Starting /dee2/code/volunteer_pipeline.sh SRR8618258 current disk space = 1543105560576 free memory = 1595087264 SRR8618258 SRAfilesize 44b044119628f45b9c2f3c4ae31a1b8f SRR8618258.sra SRR8618258.sra file validated SRR8618258 is paired end SRR8618258 is conventional basespace SRR8618258 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618258_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.28225 33.0 31.0 34.0 2.0 34.0 2 30.6005 34.0 31.0 34.0 16.0 34.0 3 32.30175 34.0 31.0 34.0 28.0 34.0 4 36.20575 37.0 35.0 37.0 35.0 37.0 5 36.22425 37.0 35.0 37.0 35.0 37.0 6 36.4005 37.0 37.0 37.0 35.0 37.0 7 36.3715 37.0 37.0 37.0 35.0 37.0 8 36.3115 37.0 37.0 37.0 35.0 37.0 9 38.16725 39.0 38.0 39.0 37.0 39.0 10-11 38.18725 39.0 38.5 39.0 37.0 39.0 12-13 38.100375 39.0 38.0 39.0 35.0 39.0 14-15 39.513374999999996 41.0 39.0 41.0 37.0 41.0 16-17 39.49375 41.0 39.0 41.0 37.0 41.0 18-19 39.472125000000005 40.0 39.0 41.0 36.5 41.0 20-21 39.441 40.0 39.0 41.0 36.5 41.0 22-23 39.31275 40.0 39.0 41.0 36.0 41.0 24-25 39.166875000000005 40.0 39.0 41.0 36.0 41.0 26-27 39.1365 40.0 39.0 41.0 36.0 41.0 28-29 38.8845 40.0 38.0 41.0 35.0 41.0 30-31 38.667500000000004 40.0 38.0 41.0 35.0 41.0 32-33 38.5035 40.0 38.0 41.0 34.0 41.0 34-35 38.38225 40.0 38.0 41.0 34.0 41.0 36-37 38.229124999999996 40.0 37.5 41.0 33.0 41.0 38-39 37.860375 39.5 37.0 41.0 33.0 41.0 40-41 38.192125000000004 40.0 37.0 41.0 33.5 41.0 42-43 38.275499999999994 40.0 37.0 41.0 34.0 41.0 44-45 38.154375 40.0 36.5 41.0 34.0 41.0 46-47 38.086625 40.0 36.0 41.0 34.0 41.0 48-49 37.84425 39.5 35.0 41.0 33.0 41.0 50-51 37.55875 39.0 35.0 41.0 33.0 41.0 52-53 37.495125 39.0 35.0 41.0 33.0 41.0 54-55 37.263875 39.0 35.0 41.0 33.0 41.0 56-57 36.741 38.0 35.0 40.0 32.0 41.0 58-59 36.543 37.5 35.0 40.0 31.0 41.0 60-61 36.485625 37.0 35.0 40.0 31.5 41.0 62-63 36.248625 37.0 35.0 40.0 31.0 41.0 64-65 35.861125 36.0 34.0 39.5 31.0 41.0 66-67 35.61575 35.5 34.0 39.0 31.0 41.0 68-69 35.161 35.0 34.0 39.0 30.0 40.5 70-71 34.796875 35.0 34.0 37.5 29.5 40.0 72-73 34.496875 35.0 33.5 37.0 29.0 39.0 74-75 34.3295 35.0 33.5 37.0 29.5 39.0 76-77 33.01325 34.0 31.5 35.0 28.0 37.0 78-79 33.880750000000006 35.0 33.0 36.0 29.5 37.0 80-81 33.851 35.0 33.0 35.0 30.0 37.0 82-83 33.636875 35.0 33.0 35.0 29.5 36.5 84-85 33.435500000000005 35.0 33.0 35.0 29.0 36.0 86-87 33.201499999999996 35.0 33.0 35.0 29.0 36.0 88-89 32.935375 35.0 33.0 35.0 29.0 36.0 90-91 32.84975 35.0 33.0 35.0 29.0 35.0 92-93 32.600125000000006 35.0 33.0 35.0 27.5 35.0 94-95 32.531875 35.0 33.0 35.0 27.0 35.0 96-97 32.319500000000005 35.0 33.0 35.0 27.5 35.0 98-99 31.91075 35.0 32.5 35.0 27.0 35.0 100 31.69625 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality warn #Tile Base Mean 1101 1 -5.421147646679561 1101 2 -2.7468085106382993 1101 3 -0.8808510638297911 1101 4 -0.324306898774978 1101 5 -0.03346228239845317 1101 6 0.07769181173436124 1101 7 -9.026434558379037E-4 1101 8 0.2208897485493253 1101 9 0.007285622179239226 1101 10-11 0.08268858800774126 1101 12-13 0.010154738878142666 1101 14-15 0.10209542230818158 1101 16-17 -0.08700838168923042 1101 18-19 0.05022566086395841 1101 20-21 -0.02743391360412062 1101 22-23 0.1559316569954916 1101 24-25 0.19426176660219596 1101 26-27 -0.03023855577047385 1101 28-29 -0.11747259832365842 1101 30-31 -0.34036105738233857 1101 32-33 -0.020599613152803897 1101 34-35 -0.09393939393939377 1101 36-37 -0.1325596389426167 1101 38-39 -0.030496453900710208 1101 40-41 0.19629271437782592 1101 42-43 -0.14090909090909065 1101 44-45 -0.11747259832365842 1101 46-47 0.2267246937459717 1101 48-49 0.040232108317219684 1101 50-51 0.1594777562862717 1101 52-53 0.18842682140554956 1101 54-55 0.12088974854932388 1101 56-57 0.37959381044488083 1101 58-59 0.29142488716956905 1101 60-61 0.09090909090909349 1101 62-63 0.08207607994842192 1101 64-65 -0.09261766602192267 1101 66-67 0.0792714377820758 1101 68-69 0.051128304319796314 1101 70-71 -0.06173436492585438 1101 72-73 0.1567698259187651 1101 74-75 0.17598323662153348 1101 76-77 0.28961960025789324 1101 78-79 0.2518697614442331 1101 80-81 -0.03281753707285873 1101 82-83 -0.06869761444229283 1101 84-85 0.0985493230174157 1101 86-87 -0.12843326885879947 1101 88-89 -0.08217279174725434 1101 90-91 -0.3020631850419093 1101 92-93 -0.07775628626692566 1101 94-95 -0.15660863958736115 1101 96-97 -0.32275950999355274 1101 98-99 -0.21408768536428013 1101 100 -0.34455190199870955 1103 1 5.421147646679561 1103 2 2.7468085106382993 1103 3 0.8808510638297875 1103 4 0.3243068987749851 1103 5 0.03346228239845317 1103 6 -0.07769181173436834 1103 7 9.026434558379037E-4 1103 8 -0.2208897485493182 1103 9 -0.007285622179239226 1103 10-11 -0.08268858800774126 1103 12-13 -0.010154738878142666 1103 14-15 -0.10209542230818869 1103 16-17 0.08700838168923042 1103 18-19 -0.05022566086395841 1103 20-21 0.027433913604127724 1103 22-23 -0.1559316569954916 1103 24-25 -0.19426176660219596 1103 26-27 0.03023855577047385 1103 28-29 0.11747259832366552 1103 30-31 0.34036105738233147 1103 32-33 0.020599613152803897 1103 34-35 0.09393939393939377 1103 36-37 0.1325596389426167 1103 38-39 0.030496453900710208 1103 40-41 -0.1962927143778188 1103 42-43 0.14090909090909065 1103 44-45 0.11747259832366552 1103 46-47 -0.2267246937459717 1103 48-49 -0.04023210831721258 1103 50-51 -0.1594777562862717 1103 52-53 -0.18842682140554956 1103 54-55 -0.12088974854932388 1103 56-57 -0.3795938104448737 1103 58-59 -0.29142488716956905 1103 60-61 -0.09090909090909349 1103 62-63 -0.08207607994842192 1103 64-65 0.09261766602192267 1103 66-67 -0.0792714377820758 1103 68-69 -0.051128304319796314 1103 70-71 0.06173436492585438 1103 72-73 -0.1567698259187651 1103 74-75 -0.17598323662153348 1103 76-77 -0.28961960025789324 1103 78-79 -0.251869761444226 1103 80-81 0.03281753707285873 1103 82-83 0.06869761444229283 1103 84-85 -0.0985493230174086 1103 86-87 0.12843326885879947 1103 88-89 0.08217279174726144 1103 90-91 0.3020631850419093 1103 92-93 0.07775628626692566 1103 94-95 0.15660863958736826 1103 96-97 0.32275950999355274 1103 98-99 0.21408768536428013 1103 100 0.3445519019987131 >>END_MODULE >>Per sequence quality scores pass #Quality Count 26 2.0 27 23.0 28 40.0 29 56.0 30 83.0 31 108.0 32 154.0 33 214.0 34 284.0 35 465.0 36 678.0 37 934.0 38 828.0 39 131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.85643129211837 12.071491356577791 15.646059185467331 42.42601816583651 2 25.2 19.075 32.15 23.575 3 25.5 22.7 24.75 27.05 4 28.999999999999996 27.150000000000002 17.724999999999998 26.125 5 27.725 30.9 19.475 21.9 6 22.05 33.2 19.5 25.25 7 20.5 15.299999999999999 40.225 23.974999999999998 8 22.400000000000002 19.8 24.325 33.475 9 22.425 19.5 27.925 30.15 10-11 26.5125 29.362500000000004 19.3 24.825 12-13 23.549999999999997 22.3 26.424999999999997 27.725 14-15 24.5 23.175 25.6125 26.7125 16-17 26.1625 23.974999999999998 23.925 25.937500000000004 18-19 25.687500000000004 23.7375 24.3875 26.187500000000004 20-21 26.137500000000003 23.5125 24.5 25.85 22-23 25.7625 24.2625 23.775 26.200000000000003 24-25 25.8 24.75 23.45 26.0 26-27 26.025 24.337500000000002 24.2375 25.4 28-29 25.8625 23.9875 23.775 26.375 30-31 25.387500000000003 24.3125 24.3125 25.9875 32-33 26.0375 24.125 23.9 25.937500000000004 34-35 25.662499999999998 24.775 24.3125 25.25 36-37 25.55 24.2375 23.35 26.8625 38-39 25.424999999999997 24.099999999999998 24.825 25.650000000000002 40-41 25.687500000000004 23.8875 24.2875 26.137500000000003 42-43 25.95 24.525 23.1375 26.387500000000003 44-45 25.7 24.75 23.025000000000002 26.525 46-47 25.775 24.0375 23.6625 26.525 48-49 25.9625 24.8 24.099999999999998 25.137500000000003 50-51 26.5375 24.025 23.9125 25.525 52-53 25.95 25.112499999999997 23.35 25.587500000000002 54-55 24.9875 24.325 24.425 26.2625 56-57 25.2125 24.4125 24.337500000000002 26.0375 58-59 26.674999999999997 23.2625 24.712500000000002 25.35 60-61 25.6125 24.1125 24.825 25.45 62-63 26.05 24.7375 23.849999999999998 25.362499999999997 64-65 25.887500000000003 24.85 23.425 25.837500000000002 66-67 25.912499999999998 23.8375 24.25 26.0 68-69 26.150000000000002 23.75 24.55 25.55 70-71 25.8125 23.799999999999997 24.0 26.387500000000003 72-73 25.337500000000002 23.6125 25.0625 25.9875 74-75 25.8125 24.025 25.174999999999997 24.9875 76-77 26.387500000000003 24.3875 24.4 24.825 78-79 25.525 24.462500000000002 24.3125 25.7 80-81 25.674999999999997 23.6875 24.2375 26.400000000000002 82-83 25.4875 24.0125 24.1125 26.387500000000003 84-85 25.5125 24.7375 24.025 25.724999999999998 86-87 25.45 25.337500000000002 23.5625 25.650000000000002 88-89 26.4625 23.75 24.2 25.587500000000002 90-91 25.887500000000003 24.175 25.25 24.6875 92-93 25.624999999999996 24.575 24.587500000000002 25.2125 94-95 25.124999999999996 24.0375 23.962500000000002 26.875 96-97 26.650000000000002 23.95 24.125 25.275 98-99 26.924999999999997 24.5 23.549999999999997 25.025 100 26.325 23.125 25.7 24.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 6.0 29 6.0 30 4.5 31 6.0 32 8.5 33 12.5 34 21.0 35 37.5 36 46.5 37 56.5 38 76.5 39 91.5 40 112.0 41 124.5 42 137.5 43 152.0 44 157.5 45 178.5 46 179.5 47 166.0 48 167.5 49 160.5 50 151.0 51 137.5 52 125.5 53 113.0 54 102.0 55 98.0 56 82.5 57 77.5 58 90.0 59 83.0 60 74.0 61 68.0 62 64.5 63 83.0 64 88.5 65 75.0 66 63.5 67 67.5 68 66.5 69 58.0 70 54.5 71 54.5 72 51.0 73 40.0 74 31.5 75 23.5 76 21.0 77 20.5 78 11.0 79 2.5 80 2.5 81 4.0 82 2.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.674999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8618258 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8618258_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96325 34.0 33.0 34.0 31.0 34.0 2 33.1325 34.0 33.0 34.0 31.0 34.0 3 33.2425 34.0 34.0 34.0 31.0 34.0 4 36.588 37.0 37.0 37.0 35.0 37.0 5 36.56675 37.0 37.0 37.0 35.0 37.0 6 36.58975 37.0 37.0 37.0 35.0 37.0 7 36.58275 37.0 37.0 37.0 35.0 37.0 8 36.41825 37.0 37.0 37.0 35.0 37.0 9 38.44375 39.0 39.0 39.0 37.0 39.0 10-11 38.449125 39.0 39.0 39.0 37.0 39.0 12-13 38.419624999999996 39.0 39.0 39.0 37.0 39.0 14-15 40.066500000000005 41.0 40.0 41.0 38.0 41.0 16-17 40.063500000000005 41.0 40.0 41.0 38.0 41.0 18-19 39.969625 41.0 40.0 41.0 38.0 41.0 20-21 39.922375 41.0 40.0 41.0 38.0 41.0 22-23 39.8515 41.0 40.0 41.0 38.0 41.0 24-25 39.825625 41.0 40.0 41.0 38.0 41.0 26-27 39.737 41.0 40.0 41.0 37.5 41.0 28-29 39.62375 41.0 39.5 41.0 37.0 41.0 30-31 39.522000000000006 41.0 39.0 41.0 36.5 41.0 32-33 39.271375 40.0 39.0 41.0 35.5 41.0 34-35 39.158500000000004 40.0 38.5 41.0 35.0 41.0 36-37 38.978875 40.0 38.0 41.0 35.0 41.0 38-39 38.818 40.0 38.0 41.0 35.0 41.0 40-41 38.62175 40.0 38.0 41.0 35.0 41.0 42-43 38.338375 40.0 37.0 41.0 34.0 41.0 44-45 38.31925 40.0 37.0 41.0 34.0 41.0 46-47 38.159625 40.0 36.5 41.0 34.0 41.0 48-49 38.037625000000006 40.0 36.0 41.0 33.5 41.0 50-51 36.92575 38.0 34.5 40.0 32.0 40.5 52-53 36.965999999999994 38.5 35.0 40.0 32.5 40.5 54-55 37.319625 39.0 35.0 40.5 33.0 41.0 56-57 37.17125 38.5 35.0 41.0 32.5 41.0 58-59 36.914125 38.0 35.0 40.0 32.0 41.0 60-61 37.0185 38.0 35.0 41.0 33.0 41.0 62-63 37.010000000000005 37.5 35.0 40.5 33.0 41.0 64-65 36.631 37.0 35.0 40.0 33.0 41.0 66-67 36.403875 36.0 35.0 39.5 33.0 41.0 68-69 36.17375 36.0 35.0 39.0 33.0 41.0 70-71 35.8445 35.0 35.0 39.0 32.5 41.0 72-73 35.469125 35.0 35.0 37.5 32.0 39.5 74-75 35.115375 35.0 34.5 37.0 31.5 39.0 76-77 34.789625 35.0 34.0 36.5 31.0 39.0 78-79 34.4875 35.0 34.0 36.0 31.0 37.5 80-81 34.254375 35.0 34.0 35.5 31.0 37.0 82-83 33.878 35.0 34.0 35.0 30.0 37.0 84-85 33.66825 35.0 34.0 35.0 30.0 36.0 86-87 33.510625000000005 35.0 34.0 35.0 30.0 36.0 88-89 33.242125 35.0 33.0 35.0 29.5 36.0 90-91 33.006125 35.0 33.0 35.0 29.0 35.5 92-93 32.657375 35.0 33.0 35.0 28.0 35.0 94-95 32.494875 35.0 33.0 35.0 27.5 35.0 96-97 32.313500000000005 35.0 33.0 35.0 27.0 35.0 98-99 31.939875 35.0 33.0 35.0 27.0 35.0 100 31.5395 35.0 32.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.16376531270147865 1101 2 0.17350096711798813 1101 3 0.06234687298517372 1101 4 0.20399742101869833 1101 5 0.04887169568020511 1101 6 0.05183752417794807 1101 7 -0.00457769181173262 1101 8 -0.08355899419729695 1101 9 0.1568020631850402 1101 10-11 0.11937459703417375 1101 12-13 -0.050838168923270644 1101 14-15 -0.045067698259181554 1101 16-17 0.02050290135397148 1101 18-19 0.06818181818181301 1101 20-21 0.10789813023855288 1101 22-23 0.0976789168278529 1101 24-25 0.14932301740812903 1101 26-27 -0.017633784655060936 1101 28-29 0.0568987749838783 1101 30-31 0.13426821405544587 1101 32-33 0.12559638942617823 1101 34-35 0.06247582205028834 1101 36-37 -0.035912314635716314 1101 38-39 -0.03642811089619613 1101 40-41 0.033172147001934604 1101 42-43 0.1747259832366268 1101 44-45 0.14007092198581717 1101 46-47 0.20912314635719298 1101 48-49 0.12888459058671486 1101 50-51 0.1340103159252095 1101 52-53 0.1303675048355899 1101 54-55 -0.0439071566731144 1101 56-57 -0.17366215344938496 1101 58-59 -0.08149580915538479 1101 60-61 0.038201160541582624 1101 62-63 -0.07240490006447686 1101 64-65 -0.1966473243069018 1101 66-67 -0.10212765957446379 1101 68-69 -0.19248871695680236 1101 70-71 -0.16460348162475924 1101 72-73 -0.09161831076725235 1101 74-75 -0.03410702772404761 1101 76-77 0.038072211476468 1101 78-79 -0.1608639587363001 1101 80-81 -0.027466150870402828 1101 82-83 -0.016731141199223032 1101 84-85 -0.0501611863314011 1101 86-87 -0.27543520309478 1101 88-89 -0.03871695680206244 1101 90-91 -0.1626047711154115 1101 92-93 -0.3101225016118647 1101 94-95 -0.3704384268214014 1101 96-97 -0.36531270148291384 1101 98-99 -0.4345261121856865 1101 100 -0.06118633139909946 1103 1 -0.16376531270148575 1103 2 -0.17350096711798813 1103 3 -0.06234687298516661 1103 4 -0.20399742101869833 1103 5 -0.04887169568020511 1103 6 -0.05183752417794807 1103 7 0.004577691811739726 1103 8 0.08355899419728985 1103 9 -0.1568020631850473 1103 10-11 -0.11937459703416664 1103 12-13 0.05083816892327775 1103 14-15 0.04506769825918866 1103 16-17 -0.020502901353964376 1103 18-19 -0.06818181818182012 1103 20-21 -0.10789813023855288 1103 22-23 -0.0976789168278529 1103 24-25 -0.14932301740812193 1103 26-27 0.017633784655060936 1103 28-29 -0.0568987749838783 1103 30-31 -0.13426821405544587 1103 32-33 -0.12559638942617113 1103 34-35 -0.06247582205028834 1103 36-37 0.03591231463572342 1103 38-39 0.03642811089619613 1103 40-41 -0.033172147001934604 1103 42-43 -0.1747259832366268 1103 44-45 -0.14007092198581717 1103 46-47 -0.20912314635718587 1103 48-49 -0.12888459058671486 1103 50-51 -0.1340103159252095 1103 52-53 -0.1303675048355899 1103 54-55 0.0439071566731144 1103 56-57 0.17366215344939206 1103 58-59 0.08149580915538479 1103 60-61 -0.03820116054158973 1103 62-63 0.07240490006446976 1103 64-65 0.1966473243069018 1103 66-67 0.1021276595744709 1103 68-69 0.19248871695680236 1103 70-71 0.16460348162475924 1103 72-73 0.09161831076725235 1103 74-75 0.03410702772404761 1103 76-77 -0.038072211476468 1103 78-79 0.1608639587363001 1103 80-81 0.027466150870402828 1103 82-83 0.016731141199223032 1103 84-85 0.0501611863314011 1103 86-87 0.27543520309478 1103 88-89 0.038716956802069546 1103 90-91 0.1626047711154115 1103 92-93 0.3101225016118576 1103 94-95 0.3704384268214014 1103 96-97 0.36531270148291384 1103 98-99 0.4345261121856865 1103 100 0.061186331399095906 >>END_MODULE >>Per sequence quality scores pass #Quality Count 27 11.0 28 27.0 29 25.0 30 47.0 31 77.0 32 103.0 33 161.0 34 260.0 35 384.0 36 632.0 37 1013.0 38 1071.0 39 189.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.0557508789553 10.698141637368156 16.398794575590156 43.84731290808639 2 26.063031515757878 17.858929464732366 31.690845422711355 24.387193596798397 3 27.538769384692348 22.236118059029515 23.08654327163582 27.138569284642323 4 28.121090818113586 27.445584188141105 17.63822867150363 26.79509632224168 5 29.15 29.425 19.7 21.725 6 22.45 32.6 20.525 24.425 7 20.225 14.725 39.525 25.525 8 21.975 20.8 25.15 32.074999999999996 9 22.275 20.200000000000003 27.6 29.925 10-11 26.087500000000002 28.475 19.475 25.9625 12-13 24.2375 21.875 26.787499999999998 27.1 14-15 25.1 23.962500000000002 25.337500000000002 25.6 16-17 25.2 23.2125 24.6875 26.900000000000002 18-19 24.7 24.474999999999998 23.7875 27.037499999999998 20-21 25.55 24.712500000000002 23.8125 25.924999999999997 22-23 24.4 24.9125 24.85 25.837500000000002 24-25 25.887500000000003 24.0125 23.7875 26.3125 26-27 25.4875 24.4375 23.7625 26.3125 28-29 25.575 24.0375 24.375 26.0125 30-31 25.0375 24.1375 24.2875 26.5375 32-33 25.2125 23.9875 24.125 26.674999999999997 34-35 24.975 23.5625 24.4375 27.025 36-37 24.9 24.3875 23.7 27.0125 38-39 25.0 23.8125 24.2875 26.900000000000002 40-41 25.337500000000002 24.462500000000002 23.8125 26.387500000000003 42-43 24.9125 23.7625 24.8125 26.5125 44-45 25.275 25.2 23.7125 25.8125 46-47 26.224999999999998 24.4125 23.4375 25.924999999999997 48-49 24.9875 23.95 23.974999999999998 27.0875 50-51 25.4375 24.2375 25.15 25.174999999999997 52-53 25.674999999999997 24.875 23.125 26.325 54-55 25.4875 24.0 24.2 26.3125 56-57 25.55 23.95 24.1375 26.3625 58-59 25.775 24.9 23.575 25.75 60-61 25.575 23.7875 24.587500000000002 26.05 62-63 25.0625 24.825 24.474999999999998 25.637500000000003 64-65 26.0125 24.375 23.9375 25.674999999999997 66-67 26.0375 24.6 23.625 25.7375 68-69 25.5125 24.45 25.124999999999996 24.9125 70-71 25.912499999999998 23.5375 24.099999999999998 26.450000000000003 72-73 25.0625 24.775 24.224999999999998 25.937500000000004 74-75 25.474999999999998 24.3625 24.6125 25.55 76-77 25.85 24.3625 23.724999999999998 26.0625 78-79 25.7375 24.275 24.0375 25.95 80-81 26.025 24.762500000000003 23.3375 25.874999999999996 82-83 25.837500000000002 24.2875 24.975 24.9 84-85 25.4 24.212500000000002 24.4 25.9875 86-87 26.075 24.4125 24.275 25.2375 88-89 26.2625 24.2875 23.974999999999998 25.474999999999998 90-91 26.8375 23.075000000000003 24.5625 25.525 92-93 25.924999999999997 24.325 24.087500000000002 25.662499999999998 94-95 26.35 24.6625 22.7 26.2875 96-97 25.4875 24.675 24.3625 25.474999999999998 98-99 26.525 24.05 22.9625 26.4625 100 26.8 21.975 24.55 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.5 28 2.5 29 0.5 30 3.5 31 9.0 32 10.5 33 10.5 34 15.0 35 26.5 36 36.0 37 50.0 38 66.5 39 93.0 40 119.0 41 133.0 42 150.0 43 161.0 44 165.5 45 168.0 46 165.5 47 166.5 48 178.5 49 166.5 50 146.5 51 134.0 52 116.0 53 115.0 54 112.5 55 90.5 56 90.5 57 102.0 58 98.0 59 86.0 60 70.0 61 74.5 62 74.0 63 61.5 64 69.5 65 77.0 66 76.0 67 64.5 68 59.0 69 63.0 70 55.0 71 48.0 72 46.0 73 41.5 74 35.0 75 24.5 76 17.5 77 18.5 78 13.0 79 6.0 80 4.5 81 4.0 82 3.0 83 1.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.05 3 0.05 4 0.075 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579394 spots for SRR8618258.sra Written 579394 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra Read 579388 spots for SRR8618258.sra Written 579388 spots for SRR8618258.sra SRR ids: ['SRR8618258.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7l309ji0 SRR8618258.sra spots: 11587766 blocks: [[1, 579388], [579389, 1158776], [1158777, 1738164], [1738165, 2317552], [2317553, 2896940], [2896941, 3476328], [3476329, 4055716], [4055717, 4635104], [4635105, 5214492], [5214493, 5793880], [5793881, 6373268], [6373269, 6952656], [6952657, 7532044], [7532045, 8111432], [8111433, 8690820], [8690821, 9270208], [9270209, 9849596], [9849597, 10428984], [10428985, 11008372], [11008373, 11587766]] SRR8618258 file size 3015983 SRR8618258 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8618258 SRR8618258_1.fastq SRR8618258_2.fastq Input file: SRR8618258_1.fastq Paired file: SRR8618258_2.fastq trimmed: SRR8618258-trimmed-pair1.fastq, SRR8618258-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:19:12 2024 >> started Sat Dec 7 11:19:23 2024 >> done (10.448s) 11587766 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 11587766 (100.00%) read pairs available; of these: 1149161 ( 9.92%) trimmed read pairs available after processing 10438605 (90.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 81 8 0.00% 82 17 0.00% 83 61 0.00% 84 4219 0.04% 85 4637 0.04% 86 4843 0.04% 87 5536 0.05% 88 6419 0.06% 89 8035 0.07% 90 13357 0.12% 91 24681 0.21% 92 36763 0.32% 93 50096 0.43% 94 67028 0.58% 95 88145 0.76% 96 117228 1.01% 97 162884 1.41% 98 236054 2.04% 99 319150 2.75% 100 10438605 90.08% 11587766 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=86.82 fanout-score-rank=4 prefix-density=0.94 prefix-fanout=15.3 sequence=GGCGGCGGCGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=190.58 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=21.4 sequence=CGGCGGCGGCGCC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=74.26 fanout-score-rank=5 prefix-density=0.90 prefix-fanout=13.9 sequence=GGCGGCGGCGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=300.80 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=23.9 sequence=CGCCGCCGCCGA SRR8618258 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:20:28 Started mapping on | Dec 07 11:20:29 Finished on | Dec 07 11:20:56 Mapping speed, Million of reads per hour | 1545.04 Number of input reads | 11587766 Average input read length | 199 UNIQUE READS: Uniquely mapped reads number | 11320946 Uniquely mapped reads % | 97.70% Average mapped length | 198.63 Number of splices: Total | 7399042 Number of splices: Annotated (sjdb) | 7019169 Number of splices: GT/AG | 7300862 Number of splices: GC/AG | 83483 Number of splices: AT/AC | 3702 Number of splices: Non-canonical | 10995 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 133958 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 6743 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.79% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 132862 132862 132862 N_multimapping 133958 133958 133958 N_noFeature 347680 5716579 5769933 N_ambiguous 206915 13147 12840 UnstrandedReadsAssigned:10766351 PositiveStrandReadsAssigned:5591220 NegativeStrandReadsAssigned:5538173 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8618258 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR8618258-trimmed-pair1.fastq SRR8618258-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,587,766 reads, 11,049,744 reads pseudoaligned [quant] estimated average fragment length: 169.6 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR8618258.ke.tsv 35125 SRR8618258.se.tsv 88098 total ==> SRR8618258.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 767.538 16.9927 2.9062 PNS24247 1044 875.4 21.6426 3.24537 PNS24249 1928 1759.4 116.48 8.69057 PNS24246 1044 875.4 21.6426 3.24537 PNS24248 1044 875.4 21.6426 3.24537 PNS24244 1471 1302.4 27.5997 2.78178 PNS24243 293 133.221 9 8.86815 KQK14069 1603 1434.4 1028.59 94.1312 KQK14071 474 307.262 67.249 28.7302 ==> SRR8618258.se.tsv <== BRADI_1g14170v3 1168 BRADI_1g53295v3 59 BRADI_1g59795v3 159 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 350 BRADI_1g74790v3 273 BRADI_1g09890v3 2 BRADI_1g77505v3 185 BRADI_1g48960v3 0 SRR8618258 completed mapping pipeline successfully