Starting /dee2/code/volunteer_pipeline.sh SRR8635266 current disk space = 1526170566656 free memory = 1382236140 SRR8635266 SRAfilesize 6867c50c2455d7efd3d0b0f95936f100 SRR8635266.sra SRR8635266.sra file validated SRR8635266 is single end SRR8635266 is conventional basespace SRR8635266 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635266_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 46 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1125 32.0 32.0 32.0 27.0 32.0 2 31.26625 32.0 32.0 32.0 32.0 32.0 3 33.38625 32.0 32.0 37.0 32.0 37.0 4 34.295 37.0 32.0 37.0 27.0 37.0 5 35.1775 37.0 37.0 37.0 32.0 37.0 6 37.88 41.0 37.0 41.0 32.0 41.0 7 38.50625 41.0 37.0 41.0 32.0 41.0 8 38.819 41.0 37.0 41.0 32.0 41.0 9 39.12925 41.0 41.0 41.0 37.0 41.0 10-14 39.4887 41.0 41.0 41.0 37.0 41.0 15-19 39.613899999999994 41.0 41.0 41.0 37.0 41.0 20-24 39.43745 41.0 41.0 41.0 37.0 41.0 25-29 38.739549999999994 41.0 38.6 41.0 34.0 41.0 30-34 38.7243 41.0 39.4 41.0 35.0 41.0 35-39 39.0124 41.0 40.2 41.0 36.0 41.0 40-44 38.38565 41.0 38.6 41.0 32.0 41.0 45-49 38.737049999999996 41.0 39.4 41.0 34.0 41.0 50-54 38.799350000000004 41.0 40.2 41.0 32.0 41.0 55-59 38.4801 41.0 38.6 41.0 32.0 41.0 60-64 37.953500000000005 41.0 37.0 41.0 31.0 41.0 65-69 38.07315 41.0 37.0 41.0 31.0 41.0 70-74 36.8095 41.0 37.0 41.0 26.0 41.0 75-79 35.218900000000005 39.4 33.0 41.0 21.0 41.0 80-84 35.19805 38.6 34.0 41.0 22.0 41.0 85-89 36.18465 40.2 36.0 41.0 25.0 41.0 90-94 36.97265 41.0 37.0 41.0 27.0 41.0 95-99 36.42305 41.0 37.0 41.0 26.0 41.0 100-104 35.60575 38.6 35.0 41.0 22.0 41.0 105-109 32.4341 37.0 29.0 41.0 12.0 41.0 110-114 32.722750000000005 37.0 28.0 41.0 12.0 41.0 115-119 30.960900000000002 35.0 24.0 41.0 12.0 41.0 120-124 30.964949999999998 36.0 25.0 41.0 12.0 41.0 125-129 29.0079 31.0 20.0 39.4 12.0 41.0 130-134 27.76 31.0 18.0 37.0 12.0 41.0 135-139 26.35335 28.0 14.0 37.0 12.0 41.0 140-144 25.1648 25.0 12.0 35.0 11.2 40.2 145-149 24.3901 25.0 12.0 34.0 10.4 39.4 150 23.57425 22.0 12.0 32.0 8.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 4.0 20 4.0 21 12.0 22 12.0 23 23.0 24 26.0 25 48.0 26 63.0 27 78.0 28 129.0 29 133.0 30 165.0 31 174.0 32 216.0 33 236.0 34 317.0 35 386.0 36 464.0 37 561.0 38 549.0 39 363.0 40 35.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.725 15.6 25.45 15.225 2 44.275 16.85 24.8 14.075 3 43.425000000000004 16.85 24.9 14.825 4 43.375 15.625 25.674999999999997 15.325 5 42.075 15.950000000000001 24.725 17.25 6 44.425 14.575 23.625 17.375 7 43.625 15.125 24.125 17.125 8 39.475 15.675 26.450000000000003 18.4 9 37.974999999999994 15.425 27.200000000000003 19.400000000000002 10-14 31.705 20.415 28.88 19.0 15-19 27.96 21.805 26.43 23.805 20-24 27.915 22.75 24.545 24.79 25-29 27.465 22.830000000000002 25.979999999999997 23.724999999999998 30-34 28.945 21.560000000000002 26.76 22.735 35-39 27.689999999999998 21.645 27.935 22.73 40-44 27.12 22.845 26.965 23.07 45-49 26.555 23.74 27.084999999999997 22.62 50-54 25.96 25.555 26.009999999999998 22.475 55-59 25.0 27.474999999999998 26.655 20.87 60-64 26.88 25.665 25.979999999999997 21.475 65-69 26.665 25.555 27.3 20.48 70-74 26.27 26.275 27.36 20.095 75-79 24.610000000000003 28.98 26.77 19.64 80-84 23.35 30.294999999999998 24.965 21.39 85-89 22.814999999999998 32.31 24.485 20.39 90-94 24.915000000000003 31.665 23.955000000000002 19.465 95-99 23.425 34.71 23.46 18.404999999999998 100-104 22.11 35.010000000000005 23.06 19.82 105-109 21.745 36.74 21.875 19.64 110-114 20.635 38.14 22.505 18.72 115-119 20.69 38.405 21.505 19.400000000000002 120-124 22.49 37.714999999999996 20.705000000000002 19.09 125-129 22.535 36.955 20.54 19.97 130-134 21.89 37.545 20.025000000000002 20.54 135-139 21.4 37.85 20.05 20.7 140-144 21.145 37.059999999999995 20.21 21.584999999999997 145-149 20.43 35.6 20.735 23.235 150 20.0 35.449999999999996 20.525 24.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 1.0 17 2.5 18 2.0 19 1.5 20 1.0 21 1.5 22 2.5 23 2.5 24 4.5 25 8.0 26 10.0 27 10.0 28 14.0 29 17.0 30 22.0 31 32.5 32 43.0 33 51.0 34 61.0 35 75.5 36 81.0 37 95.5 38 120.0 39 140.0 40 159.5 41 161.0 42 167.5 43 162.0 44 131.5 45 128.0 46 136.0 47 135.0 48 118.5 49 97.0 50 84.5 51 93.0 52 103.0 53 102.5 54 107.5 55 115.5 56 120.0 57 107.0 58 86.5 59 64.5 60 57.5 61 85.0 62 86.5 63 67.0 64 49.5 65 24.5 66 22.0 67 24.5 68 51.0 69 96.5 70 89.5 71 51.5 72 28.5 73 17.0 74 17.0 75 20.5 76 16.5 77 8.5 78 3.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.9 #Duplication Level Percentage of deduplicated Percentage of total 1 91.80887372013652 80.7 2 6.2855517633674625 11.05 3 0.881683731513083 2.325 4 0.42662116040955633 1.5 5 0.25597269624573377 1.125 6 0.17064846416382254 0.8999999999999999 7 0.05688282138794084 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.11376564277588168 2.0500000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 40 1.0 No Hit CGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGG 16 0.4 No Hit GTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCC 16 0.4 No Hit GGGCGGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGT 10 0.25 No Hit CCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTGG 7 0.17500000000000002 No Hit GAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCCG 7 0.17500000000000002 No Hit CGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTC 6 0.15 No Hit GCCCGGACCCTGTCGCCCCACGAGGCGCCGTCAACGAGTCGGGTTGTTTG 6 0.15 No Hit TCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAG 6 0.15 No Hit TGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAA 6 0.15 No Hit GGGGGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 6 0.15 No Hit CGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGG 6 0.15 No Hit GTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTAAAT 5 0.125 No Hit GGTCGGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCA 5 0.125 No Hit GTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGCTA 5 0.125 No Hit ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 5 0.125 No Hit GGGTTGTTTGGGAATGCAGCCCAAATCGGGCGGTAGACTCCGTCCAAGGC 5 0.125 No Hit GCATATGTACTTTTTGCTTGGCTTTTCCTCTGTTTTTCTTTCGTTTTCTC 5 0.125 No Hit ACGAGGCGCCGTCAACGAGTCGGGTTGTTTGGGAATGCAGCCCAAATCGG 5 0.125 No Hit GGGGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGCC 5 0.125 No Hit GGGGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.037500000000000006 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.1375 0.0 0.0 0.0 0.0 42-43 0.16249999999999998 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.2375 0.0 0.0 0.0 0.0 54-55 0.275 0.0 0.0 0.0 0.0 56-57 0.3125 0.0 0.0 0.0 0.0 58-59 0.3875 0.0 0.0 0.0 0.0 60-61 0.4125 0.0 0.0 0.0 0.0 62-63 0.4375 0.0 0.0 0.0 0.0 64-65 0.5125 0.0 0.0 0.0 0.0 66-67 0.625 0.0 0.0 0.0 0.0 68-69 0.65 0.0 0.0 0.0 0.0 70-71 0.7250000000000001 0.0 0.0 0.0 0.0 72-73 0.8125 0.0 0.0 0.0 0.0 74-75 0.8625 0.0 0.0 0.0 0.0 76-77 0.925 0.0 0.0 0.0 0.0 78-79 1.075 0.0 0.0 0.0 0.0 80-81 1.2625000000000002 0.0 0.0 0.0 0.0 82-83 1.325 0.0 0.0 0.0 0.0 84-85 1.475 0.0 0.0 0.0 0.0 86-87 1.7 0.0 0.0 0.0 0.0 88-89 1.925 0.0 0.0 0.0 0.0 90-91 2.2125 0.0 0.0 0.0 0.0 92-93 2.6375 0.0 0.0 0.0 0.0 94-95 2.925 0.0 0.0 0.0 0.0 96-97 3.2375 0.0 0.0 0.0 0.0 98-99 3.5625 0.0 0.0 0.0 0.0 100-101 4.0 0.0 0.0 0.0 0.0 102-103 4.3375 0.0 0.0 0.0 0.0 104-105 4.737500000000001 0.0 0.0 0.0 0.0 106-107 5.2 0.0 0.0 0.0 0.0 108-109 5.7375 0.0 0.0 0.0 0.0 110-111 6.3375 0.0 0.0 0.0 0.0 112-113 7.075 0.0 0.0 0.0 0.0 114-115 7.949999999999999 0.0 0.0 0.0 0.0 116-117 8.662500000000001 0.0 0.0 0.0 0.0 118-119 9.337499999999999 0.0 0.0 0.0 0.0 120-121 10.25 0.0 0.0 0.0 0.0 122-123 11.0125 0.0 0.0 0.0 0.0 124-125 11.8 0.0 0.0 0.0 0.0 126-127 12.375 0.0 0.0 0.0 0.0 128-129 12.962499999999999 0.0 0.0 0.0 0.0 130-131 13.5 0.0 0.0 0.0 0.0 132-133 14.1625 0.0 0.0 0.0 0.0 134-135 14.625 0.0 0.0 0.0 0.0 136-137 15.1625 0.0 0.0 0.0 0.0 138 15.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGACAG 10 0.006973645 144.0 3 TGGGGGT 10 0.006973645 144.0 4 GAGCCCC 55 0.0026350126 15.709091 10-14 AGAGCCC 55 0.0026350126 15.709091 10-14 CCCGTCC 60 0.0047032754 14.4 15-19 CGGCCCG 60 0.0047032754 14.4 20-24 CCGTCCG 65 0.007995365 13.292308 15-19 CCGGCCC 65 0.007995365 13.292308 20-24 GTTGTTT 95 0.0076621785 10.610526 65-69 >>END_MODULE Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323695 READS because READLEN < 1 Read 323695 spots for SRR8635266.sra Written 323695 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra Rejected 323694 READS because READLEN < 1 Read 323694 spots for SRR8635266.sra Written 323694 spots for SRR8635266.sra SRR ids: ['SRR8635266.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__3ff6agd SRR8635266.sra spots: 6473881 blocks: [[1, 323694], [323695, 647388], [647389, 971082], [971083, 1294776], [1294777, 1618470], [1618471, 1942164], [1942165, 2265858], [2265859, 2589552], [2589553, 2913246], [2913247, 3236940], [3236941, 3560634], [3560635, 3884328], [3884329, 4208022], [4208023, 4531716], [4531717, 4855410], [4855411, 5179104], [5179105, 5502798], [5502799, 5826492], [5826493, 6150186], [6150187, 6473881]] SRR8635266 file size 2166328 SRR8635266 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635266 SRR8635266_1.fastq Input file: SRR8635266_1.fastq trimmed: SRR8635266-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 11:59:06 2024 >> started Mon Dec 9 11:59:24 2024 >> done (17.988s) 6473881 reads processed; of these: 192 ( 0.00%) short reads filtered out after trimming by size control 71 ( 0.00%) empty reads filtered out after trimming by size control 6473618 (100.00%) reads available; of these: 1336864 (20.65%) trimmed reads available after processing 5136754 (79.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 43 0.00% 19 110 0.00% 20 157 0.00% 21 330 0.01% 22 478 0.01% 23 561 0.01% 24 604 0.01% 25 576 0.01% 26 523 0.01% 27 478 0.01% 28 573 0.01% 29 553 0.01% 30 575 0.01% 31 538 0.01% 32 517 0.01% 33 463 0.01% 34 432 0.01% 35 433 0.01% 36 470 0.01% 37 439 0.01% 38 442 0.01% 39 504 0.01% 40 441 0.01% 41 455 0.01% 42 472 0.01% 43 505 0.01% 44 549 0.01% 45 607 0.01% 46 666 0.01% 47 833 0.01% 48 808 0.01% 49 849 0.01% 50 953 0.01% 51 1089 0.02% 52 1285 0.02% 53 1807 0.03% 54 2352 0.04% 55 2284 0.04% 56 1938 0.03% 57 2149 0.03% 58 2464 0.04% 59 2358 0.04% 60 2304 0.04% 61 2399 0.04% 62 2426 0.04% 63 2319 0.04% 64 2176 0.03% 65 2467 0.04% 66 2595 0.04% 67 2798 0.04% 68 2865 0.04% 69 2813 0.04% 70 3395 0.05% 71 3629 0.06% 72 3812 0.06% 73 3699 0.06% 74 3957 0.06% 75 4011 0.06% 76 4324 0.07% 77 4752 0.07% 78 5395 0.08% 79 6887 0.11% 80 8477 0.13% 81 9228 0.14% 82 9304 0.14% 83 10472 0.16% 84 12404 0.19% 85 12109 0.19% 86 11110 0.17% 87 11239 0.17% 88 11742 0.18% 89 12524 0.19% 90 13687 0.21% 91 15229 0.24% 92 15636 0.24% 93 16343 0.25% 94 16938 0.26% 95 18832 0.29% 96 18790 0.29% 97 18051 0.28% 98 17651 0.27% 99 17585 0.27% 100 18193 0.28% 101 19242 0.30% 102 20030 0.31% 103 20527 0.32% 104 21674 0.33% 105 24202 0.37% 106 26459 0.41% 107 28540 0.44% 108 30800 0.48% 109 32149 0.50% 110 34416 0.53% 111 38754 0.60% 112 39699 0.61% 113 36688 0.57% 114 35457 0.55% 115 35651 0.55% 116 37363 0.58% 117 37981 0.59% 118 27903 0.43% 119 0 0.00% 120 0 0.00% 121 1 0.00% 122 0 0.00% 123 0 0.00% 124 2 0.00% 125 1 0.00% 126 0 0.00% 127 0 0.00% 128 1 0.00% 129 3 0.00% 130 6 0.00% 131 11 0.00% 132 14 0.00% 133 16 0.00% 134 21 0.00% 135 51 0.00% 136 73 0.00% 137 108 0.00% 138 206 0.00% 139 329 0.01% 140 520 0.01% 141 864 0.01% 142 1607 0.02% 143 2779 0.04% 144 5548 0.09% 145 10122 0.16% 146 19350 0.30% 147 38341 0.59% 148 79183 1.22% 149 230942 3.57% 150 5136754 79.35% 6473618 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=48.92 fanout-score-rank=7 prefix-density=23.85 prefix-fanout=1.1 sequence=AGGCTAAATACTCCTGGGTGACCGATAGCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=533.29 fanout-score-rank=1 prefix-density=16.82 prefix-fanout=1.0 sequence=AACGAGTCGGGGTGTTTGGGAAT Started job on | Dec 09 12:02:09 Started mapping on | Dec 09 12:02:10 Finished on | Dec 09 12:04:56 Mapping speed, Million of reads per hour | 140.39 Number of input reads | 6473618 Average input read length | 142 UNIQUE READS: Uniquely mapped reads number | 3508607 Uniquely mapped reads % | 54.20% Average mapped length | 133.07 Number of splices: Total | 298355 Number of splices: Annotated (sjdb) | 223723 Number of splices: GT/AG | 252027 Number of splices: GC/AG | 5463 Number of splices: AT/AC | 315 Number of splices: Non-canonical | 40550 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.01% Insertion average length | 1.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442479 % of reads mapped to multiple loci | 6.84% Number of reads mapped to too many loci | 1887501 % of reads mapped to too many loci | 29.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.76% % of reads unmapped: other | 2.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2522532 2522532 2522532 N_multimapping 442479 442479 442479 N_noFeature 331935 365009 3395997 N_ambiguous 94355 16861 449 UnstrandedReadsAssigned:3082317 PositiveStrandReadsAssigned:3126737 NegativeStrandReadsAssigned:112161 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR8635266 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635266-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,473,618 reads, 3,424,799 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52973 SRR8635266.ke.tsv 35125 SRR8635266.se.tsv 88098 total ==> SRR8635266.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 63 18.7337 PNS24243 293 194 0 0 KQK14069 1603 1504 35.1575 9.53691 KQK14071 474 375 0 0 ==> SRR8635266.se.tsv <== BRADI_1g14170v3 38 BRADI_1g53295v3 10 BRADI_1g59795v3 55 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 378 BRADI_1g74790v3 2 BRADI_1g09890v3 3 BRADI_1g77505v3 70 BRADI_1g48960v3 7 SRR8635266 completed mapping pipeline successfully