Starting /dee2/code/volunteer_pipeline.sh SRR8635268 current disk space = 1526160166912 free memory = 1553897880 SRR8635268 SRAfilesize 31efe6ee2c93029ae4302ffca152a2d5 SRR8635268.sra SRR8635268.sra file validated SRR8635268 is single end SRR8635268 is conventional basespace SRR8635268 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635268_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.16875 32.0 32.0 32.0 27.0 32.0 2 30.32625 32.0 32.0 32.0 27.0 32.0 3 32.135 32.0 32.0 37.0 22.0 37.0 4 33.68 37.0 32.0 37.0 27.0 37.0 5 34.80875 37.0 37.0 37.0 27.0 37.0 6 36.857 41.0 37.0 41.0 27.0 41.0 7 37.7645 41.0 37.0 41.0 32.0 41.0 8 38.2795 41.0 37.0 41.0 32.0 41.0 9 38.292 41.0 37.0 41.0 32.0 41.0 10-14 38.5663 41.0 37.0 41.0 33.0 41.0 15-19 38.36215 41.0 37.0 41.0 32.0 41.0 20-24 37.8568 41.0 37.0 41.0 31.0 41.0 25-29 37.8579 41.0 37.0 41.0 32.0 41.0 30-34 37.30565 41.0 37.0 41.0 28.0 41.0 35-39 37.8457 41.0 37.0 41.0 32.0 41.0 40-44 37.41685 41.0 37.0 41.0 29.0 41.0 45-49 37.504450000000006 41.0 37.0 41.0 29.0 41.0 50-54 35.2472 39.4 32.0 41.0 21.0 41.0 55-59 35.80305 37.8 34.0 41.0 25.0 41.0 60-64 34.5115 38.6 33.0 41.0 19.0 41.0 65-69 34.13925 37.0 31.0 41.0 20.0 41.0 70-74 35.21305 37.0 33.0 41.0 22.0 41.0 75-79 33.710300000000004 36.0 31.0 40.2 18.0 41.0 80-84 34.8306 37.0 32.0 41.0 20.0 41.0 85-89 34.98785 37.0 31.0 41.0 20.0 41.0 90-94 33.87265 37.0 32.0 41.0 18.0 41.0 95-99 31.41855 35.0 27.0 41.0 12.0 41.0 100-104 30.730849999999997 34.0 25.0 39.4 12.0 41.0 105-109 29.99955 32.0 22.0 38.6 12.0 41.0 110-114 28.033499999999997 30.0 20.0 37.0 12.0 41.0 115-119 26.527949999999997 26.0 16.0 35.0 12.0 40.2 120-124 19.979750000000003 18.0 12.0 26.0 10.4 35.0 125-129 18.2401 14.0 12.0 24.0 8.8 32.0 130-134 19.261149999999997 18.0 12.0 23.0 11.2 33.0 135-139 17.0487 12.0 12.0 23.0 8.8 29.0 140-144 14.0769 12.0 12.0 16.0 8.0 22.0 145-149 14.379050000000001 12.0 12.0 16.0 8.0 22.0 150 13.2705 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 6.0 19 7.0 20 20.0 21 39.0 22 53.0 23 71.0 24 107.0 25 116.0 26 184.0 27 189.0 28 256.0 29 286.0 30 357.0 31 451.0 32 482.0 33 520.0 34 453.0 35 259.0 36 115.0 37 23.0 38 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.925000000000004 16.375 28.749999999999996 12.950000000000001 2 43.9 15.325 26.3 14.475 3 41.575 17.275 28.225 12.925 4 43.225 16.650000000000002 27.025 13.100000000000001 5 38.5 18.375 26.75 16.375 6 40.949999999999996 15.775 28.9 14.374999999999998 7 38.324999999999996 17.075000000000003 28.65 15.950000000000001 8 38.074999999999996 15.525 28.925 17.474999999999998 9 34.625 15.65 30.725 19.0 10-14 29.185 21.765 32.074999999999996 16.975 15-19 25.585 23.54 31.645 19.23 20-24 25.845000000000002 24.27 30.435000000000002 19.45 25-29 24.815 24.365000000000002 30.880000000000003 19.939999999999998 30-34 24.505 24.279999999999998 31.44 19.775000000000002 35-39 24.490000000000002 24.175 31.435000000000002 19.900000000000002 40-44 24.14 25.080000000000002 31.215 19.564999999999998 45-49 22.98 25.81 31.115 20.095 50-54 22.939999999999998 25.16 31.59 20.31 55-59 22.585 25.955000000000002 32.1 19.36 60-64 23.265 26.43 31.740000000000002 18.565 65-69 22.63 26.625 31.825 18.92 70-74 21.675 28.46 31.05 18.815 75-79 21.22 30.205 29.744999999999997 18.83 80-84 21.065 30.935000000000002 29.21 18.790000000000003 85-89 21.145 32.31 28.815 17.73 90-94 21.265 32.65 28.685 17.4 95-99 20.555 33.845 27.49 18.11 100-104 19.835 35.410000000000004 26.39 18.365000000000002 105-109 20.105 35.91 25.88 18.105 110-114 19.425 36.464999999999996 26.375 17.735 115-119 20.465 35.03 26.0 18.505 120-124 22.305 34.605000000000004 25.305 17.785 125-129 21.279999999999998 36.0 24.725 17.995 130-134 20.595 37.135 23.7 18.57 135-139 20.115 36.230000000000004 24.975 18.68 140-144 22.85 34.894999999999996 25.045 17.21 145-149 22.189999999999998 34.260000000000005 25.35 18.2 150 21.725 37.4 25.074999999999996 15.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 1.0 5 2.0 6 2.5 7 1.5 8 1.5 9 3.0 10 2.0 11 0.0 12 0.5 13 7.5 14 9.5 15 5.5 16 6.0 17 8.0 18 8.0 19 8.5 20 11.0 21 8.0 22 8.0 23 11.0 24 9.5 25 12.5 26 17.0 27 18.0 28 23.0 29 29.5 30 34.0 31 48.0 32 63.0 33 71.5 34 81.0 35 93.0 36 111.0 37 138.0 38 174.5 39 181.0 40 183.5 41 205.0 42 202.0 43 197.5 44 196.5 45 190.5 46 181.0 47 166.5 48 132.5 49 117.5 50 119.5 51 109.5 52 100.5 53 87.5 54 94.0 55 79.5 56 56.0 57 57.5 58 48.5 59 34.5 60 27.0 61 26.0 62 27.0 63 20.0 64 14.5 65 14.0 66 14.0 67 14.0 68 11.5 69 13.0 70 15.5 71 11.5 72 7.0 73 4.5 74 4.0 75 3.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.4 #Duplication Level Percentage of deduplicated Percentage of total 1 94.80728051391864 88.55 2 4.443254817987152 8.3 3 0.4817987152034261 1.35 4 0.10706638115631692 0.4 5 0.05353319057815846 0.25 6 0.05353319057815846 0.3 7 0.0 0.0 8 0.0 0.0 9 0.02676659528907923 0.22499999999999998 >10 0.02676659528907923 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 25 0.625 No Hit ATGTCTGTCACGTACGTGGTCGTGCAAAAAACCCTGAAAGTTTAATTGGC 9 0.22499999999999998 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 6 0.15 No Hit CGACCGTATTGTTCATCCGACACGATCCATGTCCTTCCTCATGCCTCGCT 6 0.15 No Hit AAGGCTAGCTGCACAAGCTAGGCCCTTATTTCCCTTTGTACGGGTGCATG 5 0.125 No Hit GGGAGGGTGAGAGCCCCGTCCGGCCCGGACCCTGTCGCCCCACGAGGCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.037500000000000006 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.0875 0.0 0.0 0.0 0.0 46-47 0.1125 0.0 0.0 0.0 0.0 48-49 0.1375 0.0 0.0 0.0 0.0 50-51 0.16249999999999998 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.1875 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.25 0.0 0.0 0.0 0.0 60-61 0.2875 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.32499999999999996 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.45 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.5 0.0 0.0 0.0 0.0 74-75 0.5874999999999999 0.0 0.0 0.0 0.0 76-77 0.6375 0.0 0.0 0.0 0.0 78-79 0.7125 0.0 0.0 0.0 0.0 80-81 0.9125 0.0 0.0 0.0 0.0 82-83 1.0875 0.0 0.0 0.0 0.0 84-85 1.2 0.0 0.0 0.0 0.0 86-87 1.4125 0.0 0.0 0.0 0.0 88-89 1.6625 0.0 0.0 0.0 0.0 90-91 1.9 0.0 0.0 0.0 0.0 92-93 2.05 0.0 0.0 0.0 0.0 94-95 2.2625 0.0 0.0 0.0 0.0 96-97 2.5375 0.0 0.0 0.0 0.0 98-99 2.7375 0.0 0.0 0.0 0.0 100-101 3.125 0.0 0.0 0.0 0.0 102-103 3.3 0.0 0.0 0.0 0.0 104-105 3.625 0.0 0.0 0.0 0.0 106-107 4.025 0.0 0.0 0.0 0.0 108-109 4.175 0.0 0.0 0.0 0.0 110-111 4.4375 0.0 0.0 0.0 0.0 112-113 4.575 0.0 0.0 0.0 0.0 114-115 4.6875 0.0 0.0 0.0 0.0 116-117 4.7625 0.0 0.0 0.0 0.0 118-119 4.875 0.0 0.0 0.0 0.0 120-121 4.9375 0.0 0.0 0.0 0.0 122-123 5.0125 0.0 0.0 0.0 0.0 124-125 5.074999999999999 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.25 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.3 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 5.3625 0.0 0.0 0.0 0.0 138 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGAGG 10 0.006973645 144.0 1 >>END_MODULE Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220458 READS because READLEN < 1 Read 220458 spots for SRR8635268.sra Written 220458 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra Rejected 220447 READS because READLEN < 1 Read 220447 spots for SRR8635268.sra Written 220447 spots for SRR8635268.sra SRR ids: ['SRR8635268.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cf2_qo2s SRR8635268.sra spots: 4408951 blocks: [[1, 220447], [220448, 440894], [440895, 661341], [661342, 881788], [881789, 1102235], [1102236, 1322682], [1322683, 1543129], [1543130, 1763576], [1763577, 1984023], [1984024, 2204470], [2204471, 2424917], [2424918, 2645364], [2645365, 2865811], [2865812, 3086258], [3086259, 3306705], [3306706, 3527152], [3527153, 3747599], [3747600, 3968046], [3968047, 4188493], [4188494, 4408951]] SRR8635268 file size 1474657 SRR8635268 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635268 SRR8635268_1.fastq Input file: SRR8635268_1.fastq trimmed: SRR8635268-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 11:59:06 2024 >> started Mon Dec 9 11:59:10 2024 >> done (4.089s) 4408951 reads processed; of these: 113 ( 0.00%) short reads filtered out after trimming by size control 35 ( 0.00%) empty reads filtered out after trimming by size control 4408803 (100.00%) reads available; of these: 681942 (15.47%) trimmed reads available after processing 3726861 (84.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 54 0.00% 19 99 0.00% 20 76 0.00% 21 129 0.00% 22 171 0.00% 23 204 0.00% 24 207 0.00% 25 198 0.00% 26 185 0.00% 27 190 0.00% 28 199 0.00% 29 246 0.01% 30 223 0.01% 31 227 0.01% 32 237 0.01% 33 236 0.01% 34 229 0.01% 35 293 0.01% 36 285 0.01% 37 283 0.01% 38 318 0.01% 39 321 0.01% 40 266 0.01% 41 288 0.01% 42 306 0.01% 43 315 0.01% 44 288 0.01% 45 327 0.01% 46 365 0.01% 47 427 0.01% 48 448 0.01% 49 484 0.01% 50 496 0.01% 51 577 0.01% 52 637 0.01% 53 701 0.02% 54 840 0.02% 55 849 0.02% 56 939 0.02% 57 1021 0.02% 58 1131 0.03% 59 1233 0.03% 60 1263 0.03% 61 1341 0.03% 62 1362 0.03% 63 1344 0.03% 64 1456 0.03% 65 1497 0.03% 66 1578 0.04% 67 1715 0.04% 68 1721 0.04% 69 1947 0.04% 70 1983 0.04% 71 2189 0.05% 72 2434 0.06% 73 2564 0.06% 74 2761 0.06% 75 2998 0.07% 76 3233 0.07% 77 3249 0.07% 78 3638 0.08% 79 4038 0.09% 80 4439 0.10% 81 4706 0.11% 82 5014 0.11% 83 5114 0.12% 84 5443 0.12% 85 5785 0.13% 86 6073 0.14% 87 6406 0.15% 88 6558 0.15% 89 6916 0.16% 90 7176 0.16% 91 7709 0.17% 92 7775 0.18% 93 8141 0.18% 94 8483 0.19% 95 8930 0.20% 96 9179 0.21% 97 9112 0.21% 98 9471 0.21% 99 9556 0.22% 100 10119 0.23% 101 10452 0.24% 102 10808 0.25% 103 10727 0.24% 104 11209 0.25% 105 11713 0.27% 106 11370 0.26% 107 12013 0.27% 108 12342 0.28% 109 12811 0.29% 110 13170 0.30% 111 13635 0.31% 112 13785 0.31% 113 14195 0.32% 114 14160 0.32% 115 15560 0.35% 116 16229 0.37% 117 16182 0.37% 118 10153 0.23% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 1 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 1 0.00% 129 2 0.00% 130 0 0.00% 131 4 0.00% 132 2 0.00% 133 6 0.00% 134 8 0.00% 135 17 0.00% 136 17 0.00% 137 48 0.00% 138 57 0.00% 139 100 0.00% 140 190 0.00% 141 351 0.01% 142 602 0.01% 143 1211 0.03% 144 2288 0.05% 145 4445 0.10% 146 8563 0.19% 147 19979 0.45% 148 51743 1.17% 149 148829 3.38% 150 3726861 84.53% 4408803 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=8.62 fanout-score-rank=25 prefix-density=2.21 prefix-fanout=1.4 sequence=TTATTTCCCTTCGGTTATTCTGTGAAGCAGCCAGCCAGGCTATTGTTGCTCTGAATAAGTCTAATAGCTCTAGGTGGTCAGCTGCGTCTACCACAATGAGCATATGTCTGAAGAAAAGTTGTCAAAAACCGCAATAAATAAGCATTATTGTCCTTCTGAATTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=141.29 fanout-score-rank=1 prefix-density=1.75 prefix-fanout=2.6 sequence=CTGCTGCTGGATGTATCTCTGATTAATGAGTTGCTGCTCTTTAGAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAATACTTTAAGCACCT Started job on | Dec 09 12:01:50 Started mapping on | Dec 09 12:01:51 Finished on | Dec 09 12:02:47 Mapping speed, Million of reads per hour | 283.42 Number of input reads | 4408803 Average input read length | 140 UNIQUE READS: Uniquely mapped reads number | 3483506 Uniquely mapped reads % | 79.01% Average mapped length | 130.95 Number of splices: Total | 226638 Number of splices: Annotated (sjdb) | 161623 Number of splices: GT/AG | 185051 Number of splices: GC/AG | 3831 Number of splices: AT/AC | 270 Number of splices: Non-canonical | 37486 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249462 % of reads mapped to multiple loci | 5.66% Number of reads mapped to too many loci | 151161 % of reads mapped to too many loci | 3.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.42% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 675835 675835 675835 N_multimapping 249462 249462 249462 N_noFeature 195316 235878 3353663 N_ambiguous 100176 12401 345 UnstrandedReadsAssigned:3188014 PositiveStrandReadsAssigned:3235227 NegativeStrandReadsAssigned:129498 Dataset is classified positive stranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR8635268 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635268-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,408,803 reads, 3,523,691 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52973 SRR8635268.ke.tsv 35125 SRR8635268.se.tsv 88098 total ==> SRR8635268.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 70 18.8705 PNS24243 293 194 0 0 KQK14069 1603 1504 1460.22 359.095 KQK14071 474 375 0 0 ==> SRR8635268.se.tsv <== BRADI_1g14170v3 1122 BRADI_1g53295v3 19 BRADI_1g59795v3 96 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 81 BRADI_1g74790v3 23 BRADI_1g09890v3 0 BRADI_1g77505v3 77 BRADI_1g48960v3 0 SRR8635268 completed mapping pipeline successfully