 34.806625 35.0 34.0 36.5 31.0 39.0 78-79 34.46425 35.0 34.0 36.0 31.0 37.5 80-81 34.312 35.0 34.0 36.0 31.0 37.0 82-83 34.089 35.0 34.0 35.0 31.0 37.0 84-85 33.832125 35.0 34.0 35.0 31.0 36.0 86-87 33.601749999999996 35.0 34.0 35.0 30.0 36.0 88-89 33.445499999999996 35.0 33.5 35.0 30.0 36.0 90-91 33.19775 35.0 33.0 35.0 29.5 35.0 92-93 32.935 35.0 33.0 35.0 29.0 35.0 94-95 32.6015 35.0 33.0 35.0 29.0 35.0 96-97 32.4865 35.0 33.0 35.0 29.0 35.0 98-99 32.142125 35.0 33.0 35.0 27.0 35.0 100 31.805 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.30400455592658915 1101 2 0.07461624084284324 1101 3 0.12040848023607964 1101 4 0.10479925448473892 1101 5 0.04285418446325906 1101 6 0.005280733090003764 1101 7 0.013926639227562987 1101 8 0.006238513111227917 1101 9 -0.020022779632938636 1101 10-11 0.018437265408607573 1101 12-13 -0.10111697859232294 1101 14-15 0.03405296264658375 1101 16-17 0.07990344541948247 1101 18-19 0.179240765188581 1101 20-21 0.06352411275918968 1101 22-23 0.05623721881390509 1101 24-25 0.035470218218527805 1101 26-27 0.14536253268100552 1101 28-29 0.021498278584559216 1101 30-31 -0.046193471564293986 1101 32-33 -0.07149698428722928 1101 34-35 0.12018197820403032 1101 36-37 0.11061712096502418 1101 38-39 0.13497579664000625 1101 40-41 -0.1707307602702528 1101 42-43 0.12449198829955321 1101 44-45 -0.04359193393906935 1101 46-47 0.05241257021562973 1101 48-49 0.0023232637001413536 1101 50-51 0.009739587378007286 1101 52-53 0.20214335637182046 1101 54-55 0.23064378348994552 1101 56-57 0.16834278170381367 1101 58-59 0.1985775672387433 1101 60-61 0.10993114338226206 1101 62-63 0.09427661722450864 1101 64-65 -0.018087805130598156 1101 66-67 -0.1162278998731594 1101 68-69 0.0020902901814565666 1101 70-71 0.023705055525354624 1101 72-73 -0.10393854676296144 1101 74-75 0.18795785767906636 1101 76-77 0.10539463125468984 1101 78-79 0.08266677021045155 1101 80-81 -0.05076881261163635 1101 82-83 0.1465597577075357 1101 84-85 0.23703761228029663 1101 86-87 -0.051985452098058715 1101 88-89 -0.06015893971163422 1101 90-91 0.19542595324998047 1101 92-93 -0.11891356682457399 1101 94-95 0.07519220315290909 1101 96-97 0.01672232145168806 1101 98-99 -0.05302088995883736 1101 100 -0.2897802283140507 1104 1 -0.3040045559265856 1104 2 -0.07461624084284324 1104 3 -0.12040848023607964 1104 4 -0.10479925448473892 1104 5 -0.042854184463251954 1104 6 -0.005280733090003764 1104 7 -0.013926639227562987 1104 8 -0.006238513111235022 1104 9 0.020022779632938636 1104 10-11 -0.018437265408607573 1104 12-13 0.10111697859232294 1104 14-15 -0.034052962646576646 1104 16-17 -0.07990344541948247 1104 18-19 -0.179240765188581 1104 20-21 -0.06352411275918257 1104 22-23 -0.05623721881391219 1104 24-25 -0.035470218218527805 1104 26-27 -0.14536253268101262 1104 28-29 -0.021498278584559216 1104 30-31 0.04619347156428688 1104 32-33 0.07149698428722928 1104 34-35 -0.12018197820403742 1104 36-37 -0.11061712096503129 1104 38-39 -0.13497579663999915 1104 40-41 0.1707307602702457 1104 42-43 -0.12449198829955321 1104 44-45 0.043591933939062244 1104 46-47 -0.05241257021562973 1104 48-49 -0.002323263700134248 1104 50-51 -0.009739587378007286 1104 52-53 -0.20214335637182756 1104 54-55 -0.23064378348994552 1104 56-57 -0.16834278170381367 1104 58-59 -0.1985775672387433 1104 60-61 -0.10993114338226206 1104 62-63 -0.09427661722450154 1104 64-65 0.01808780513059105 1104 66-67 0.1162278998731594 1104 68-69 -0.0020902901814565666 1104 70-71 -0.023705055525354624 1104 72-73 0.10393854676296144 1104 74-75 -0.18795785767906636 1104 76-77 -0.10539463125468984 1104 78-79 -0.08266677021045865 1104 80-81 0.05076881261163635 1104 82-83 -0.1465597577075357 1104 84-85 -0.23703761228028952 1104 86-87 0.051985452098058715 1104 88-89 0.06015893971163422 1104 90-91 -0.19542595324998047 1104 92-93 0.11891356682456689 1104 94-95 -0.07519220315290909 1104 96-97 -0.016722321451680955 1104 98-99 0.05302088995883736 1104 100 0.2897802283140436 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 14.0 28 20.0 29 36.0 30 50.0 31 56.0 32 95.0 33 162.0 34 216.0 35 380.0 36 649.0 37 909.0 38 1178.0 39 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.950000000000003 9.525 15.75 46.775 2 25.825 17.175 32.7 24.3 3 26.174999999999997 22.575 23.599999999999998 27.650000000000002 4 28.575 26.924999999999997 17.7 26.8 5 28.075 31.525 19.3 21.099999999999998 6 22.05 33.2 19.575 25.174999999999997 7 19.35 16.075 39.25 25.324999999999996 8 21.85 20.724999999999998 25.674999999999997 31.75 9 22.775000000000002 20.05 27.500000000000004 29.675 10-11 25.84396099024756 28.157039259814955 19.517379344836208 26.481620405101275 12-13 23.2375 22.15 26.650000000000002 27.962500000000002 14-15 25.0 25.174999999999997 24.025 25.8 16-17 25.7125 23.6375 23.9125 26.737499999999997 18-19 24.6 25.224999999999998 23.6625 26.5125 20-21 25.174999999999997 24.762500000000003 23.95 26.1125 22-23 25.4 24.8125 23.6125 26.174999999999997 24-25 25.75 24.9125 23.8375 25.5 26-27 26.0625 24.587500000000002 24.3125 25.0375 28-29 25.8625 23.9 23.775 26.4625 30-31 24.762500000000003 24.8625 24.675 25.7 32-33 24.962500000000002 24.825 24.2375 25.974999999999998 34-35 25.3125 24.625 23.9 26.1625 36-37 25.112499999999997 24.55 24.2625 26.075 38-39 25.05 25.1875 23.474999999999998 26.2875 40-41 25.05 23.8375 24.8125 26.3 42-43 25.4 24.962500000000002 24.3125 25.324999999999996 44-45 25.275 23.925 24.5375 26.2625 46-47 25.924999999999997 24.224999999999998 23.5625 26.2875 48-49 24.887500000000003 23.9 25.124999999999996 26.087500000000002 50-51 25.137500000000003 24.775 24.15 25.937500000000004 52-53 25.9625 24.5625 24.4875 24.9875 54-55 25.25 24.275 24.8125 25.662499999999998 56-57 25.424999999999997 25.2625 23.1625 26.150000000000002 58-59 24.9 25.5 23.599999999999998 26.0 60-61 25.374999999999996 23.799999999999997 25.2875 25.5375 62-63 25.900000000000002 24.349999999999998 24.125 25.624999999999996 64-65 24.7375 25.0125 24.4 25.85 66-67 25.6125 24.375 24.1125 25.900000000000002 68-69 24.8125 25.0 24.025 26.1625 70-71 25.025 25.0125 23.6375 26.325 72-73 24.2625 24.95 25.05 25.7375 74-75 25.775 24.9 24.099999999999998 25.224999999999998 76-77 26.05 24.7 24.1125 25.137500000000003 78-79 25.8 23.8125 24.224999999999998 26.1625 80-81 26.0375 24.8 24.625 24.5375 82-83 26.325 24.4125 24.375 24.887500000000003 84-85 25.8 24.675 23.95 25.575 86-87 25.35 24.9875 24.175 25.4875 88-89 26.5125 24.4875 24.462500000000002 24.5375 90-91 25.9875 23.8875 24.175 25.95 92-93 26.0375 24.95 23.7625 25.25 94-95 26.8375 24.637500000000003 23.2125 25.3125 96-97 26.0125 24.0625 24.587500000000002 25.337500000000002 98-99 26.025 24.712500000000002 23.849999999999998 25.412499999999998 100 26.8 23.400000000000002 24.4 25.4 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 1.5 28 0.5 29 1.5 30 4.0 31 6.5 32 10.0 33 14.0 34 17.5 35 27.5 36 40.0 37 57.5 38 72.0 39 89.0 40 111.5 41 133.0 42 159.0 43 165.0 44 163.0 45 164.0 46 181.5 47 187.5 48 178.5 49 181.5 50 170.0 51 142.5 52 116.0 53 110.5 54 103.5 55 91.0 56 89.5 57 73.5 58 70.0 59 79.0 60 70.0 61 69.0 62 76.0 63 77.0 64 73.0 65 65.0 66 61.0 67 63.0 68 59.0 69 51.0 70 50.0 71 53.5 72 47.0 73 38.5 74 34.5 75 30.5 76 22.0 77 13.5 78 9.5 79 7.0 80 5.5 81 5.0 82 4.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.025 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra Read 580141 spots for SRR8618257.sra Written 580141 spots for SRR8618257.sra SRR ids: ['SRR8618257.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f53d_kdu SRR8618257.sra spots: 11602820 blocks: [[1, 580141], [580142, 1160282], [1160283, 1740423], [1740424, 2320564], [2320565, 2900705], [2900706, 3480846], [3480847, 4060987], [4060988, 4641128], [4641129, 5221269], [5221270, 5801410], [5801411, 6381551], [6381552, 6961692], [6961693, 7541833], [7541834, 8121974], [8121975, 8702115], [8702116, 9282256], [9282257, 9862397], [9862398, 10442538], [10442539, 11022679], [11022680, 11602820]] SRR8618257 file size 3019946 SRR8618257 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618257 SRR8618257_1.fastq SRR8618257_2.fastq Input file: SRR8618257_1.fastq Paired file: SRR8618257_2.fastq trimmed: SRR8618257-trimmed-pair1.fastq, SRR8618257-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:13:43 2024 >> started Sat Dec 7 11:13:54 2024 >> done (10.607s) 11602820 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11602820 (100.00%) read pairs available; of these: 1259400 (10.85%) trimmed read pairs available after processing 10343420 (89.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 0 0.00% 59 0 0.00% 60 0 0.00% 61 0 0.00% 62 0 0.00% 63 0 0.00% 64 0 0.00% 65 0 0.00% 66 0 0.00% 67 0 0.00% 68 0 0.00% 69 0 0.00% 70 0 0.00% 71 0 0.00% 72 0 0.00% 73 0 0.00% 74 0 0.00% 75 0 0.00% 76 0 0.00% 77 1 0.00% 78 1 0.00% 79 0 0.00% 80 1 0.00% 81 12 0.00% 82 20 0.00% 83 71 0.00% 84 5008 0.04% 85 5268 0.05% 86 5537 0.05% 87 5973 0.05% 88 7143 0.06% 89 8836 0.08% 90 14979 0.13% 91 27391 0.24% 92 39692 0.34% 93 54485 0.47% 94 72767 0.63% 95 93889 0.81% 96 122773 1.06% 97 170673 1.47% 98 254624 2.19% 99 370255 3.19% 100 10343420 89.15% 11602820 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=91.57 fanout-score-rank=7 prefix-density=0.88 prefix-fanout=15.8 sequence=GGCGGCGGCGGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=298.88 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=23.7 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=83.66 fanout-score-rank=7 prefix-density=0.92 prefix-fanout=15.2 sequence=GGCGGCGGCGGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=302.22 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=24.3 sequence=CGCCGCCGCCGA SRR8618257 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:14:26 Started mapping on | Dec 07 11:14:27 Finished on | Dec 07 11:14:53 Mapping speed, Million of reads per hour | 1606.54 Number of input reads | 11602820 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11358051 Uniquely mapped reads % | 97.89% Average mapped length | 198.55 Number of splices: Total | 7601677 Number of splices: Annotated (sjdb) | 7204061 Number of splices: GT/AG | 7497294 Number of splices: GC/AG | 89390 Number of splices: AT/AC | 3727 Number of splices: Non-canonical | 11266 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 127218 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 5791 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 117551 117551 117551 N_multimapping 127218 127218 127218 N_noFeature 399528 5737572 5840109 N_ambiguous 206563 14143 13885 UnstrandedReadsAssigned:10751960 PositiveStrandReadsAssigned:5606336 NegativeStrandReadsAssigned:5504057 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618257 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618257-trimmed-pair1.fastq SRR8618257-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,602,820 reads, 11,029,052 reads pseudoaligned [quant] estimated average fragment length: 169.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR8618257.ke.tsv 35125 SRR8618257.se.tsv 88098 total ==> SRR8618257.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 767.717 0 0 PNS24247 1044 875.525 30.0759 4.69678 PNS24249 1928 1759.52 124.106 9.64382 PNS24246 1044 875.525 30.0759 4.69678 PNS24248 1044 875.525 30.0759 4.69678 PNS24244 1471 1302.52 18.6658 1.95934 PNS24243 293 133.898 18 18.3801 KQK14069 1603 1434.52 869.35 82.8583 KQK14071 474 307.544 83.4751 37.1108 ==> SRR8618257.se.tsv <== BRADI_1g14170v3 1028 BRADI_1g53295v3 71 BRADI_1g59795v3 229 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 385 BRADI_1g74790v3 203 BRADI_1g09890v3 0 BRADI_1g77505v3 205 BRADI_1g48960v3 0 SRR8618257 completed mapping pipeline successfully