Starting /dee2/code/volunteer_pipeline.sh SRR8635267 current disk space = 1526160166912 free memory = 1553891084 SRR8635267 SRAfilesize 47db28875df0e9b855879e7a43b259ab SRR8635267.sra SRR8635267.sra file validated SRR8635267 is single end SRR8635267 is conventional basespace SRR8635267 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635267_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05375 32.0 32.0 32.0 32.0 32.0 2 30.4825 32.0 32.0 32.0 27.0 32.0 3 32.4275 32.0 32.0 37.0 22.0 37.0 4 33.475 37.0 32.0 37.0 27.0 37.0 5 34.80375 37.0 37.0 37.0 27.0 37.0 6 37.2425 41.0 37.0 41.0 27.0 41.0 7 37.90325 41.0 37.0 41.0 32.0 41.0 8 38.08575 41.0 37.0 41.0 32.0 41.0 9 38.03225 41.0 37.0 41.0 32.0 41.0 10-14 38.61245 41.0 37.0 41.0 34.0 41.0 15-19 38.289500000000004 41.0 37.0 41.0 32.0 41.0 20-24 37.966150000000006 41.0 37.0 41.0 31.0 41.0 25-29 38.21145 41.0 37.0 41.0 32.0 41.0 30-34 37.416000000000004 41.0 37.0 41.0 29.0 41.0 35-39 37.92550000000001 41.0 37.0 41.0 32.0 41.0 40-44 37.4157 41.0 37.0 41.0 28.0 41.0 45-49 37.513949999999994 41.0 37.0 41.0 29.0 41.0 50-54 34.91585 38.4 32.0 41.0 21.0 41.0 55-59 35.701499999999996 37.0 34.0 41.0 24.0 41.0 60-64 34.1636 37.8 32.0 41.0 20.0 41.0 65-69 34.01405 37.0 31.0 41.0 20.0 41.0 70-74 35.304500000000004 37.0 33.0 41.0 23.0 41.0 75-79 33.77865 36.0 31.0 40.2 20.0 41.0 80-84 34.69795 37.0 32.0 41.0 20.0 41.0 85-89 34.95504999999999 37.8 31.0 41.0 22.0 41.0 90-94 33.7257 37.0 31.0 41.0 18.0 41.0 95-99 30.91415 33.0 25.0 41.0 12.0 41.0 100-104 30.55405 33.0 25.0 39.4 12.0 41.0 105-109 29.189600000000002 32.0 22.0 37.0 12.0 41.0 110-114 27.1286 29.0 18.0 37.0 12.0 41.0 115-119 25.34655 26.0 16.0 35.0 11.2 39.2 120-124 18.75555 16.0 12.0 26.0 9.6 31.0 125-129 17.27315 14.0 12.0 23.0 8.8 28.0 130-134 18.405250000000002 16.0 12.0 23.0 9.6 30.0 135-139 16.3136 12.0 12.0 22.0 8.0 28.0 140-144 13.83295 12.0 12.0 12.0 8.0 22.0 145-149 14.0013 12.0 12.0 12.0 8.0 22.0 150 13.272 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 3.0 19 9.0 20 25.0 21 36.0 22 36.0 23 94.0 24 93.0 25 135.0 26 162.0 27 200.0 28 260.0 29 344.0 30 452.0 31 479.0 32 499.0 33 535.0 34 390.0 35 198.0 36 40.0 37 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.125 15.8 28.925 13.15 2 40.775 17.4 27.675 14.149999999999999 3 41.275 17.5 27.0 14.224999999999998 4 42.925000000000004 16.175 27.975 12.925 5 37.574999999999996 16.5 28.575 17.349999999999998 6 40.25 14.45 30.599999999999998 14.7 7 39.4 16.025 29.775000000000002 14.799999999999999 8 36.7 15.675 28.925 18.7 9 34.25 16.3 30.049999999999997 19.400000000000002 10-14 28.9 21.175 32.190000000000005 17.735 15-19 24.36 24.529999999999998 31.8 19.31 20-24 24.560000000000002 24.82 30.935000000000002 19.685 25-29 24.035 25.119999999999997 30.7 20.145 30-34 24.404999999999998 24.740000000000002 31.669999999999998 19.185 35-39 23.645 25.135 31.66 19.56 40-44 23.105 25.805 31.635 19.455 45-49 22.305 25.83 31.775 20.09 50-54 22.564999999999998 26.36 31.35 19.725 55-59 22.189999999999998 27.935 31.275 18.6 60-64 22.23 27.889999999999997 31.165 18.715 65-69 21.83 29.335 30.385 18.45 70-74 21.335 29.599999999999998 30.035 19.03 75-79 20.4 31.97 28.78 18.85 80-84 20.19 32.05 28.744999999999997 19.015 85-89 20.115 33.875 28.305000000000003 17.705000000000002 90-94 20.175 34.849999999999994 28.07 16.905 95-99 18.935 35.915 27.265 17.885 100-104 18.915000000000003 37.32 25.564999999999998 18.2 105-109 19.045 38.42 25.91 16.625 110-114 18.775 38.945 25.324999999999996 16.955000000000002 115-119 19.715 36.614999999999995 24.915000000000003 18.755 120-124 21.245 36.675000000000004 24.37 17.71 125-129 20.34 36.96 24.64 18.060000000000002 130-134 19.470000000000002 39.645 22.39 18.495 135-139 20.05 37.815 23.51 18.625 140-144 21.545 36.46 25.290000000000003 16.705000000000002 145-149 21.075 34.975 25.7 18.25 150 23.474999999999998 36.75 24.65 15.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 2.0 5 4.0 6 6.0 7 7.5 8 5.0 9 5.5 10 6.5 11 4.0 12 3.0 13 3.0 14 5.0 15 7.0 16 7.5 17 8.5 18 8.5 19 12.0 20 12.0 21 11.5 22 12.0 23 8.0 24 9.5 25 16.0 26 23.0 27 21.0 28 30.5 29 41.5 30 38.0 31 46.5 32 59.5 33 74.5 34 101.0 35 121.0 36 128.0 37 138.0 38 154.5 39 170.0 40 183.5 41 215.5 42 215.5 43 190.5 44 204.0 45 203.0 46 185.5 47 171.0 48 138.0 49 113.0 50 99.5 51 87.0 52 73.5 53 68.5 54 90.5 55 75.5 56 38.5 57 46.5 58 45.0 59 27.5 60 24.5 61 22.0 62 19.0 63 19.0 64 15.5 65 13.0 66 17.0 67 17.0 68 12.0 69 9.0 70 8.0 71 8.0 72 8.5 73 8.0 74 6.5 75 2.5 76 2.5 77 3.0 78 0.5 79 0.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.08021390374331 88.9 2 4.491978609625669 8.4 3 0.29411764705882354 0.8250000000000001 4 0.0 0.0 5 0.026737967914438502 0.125 6 0.026737967914438502 0.15 7 0.026737967914438502 0.17500000000000002 8 0.026737967914438502 0.2 9 0.0 0.0 >10 0.026737967914438502 1.225 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 49 1.225 No Hit AAGGCTAGCTGCACAAGCTAGGCCCTTATTTCCCTTTGTACGGGTGCATG 8 0.2 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 7 0.17500000000000002 No Hit GTGTTTCCCGTGTAACGGCTACTGATCCAGTGGTTAAGCTTCGGGTTGTA 6 0.15 No Hit GCCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.2125 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.2625 0.0 0.0 0.0 0.0 64-65 0.38749999999999996 0.0 0.0 0.0 0.0 66-67 0.525 0.0 0.0 0.0 0.0 68-69 0.6375 0.0 0.0 0.0 0.0 70-71 0.725 0.0 0.0 0.0 0.0 72-73 0.8 0.0 0.0 0.0 0.0 74-75 0.8374999999999999 0.0 0.0 0.0 0.0 76-77 0.975 0.0 0.0 0.0 0.0 78-79 1.1124999999999998 0.0 0.0 0.0 0.0 80-81 1.2000000000000002 0.0 0.0 0.0 0.0 82-83 1.3375 0.0 0.0 0.0 0.0 84-85 1.4874999999999998 0.0 0.0 0.0 0.0 86-87 1.725 0.0 0.0 0.0 0.0 88-89 1.875 0.0 0.0 0.0 0.0 90-91 2.0 0.0 0.0 0.0 0.0 92-93 2.275 0.0 0.0 0.0 0.0 94-95 2.5 0.0 0.0 0.0 0.0 96-97 2.75 0.0 0.0 0.0 0.0 98-99 3.125 0.0 0.0 0.0 0.0 100-101 3.55 0.0 0.0 0.0 0.0 102-103 3.7875 0.0 0.0 0.0 0.0 104-105 4.225 0.0 0.0 0.0 0.0 106-107 4.5 0.0 0.0 0.0 0.0 108-109 4.775 0.0 0.0 0.0 0.0 110-111 4.925 0.0 0.0 0.0 0.0 112-113 5.15 0.0 0.0 0.0 0.0 114-115 5.2875 0.0 0.0 0.0 0.0 116-117 5.362500000000001 0.0 0.0 0.0 0.0 118-119 5.45 0.0 0.0 0.0 0.0 120-121 5.5 0.0 0.0 0.0 0.0 122-123 5.574999999999999 0.0 0.0 0.0 0.0 124-125 5.725 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 5.925000000000001 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.0 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.05 0.0 0.0 0.0 0.0 138 6.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCTG 10 0.006973645 144.0 7 GTAGTGT 10 0.006973645 144.0 4 >>END_MODULE Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra Rejected 331696 READS because READLEN < 1 Read 331696 spots for SRR8635267.sra Written 331696 spots for SRR8635267.sra SRR ids: ['SRR8635267.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lnzm0jps SRR8635267.sra spots: 6633920 blocks: [[1, 331696], [331697, 663392], [663393, 995088], [995089, 1326784], [1326785, 1658480], [1658481, 1990176], [1990177, 2321872], [2321873, 2653568], [2653569, 2985264], [2985265, 3316960], [3316961, 3648656], [3648657, 3980352], [3980353, 4312048], [4312049, 4643744], [4643745, 4975440], [4975441, 5307136], [5307137, 5638832], [5638833, 5970528], [5970529, 6302224], [6302225, 6633920]] SRR8635267 file size 2219934 SRR8635267 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635267 SRR8635267_1.fastq Input file: SRR8635267_1.fastq trimmed: SRR8635267-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 11:59:12 2024 >> started Mon Dec 9 11:59:17 2024 >> done (5.024s) 6633920 reads processed; of these: 157 ( 0.00%) short reads filtered out after trimming by size control 47 ( 0.00%) empty reads filtered out after trimming by size control 6633716 (100.00%) reads available; of these: 1089751 (16.43%) trimmed reads available after processing 5543965 (83.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 71 0.00% 19 114 0.00% 20 146 0.00% 21 152 0.00% 22 200 0.00% 23 248 0.00% 24 271 0.00% 25 266 0.00% 26 221 0.00% 27 270 0.00% 28 309 0.00% 29 343 0.01% 30 344 0.01% 31 359 0.01% 32 376 0.01% 33 382 0.01% 34 375 0.01% 35 398 0.01% 36 439 0.01% 37 439 0.01% 38 491 0.01% 39 566 0.01% 40 516 0.01% 41 494 0.01% 42 467 0.01% 43 517 0.01% 44 513 0.01% 45 591 0.01% 46 599 0.01% 47 656 0.01% 48 697 0.01% 49 737 0.01% 50 844 0.01% 51 917 0.01% 52 977 0.01% 53 1182 0.02% 54 1339 0.02% 55 1429 0.02% 56 1575 0.02% 57 1665 0.03% 58 1889 0.03% 59 2045 0.03% 60 2209 0.03% 61 2246 0.03% 62 2342 0.04% 63 2329 0.04% 64 2369 0.04% 65 2540 0.04% 66 2724 0.04% 67 2841 0.04% 68 3032 0.05% 69 3233 0.05% 70 3624 0.05% 71 3930 0.06% 72 4142 0.06% 73 4366 0.07% 74 4639 0.07% 75 4958 0.07% 76 5209 0.08% 77 5616 0.08% 78 5937 0.09% 79 6437 0.10% 80 7139 0.11% 81 7844 0.12% 82 8131 0.12% 83 8591 0.13% 84 8969 0.14% 85 9535 0.14% 86 9773 0.15% 87 10372 0.16% 88 11139 0.17% 89 11293 0.17% 90 12052 0.18% 91 12741 0.19% 92 13201 0.20% 93 13275 0.20% 94 14022 0.21% 95 14815 0.22% 96 15543 0.23% 97 15383 0.23% 98 15867 0.24% 99 16171 0.24% 100 17028 0.26% 101 17354 0.26% 102 17768 0.27% 103 18086 0.27% 104 18532 0.28% 105 19131 0.29% 106 18927 0.29% 107 19581 0.30% 108 20033 0.30% 109 20632 0.31% 110 21254 0.32% 111 22008 0.33% 112 22244 0.34% 113 22796 0.34% 114 22685 0.34% 115 24452 0.37% 116 25525 0.38% 117 25503 0.38% 118 15973 0.24% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 1 0.00% 125 0 0.00% 126 1 0.00% 127 0 0.00% 128 2 0.00% 129 7 0.00% 130 2 0.00% 131 4 0.00% 132 12 0.00% 133 10 0.00% 134 15 0.00% 135 31 0.00% 136 53 0.00% 137 76 0.00% 138 112 0.00% 139 228 0.00% 140 350 0.01% 141 584 0.01% 142 1103 0.02% 143 1964 0.03% 144 3748 0.06% 145 6840 0.10% 146 13638 0.21% 147 30981 0.47% 148 80360 1.21% 149 223109 3.36% 150 5543965 83.57% 6633716 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=8.81 fanout-score-rank=22 prefix-density=2.53 prefix-fanout=1.4 sequence=TTATTTCCCTTCGGTTATTCTGTGAAGCAGCCAGCCAGGCTATTGTTGCTCTGAATAAGTCTAATAGCTCTAGGTGGTCAGCTGCGTCTACCACAATGAGCATATGTCTGAAGAAAAGTTGTCAAAAACCGCAATAAATAAGCATTATTGTCCTTCTGAATTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=166.80 fanout-score-rank=1 prefix-density=1.70 prefix-fanout=2.7 sequence=CTGCTGCTGGATGTATCTCTGATTAATGAGTTGCTGCTCTTTAGAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAA Started job on | Dec 09 12:01:04 Started mapping on | Dec 09 12:01:31 Finished on | Dec 09 12:02:03 Mapping speed, Million of reads per hour | 746.29 Number of input reads | 6633716 Average input read length | 144 UNIQUE READS: Uniquely mapped reads number | 5166639 Uniquely mapped reads % | 77.88% Average mapped length | 132.49 Number of splices: Total | 323445 Number of splices: Annotated (sjdb) | 222617 Number of splices: GT/AG | 261295 Number of splices: GC/AG | 6105 Number of splices: AT/AC | 234 Number of splices: Non-canonical | 55811 Mismatch rate per base, % | 0.59% Deletion rate per base | 0.00% Deletion average length | 1.51 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309727 % of reads mapped to multiple loci | 4.67% Number of reads mapped to too many loci | 152180 % of reads mapped to too many loci | 2.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.80% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1157350 1157350 1157350 N_multimapping 309727 309727 309727 N_noFeature 270751 332593 4969778 N_ambiguous 151416 18664 560 UnstrandedReadsAssigned:4744472 PositiveStrandReadsAssigned:4815382 NegativeStrandReadsAssigned:196301 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8635267 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635267-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,633,716 reads, 5,350,072 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52973 SRR8635267.ke.tsv 35125 SRR8635267.se.tsv 88098 total ==> SRR8635267.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 82 14.4549 PNS24243 293 194 0 0 KQK14069 1603 1504 2422.56 389.568 KQK14071 474 375 0 0 ==> SRR8635267.se.tsv <== BRADI_1g14170v3 1838 BRADI_1g53295v3 33 BRADI_1g59795v3 121 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 83 BRADI_1g74790v3 16 BRADI_1g09890v3 0 BRADI_1g77505v3 139 BRADI_1g48960v3 0 SRR8635267 completed mapping pipeline successfully