Starting /dee2/code/volunteer_pipeline.sh SRR8635265 current disk space = 1526551896064 free memory = 1527396796 SRR8635265 SRAfilesize d00fd7a6e3a47eb2c506b79d2c897fbc SRR8635265.sra SRR8635265.sra file validated SRR8635265 is single end SRR8635265 is conventional basespace SRR8635265 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635265_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8225 32.0 32.0 32.0 27.0 32.0 2 31.0325 32.0 32.0 32.0 32.0 32.0 3 32.75 32.0 32.0 37.0 22.0 37.0 4 33.95375 37.0 32.0 37.0 27.0 37.0 5 34.97125 37.0 37.0 37.0 27.0 37.0 6 37.5915 41.0 37.0 41.0 32.0 41.0 7 38.206 41.0 37.0 41.0 32.0 41.0 8 38.3915 41.0 37.0 41.0 32.0 41.0 9 38.74025 41.0 37.0 41.0 32.0 41.0 10-14 38.993900000000004 41.0 39.4 41.0 35.0 41.0 15-19 38.5655 41.0 39.4 41.0 34.0 41.0 20-24 38.08235 41.0 37.0 41.0 31.0 41.0 25-29 38.108450000000005 41.0 37.0 41.0 32.0 41.0 30-34 37.53255 41.0 37.0 41.0 30.0 41.0 35-39 37.75835 41.0 37.0 41.0 30.0 41.0 40-44 37.35035 41.0 37.0 41.0 30.0 41.0 45-49 37.7428 41.0 37.0 41.0 31.0 41.0 50-54 34.93575 39.4 32.0 41.0 21.0 41.0 55-59 35.6826 37.0 34.0 41.0 24.0 41.0 60-64 34.0856 37.0 31.0 41.0 20.0 41.0 65-69 34.04235 37.0 31.0 41.0 20.0 41.0 70-74 35.4784 37.0 35.0 41.0 23.0 41.0 75-79 33.963750000000005 36.0 31.0 40.2 22.0 41.0 80-84 35.039649999999995 37.0 32.0 41.0 20.0 41.0 85-89 35.17205 38.6 31.0 41.0 22.0 41.0 90-94 34.021950000000004 37.0 31.0 41.0 22.0 41.0 95-99 31.2702 35.0 26.0 41.0 12.0 41.0 100-104 31.096249999999998 35.0 27.0 40.2 12.0 41.0 105-109 30.0032 32.0 23.0 37.8 12.0 41.0 110-114 28.103250000000003 30.0 20.0 37.0 12.0 41.0 115-119 26.131350000000005 26.0 16.0 35.0 11.2 40.2 120-124 19.24495 16.0 12.0 26.0 10.4 31.0 125-129 17.820449999999997 14.0 12.0 23.0 8.8 29.0 130-134 19.052500000000002 18.0 12.0 23.0 11.2 31.0 135-139 16.8468 12.0 12.0 23.0 8.8 29.0 140-144 13.9745 12.0 12.0 14.0 8.0 22.0 145-149 14.21585 12.0 12.0 16.0 8.0 22.0 150 13.31 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 5.0 20 6.0 21 37.0 22 43.0 23 68.0 24 115.0 25 131.0 26 169.0 27 181.0 28 219.0 29 317.0 30 380.0 31 447.0 32 532.0 33 594.0 34 449.0 35 233.0 36 64.0 37 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.975 15.325 30.125 11.575000000000001 2 42.55 15.45 28.575 13.425 3 42.375 16.425 28.325 12.875 4 42.075 15.8 29.175 12.950000000000001 5 38.7 15.775 30.525000000000002 15.0 6 41.375 15.4 29.5 13.725000000000001 7 40.075 14.95 30.225 14.75 8 38.5 14.95 31.5 15.049999999999999 9 34.75 16.25 31.85 17.150000000000002 10-14 29.365000000000002 21.015 33.46 16.16 15-19 25.019999999999996 24.085 31.869999999999997 19.025 20-24 25.580000000000002 24.215 30.665 19.54 25-29 24.75 24.185000000000002 31.4 19.665 30-34 24.85 24.325 31.630000000000003 19.195 35-39 23.515 24.09 32.315 20.080000000000002 40-44 23.875 24.69 31.995 19.439999999999998 45-49 23.150000000000002 25.845000000000002 31.075000000000003 19.93 50-54 23.46 25.755 31.745 19.040000000000003 55-59 22.34 25.945 32.550000000000004 19.165 60-64 23.005 25.990000000000002 31.929999999999996 19.075 65-69 22.855 26.93 31.209999999999997 19.005 70-74 22.06 28.155 31.22 18.565 75-79 21.765 28.51 30.930000000000003 18.795 80-84 21.665 29.459999999999997 30.305 18.57 85-89 20.74 31.305 30.085 17.87 90-94 21.15 32.455 28.62 17.775 95-99 20.72 33.805 28.01 17.465 100-104 20.0 34.64 27.26 18.099999999999998 105-109 19.900000000000002 35.345 27.060000000000002 17.695 110-114 19.575 36.02 26.495 17.91 115-119 19.785 35.31 26.275 18.63 120-124 22.085 34.555 25.35 18.01 125-129 21.72 34.88 24.715 18.685 130-134 20.47 37.56 23.515 18.455 135-139 20.31 35.825 24.745 19.12 140-144 22.689999999999998 35.665 24.595 17.05 145-149 21.935 34.975 24.525 18.565 150 22.925 36.55 24.3 16.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 1.5 6 2.0 7 2.5 8 3.5 9 2.0 10 1.5 11 3.0 12 4.5 13 3.5 14 2.5 15 5.0 16 6.5 17 5.5 18 5.5 19 6.5 20 7.5 21 9.0 22 10.5 23 9.0 24 12.0 25 16.5 26 17.0 27 19.5 28 20.0 29 23.0 30 35.5 31 47.5 32 57.5 33 74.0 34 94.5 35 117.0 36 136.0 37 155.0 38 180.0 39 194.5 40 202.5 41 215.5 42 203.0 43 193.5 44 181.0 45 175.0 46 188.5 47 173.0 48 133.0 49 108.0 50 100.0 51 90.5 52 84.0 53 87.0 54 91.0 55 67.5 56 55.5 57 49.5 58 33.5 59 24.5 60 21.0 61 23.5 62 24.5 63 23.5 64 23.0 65 20.5 66 19.0 67 15.0 68 10.5 69 12.0 70 12.0 71 10.5 72 9.5 73 6.5 74 5.0 75 5.0 76 3.5 77 2.0 78 1.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.30219055159674 90.275 2 4.407495381367115 8.35 3 0.2111375032990235 0.6 4 0.0 0.0 5 0.0 0.0 6 0.026392187912377938 0.15 7 0.026392187912377938 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026392187912377938 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 18 0.44999999999999996 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 7 0.17500000000000002 No Hit GCATATGTACTTTTTGCTTGGCTTTTCCTCTGTTTTTCTTTCGTTTTCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.16249999999999998 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.3125 0.0 0.0 0.0 0.0 70-71 0.4375 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.5875 0.0 0.0 0.0 0.0 76-77 0.7 0.0 0.0 0.0 0.0 78-79 0.775 0.0 0.0 0.0 0.0 80-81 0.825 0.0 0.0 0.0 0.0 82-83 0.925 0.0 0.0 0.0 0.0 84-85 1.05 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.3125 0.0 0.0 0.0 0.0 90-91 1.5875 0.0 0.0 0.0 0.0 92-93 1.8125 0.0 0.0 0.0 0.0 94-95 2.0125 0.0 0.0 0.0 0.0 96-97 2.4125 0.0 0.0 0.0 0.0 98-99 2.575 0.0 0.0 0.0 0.0 100-101 2.7249999999999996 0.0 0.0 0.0 0.0 102-103 2.9 0.0 0.0 0.0 0.0 104-105 3.1875 0.0 0.0 0.0 0.0 106-107 3.425 0.0 0.0 0.0 0.0 108-109 3.7625 0.0 0.0 0.0 0.0 110-111 3.9124999999999996 0.0 0.0 0.0 0.0 112-113 4.025 0.0 0.0 0.0 0.0 114-115 4.175000000000001 0.0 0.0 0.0 0.0 116-117 4.2 0.0 0.0 0.0 0.0 118-119 4.2375 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.425 0.0 0.0 0.0 0.0 126-127 4.574999999999999 0.0 0.0 0.0 0.0 128-129 4.625 0.0 0.0 0.0 0.0 130-131 4.7 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 4.7375 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGGGG 10 0.006973645 144.0 5 ACCATGA 10 0.006973645 144.0 7 CGCTACC 10 0.006973645 144.0 3 GCTACCA 10 0.006973645 144.0 4 GGGGTTG 10 0.006973645 144.0 3 TAGATTT 10 0.006973645 144.0 1 CTACCAT 10 0.006973645 144.0 5 AAAAAGA 75 0.0013041105 13.439999 135-139 >>END_MODULE Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404461 READS because READLEN < 1 Read 404461 spots for SRR8635265.sra Written 404461 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra Rejected 404457 READS because READLEN < 1 Read 404457 spots for SRR8635265.sra Written 404457 spots for SRR8635265.sra SRR ids: ['SRR8635265.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_en386d9s SRR8635265.sra spots: 8089144 blocks: [[1, 404457], [404458, 808914], [808915, 1213371], [1213372, 1617828], [1617829, 2022285], [2022286, 2426742], [2426743, 2831199], [2831200, 3235656], [3235657, 3640113], [3640114, 4044570], [4044571, 4449027], [4449028, 4853484], [4853485, 5257941], [5257942, 5662398], [5662399, 6066855], [6066856, 6471312], [6471313, 6875769], [6875770, 7280226], [7280227, 7684683], [7684684, 8089144]] SRR8635265 file size 2707378 SRR8635265 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635265 SRR8635265_1.fastq Input file: SRR8635265_1.fastq trimmed: SRR8635265-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 11:50:39 2024 >> started Mon Dec 9 11:50:49 2024 >> done (10.052s) 8089144 reads processed; of these: 186 ( 0.00%) short reads filtered out after trimming by size control 75 ( 0.00%) empty reads filtered out after trimming by size control 8088883 (100.00%) reads available; of these: 1085210 (13.42%) trimmed reads available after processing 7003673 (86.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 80 0.00% 19 140 0.00% 20 156 0.00% 21 198 0.00% 22 262 0.00% 23 335 0.00% 24 383 0.00% 25 326 0.00% 26 292 0.00% 27 279 0.00% 28 279 0.00% 29 340 0.00% 30 356 0.00% 31 340 0.00% 32 325 0.00% 33 334 0.00% 34 311 0.00% 35 365 0.00% 36 395 0.00% 37 409 0.01% 38 387 0.00% 39 464 0.01% 40 416 0.01% 41 382 0.00% 42 425 0.01% 43 433 0.01% 44 465 0.01% 45 440 0.01% 46 500 0.01% 47 512 0.01% 48 596 0.01% 49 660 0.01% 50 727 0.01% 51 751 0.01% 52 836 0.01% 53 923 0.01% 54 1120 0.01% 55 1261 0.02% 56 1217 0.02% 57 1335 0.02% 58 1515 0.02% 59 1595 0.02% 60 1767 0.02% 61 1807 0.02% 62 1875 0.02% 63 1921 0.02% 64 2012 0.02% 65 2049 0.03% 66 2181 0.03% 67 2349 0.03% 68 2447 0.03% 69 2665 0.03% 70 2997 0.04% 71 3276 0.04% 72 3395 0.04% 73 3670 0.05% 74 4063 0.05% 75 4144 0.05% 76 4454 0.06% 77 4608 0.06% 78 5063 0.06% 79 5599 0.07% 80 6150 0.08% 81 6758 0.08% 82 7032 0.09% 83 7389 0.09% 84 7658 0.09% 85 8219 0.10% 86 8812 0.11% 87 9041 0.11% 88 9617 0.12% 89 10065 0.12% 90 10386 0.13% 91 10983 0.14% 92 11401 0.14% 93 11634 0.14% 94 12073 0.15% 95 12992 0.16% 96 13610 0.17% 97 13664 0.17% 98 13730 0.17% 99 14196 0.18% 100 14990 0.19% 101 15406 0.19% 102 16110 0.20% 103 16883 0.21% 104 17054 0.21% 105 17473 0.22% 106 17559 0.22% 107 18065 0.22% 108 18563 0.23% 109 19157 0.24% 110 19946 0.25% 111 20702 0.26% 112 20750 0.26% 113 21518 0.27% 114 21800 0.27% 115 23383 0.29% 116 24396 0.30% 117 24680 0.31% 118 15170 0.19% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 2 0.00% 129 4 0.00% 130 7 0.00% 131 7 0.00% 132 9 0.00% 133 17 0.00% 134 18 0.00% 135 44 0.00% 136 58 0.00% 137 93 0.00% 138 173 0.00% 139 262 0.00% 140 399 0.00% 141 678 0.01% 142 1304 0.02% 143 2217 0.03% 144 4203 0.05% 145 7902 0.10% 146 15330 0.19% 147 35595 0.44% 148 94515 1.17% 149 268151 3.32% 150 7003673 86.58% 8088883 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=7.73 fanout-score-rank=24 prefix-density=1.55 prefix-fanout=1.5 sequence=TTATTTCCCTTCGGTTATTCTGTGAAGCAGCCAGCCAGGCTATTGTTGCTCTGAATAAGTCTAATAGCTCTAGGTGGTCAGCTGCGTCTACCACAATGAGCATATGTCTGAAGAAAAGTTGTCAAAAACCGCAATAAATAAGCATTATTGTCCTTCTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=193.51 fanout-score-rank=1 prefix-density=1.50 prefix-fanout=5.0 sequence=CTGCTGCTGGATGTATCTCTGATTAATGAGTTGCTGCTCTTTAGAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAA Started job on | Dec 09 11:52:38 Started mapping on | Dec 09 11:52:38 Finished on | Dec 09 11:53:37 Mapping speed, Million of reads per hour | 493.56 Number of input reads | 8088883 Average input read length | 145 UNIQUE READS: Uniquely mapped reads number | 6465404 Uniquely mapped reads % | 79.93% Average mapped length | 136.09 Number of splices: Total | 425965 Number of splices: Annotated (sjdb) | 303545 Number of splices: GT/AG | 354864 Number of splices: GC/AG | 8229 Number of splices: AT/AC | 322 Number of splices: Non-canonical | 62550 Mismatch rate per base, % | 0.59% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441079 % of reads mapped to multiple loci | 5.45% Number of reads mapped to too many loci | 261302 % of reads mapped to too many loci | 3.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.78% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1182400 1182400 1182400 N_multimapping 441079 441079 441079 N_noFeature 382656 453210 6223504 N_ambiguous 191758 22870 845 UnstrandedReadsAssigned:5890990 PositiveStrandReadsAssigned:5989324 NegativeStrandReadsAssigned:241055 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8635265 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635265-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,088,883 reads, 6,555,638 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR8635265.ke.tsv 35125 SRR8635265.se.tsv 88098 total ==> SRR8635265.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 116 17.9737 PNS24243 293 194 0 0 KQK14069 1603 1504 3287.36 464.657 KQK14071 474 375 2.04946 1.16183 ==> SRR8635265.se.tsv <== BRADI_1g14170v3 2662 BRADI_1g53295v3 42 BRADI_1g59795v3 143 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 152 BRADI_1g74790v3 70 BRADI_1g09890v3 9 BRADI_1g77505v3 147 BRADI_1g48960v3 0 SRR8635265 completed mapping pipeline successfully