Starting /dee2/code/volunteer_pipeline.sh SRR8635269 current disk space = 1526127648768 free memory = 1574172176 SRR8635269 SRAfilesize 66a872b64cc9192093e148c075438c4d SRR8635269.sra SRR8635269.sra file validated SRR8635269 is single end SRR8635269 is conventional basespace SRR8635269 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635269_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.6175 32.0 32.0 32.0 27.0 32.0 2 30.8425 32.0 32.0 32.0 27.0 32.0 3 31.2275 32.0 32.0 37.0 22.0 37.0 4 32.05375 37.0 27.0 37.0 22.0 37.0 5 33.56125 37.0 32.0 37.0 27.0 37.0 6 35.441 37.0 32.0 41.0 27.0 41.0 7 36.90825 41.0 37.0 41.0 27.0 41.0 8 37.416 41.0 37.0 41.0 27.0 41.0 9 37.825 41.0 37.0 41.0 32.0 41.0 10-14 38.3959 41.0 37.0 41.0 32.0 41.0 15-19 37.957 41.0 37.0 41.0 30.0 41.0 20-24 37.52725 41.0 37.0 41.0 30.0 41.0 25-29 37.750249999999994 41.0 37.0 41.0 29.0 41.0 30-34 37.17745 41.0 37.0 41.0 27.0 41.0 35-39 37.626549999999995 41.0 37.0 41.0 31.0 41.0 40-44 36.7297 41.0 36.0 41.0 26.0 41.0 45-49 36.8942 41.0 37.0 41.0 27.0 41.0 50-54 33.92235 38.4 31.0 40.2 20.0 41.0 55-59 34.790150000000004 37.0 32.0 41.0 22.0 41.0 60-64 33.07745 36.0 28.0 41.0 18.0 41.0 65-69 32.9108 37.0 30.0 41.0 18.0 41.0 70-74 34.351299999999995 37.0 32.0 41.0 18.0 41.0 75-79 32.7472 36.0 29.0 39.4 18.0 41.0 80-84 34.02395 37.0 31.0 41.0 18.0 41.0 85-89 34.2428 37.0 31.0 41.0 20.0 41.0 90-94 32.84225000000001 37.0 27.0 41.0 14.0 41.0 95-99 30.027549999999998 32.0 24.0 38.6 12.0 41.0 100-104 29.54175 32.0 22.0 37.0 12.0 41.0 105-109 28.69495 32.0 22.0 37.0 12.0 41.0 110-114 26.747000000000003 28.0 18.0 37.0 12.0 41.0 115-119 24.863149999999997 26.0 16.0 34.0 11.2 37.6 120-124 18.39385 16.0 12.0 25.0 10.4 31.0 125-129 16.96045 14.0 12.0 23.0 8.8 28.0 130-134 18.0891 16.0 12.0 23.0 11.2 29.0 135-139 16.0951 12.0 12.0 22.0 8.8 27.0 140-144 13.794299999999998 12.0 12.0 12.0 8.0 22.0 145-149 14.0286 12.0 12.0 14.0 8.0 22.0 150 13.32275 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 5.0 19 15.0 20 24.0 21 48.0 22 69.0 23 100.0 24 113.0 25 164.0 26 216.0 27 229.0 28 292.0 29 409.0 30 443.0 31 469.0 32 506.0 33 465.0 34 294.0 35 104.0 36 28.0 37 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.375 15.575 30.675 14.374999999999998 2 40.125 15.925 28.4 15.55 3 39.875 17.075000000000003 28.849999999999998 14.2 4 41.15 16.75 27.275 14.825 5 36.175000000000004 16.775000000000002 29.125 17.925 6 39.825 15.775 29.375 15.024999999999999 7 38.224999999999994 17.175 29.25 15.35 8 35.8 16.675 29.475 18.05 9 32.4 16.625 30.85 20.125 10-14 28.615000000000002 21.675 32.11 17.599999999999998 15-19 25.355 24.59 30.81 19.245 20-24 25.130000000000003 24.57 29.825000000000003 20.474999999999998 25-29 24.84 24.685000000000002 30.564999999999998 19.91 30-34 24.36 24.72 30.330000000000002 20.59 35-39 23.98 25.205 30.91 19.905 40-44 23.974999999999998 25.575 30.990000000000002 19.46 45-49 23.095 26.145000000000003 31.209999999999997 19.55 50-54 22.830000000000002 26.055 31.4 19.715 55-59 22.155 27.625 31.095 19.125 60-64 22.68 27.639999999999997 30.575000000000003 19.105 65-69 22.770000000000003 28.01 30.455 18.765 70-74 21.61 29.880000000000003 30.159999999999997 18.35 75-79 21.560000000000002 30.005 29.675 18.759999999999998 80-84 21.73 30.64 28.96 18.67 85-89 21.4 31.78 28.965000000000003 17.854999999999997 90-94 21.525 32.14 28.305000000000003 18.029999999999998 95-99 20.595 32.525 28.595 18.285 100-104 20.285 33.665 27.07 18.98 105-109 20.28 35.495 26.634999999999998 17.59 110-114 19.73 35.709999999999994 27.105 17.455000000000002 115-119 20.13 34.265 27.089999999999996 18.515 120-124 22.720000000000002 32.82 27.185 17.275 125-129 21.25 33.51 27.055 18.185000000000002 130-134 20.895 36.435 25.679999999999996 16.99 135-139 21.2 34.86 26.395000000000003 17.544999999999998 140-144 22.575 34.94 27.11 15.375 145-149 21.965 33.19 27.685 17.16 150 23.25 37.125 25.7 13.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 2.0 4 3.0 5 3.5 6 4.0 7 2.0 8 1.5 9 4.0 10 6.5 11 8.0 12 7.5 13 6.5 14 7.0 15 9.5 16 9.5 17 9.5 18 10.0 19 10.5 20 11.0 21 12.0 22 10.5 23 12.0 24 13.0 25 13.5 26 15.0 27 16.0 28 25.0 29 29.0 30 30.5 31 41.5 32 52.5 33 65.5 34 81.0 35 91.0 36 118.0 37 146.0 38 162.5 39 182.5 40 203.5 41 210.5 42 195.5 43 182.0 44 174.0 45 164.0 46 164.5 47 167.5 48 154.5 49 132.0 50 110.5 51 94.5 52 80.0 53 81.0 54 100.0 55 91.5 56 63.5 57 49.5 58 39.5 59 28.0 60 27.0 61 29.5 62 31.5 63 28.5 64 22.0 65 19.0 66 19.5 67 16.0 68 11.0 69 9.0 70 9.0 71 14.0 72 15.0 73 11.5 74 5.0 75 4.5 76 4.0 77 1.5 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 94.2656207736002 87.125 2 4.814714633486611 8.9 3 0.5950770895320531 1.6500000000000001 4 0.18934271030565322 0.7000000000000001 5 0.054097917230186636 0.25 6 0.027048958615093318 0.15 7 0.027048958615093318 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.027048958615093318 1.05 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 42 1.05 No Hit ATGTCTGTCACGTACGTGGTCGTGCAAAAAACCCTGAAAGTTTAATTGGC 7 0.17500000000000002 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 6 0.15 No Hit AGGACAACTGCACTGCAAGCATGCACCCACCATCGCCGCCCAGCTAGCTA 5 0.125 No Hit GATGTCTGCTGTTTCGTCCCCGTGCAATTTGTTTTGACTTATTTCCCTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.037500000000000006 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1375 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.2625 0.0 0.0 0.0 0.0 66-67 0.32499999999999996 0.0 0.0 0.0 0.0 68-69 0.4 0.0 0.0 0.0 0.0 70-71 0.4625 0.0 0.0 0.0 0.0 72-73 0.65 0.0 0.0 0.0 0.0 74-75 0.775 0.0 0.0 0.0 0.0 76-77 0.8625 0.0 0.0 0.0 0.0 78-79 1.0375 0.0 0.0 0.0 0.0 80-81 1.175 0.0 0.0 0.0 0.0 82-83 1.2374999999999998 0.0 0.0 0.0 0.0 84-85 1.35 0.0 0.0 0.0 0.0 86-87 1.475 0.0 0.0 0.0 0.0 88-89 1.6 0.0 0.0 0.0 0.0 90-91 1.7000000000000002 0.0 0.0 0.0 0.0 92-93 1.875 0.0 0.0 0.0 0.0 94-95 2.0374999999999996 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.3625 0.0 0.0 0.0 0.0 100-101 2.6125 0.0 0.0 0.0 0.0 102-103 2.875 0.0 0.0 0.0 0.0 104-105 3.175 0.0 0.0 0.0 0.0 106-107 3.3 0.0 0.0 0.0 0.0 108-109 3.4625 0.0 0.0 0.0 0.0 110-111 3.6125 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 3.7625 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 3.9 0.0 0.0 0.0 0.0 124-125 3.9124999999999996 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.05 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.1 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 10 0.006973645 144.0 1 >>END_MODULE Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432177 READS because READLEN < 1 Read 432177 spots for SRR8635269.sra Written 432177 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra Rejected 432159 READS because READLEN < 1 Read 432159 spots for SRR8635269.sra Written 432159 spots for SRR8635269.sra SRR ids: ['SRR8635269.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nevk3szy SRR8635269.sra spots: 8643198 blocks: [[1, 432159], [432160, 864318], [864319, 1296477], [1296478, 1728636], [1728637, 2160795], [2160796, 2592954], [2592955, 3025113], [3025114, 3457272], [3457273, 3889431], [3889432, 4321590], [4321591, 4753749], [4753750, 5185908], [5185909, 5618067], [5618068, 6050226], [6050227, 6482385], [6482386, 6914544], [6914545, 7346703], [7346704, 7778862], [7778863, 8211021], [8211022, 8643198]] SRR8635269 file size 2892964 SRR8635269 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635269 SRR8635269_1.fastq Input file: SRR8635269_1.fastq trimmed: SRR8635269-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:12:11 2024 >> started Mon Dec 9 12:12:16 2024 >> done (5.841s) 8643198 reads processed; of these: 270 ( 0.00%) short reads filtered out after trimming by size control 92 ( 0.00%) empty reads filtered out after trimming by size control 8642836 (100.00%) reads available; of these: 1052874 (12.18%) trimmed reads available after processing 7589962 (87.82%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 192 0.00% 19 399 0.00% 20 384 0.00% 21 360 0.00% 22 469 0.01% 23 510 0.01% 24 511 0.01% 25 467 0.01% 26 423 0.00% 27 393 0.00% 28 419 0.00% 29 499 0.01% 30 459 0.01% 31 450 0.01% 32 433 0.01% 33 503 0.01% 34 468 0.01% 35 507 0.01% 36 534 0.01% 37 581 0.01% 38 596 0.01% 39 651 0.01% 40 614 0.01% 41 664 0.01% 42 675 0.01% 43 675 0.01% 44 736 0.01% 45 713 0.01% 46 796 0.01% 47 853 0.01% 48 958 0.01% 49 982 0.01% 50 1128 0.01% 51 1235 0.01% 52 1383 0.02% 53 1642 0.02% 54 1837 0.02% 55 2011 0.02% 56 2043 0.02% 57 2142 0.02% 58 2393 0.03% 59 2683 0.03% 60 2820 0.03% 61 2973 0.03% 62 2967 0.03% 63 3154 0.04% 64 3020 0.03% 65 3139 0.04% 66 3313 0.04% 67 3451 0.04% 68 3638 0.04% 69 3870 0.04% 70 4152 0.05% 71 4467 0.05% 72 4770 0.06% 73 4954 0.06% 74 5425 0.06% 75 5407 0.06% 76 5891 0.07% 77 6246 0.07% 78 6463 0.07% 79 7017 0.08% 80 7537 0.09% 81 8020 0.09% 82 8560 0.10% 83 8470 0.10% 84 8917 0.10% 85 9363 0.11% 86 9716 0.11% 87 10102 0.12% 88 10265 0.12% 89 10762 0.12% 90 11035 0.13% 91 11693 0.14% 92 11917 0.14% 93 11968 0.14% 94 12423 0.14% 95 13074 0.15% 96 13428 0.16% 97 13451 0.16% 98 13715 0.16% 99 13910 0.16% 100 14391 0.17% 101 14588 0.17% 102 14946 0.17% 103 15449 0.18% 104 15762 0.18% 105 15881 0.18% 106 16049 0.19% 107 16339 0.19% 108 17064 0.20% 109 17261 0.20% 110 17944 0.21% 111 18770 0.22% 112 19057 0.22% 113 19441 0.22% 114 19572 0.23% 115 20920 0.24% 116 22053 0.26% 117 21997 0.25% 118 14301 0.17% 119 1 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 1 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 0 0.00% 131 3 0.00% 132 1 0.00% 133 3 0.00% 134 3 0.00% 135 15 0.00% 136 18 0.00% 137 40 0.00% 138 78 0.00% 139 148 0.00% 140 213 0.00% 141 404 0.00% 142 726 0.01% 143 1569 0.02% 144 3004 0.03% 145 5795 0.07% 146 11994 0.14% 147 27993 0.32% 148 78177 0.90% 149 249069 2.88% 150 7589962 87.82% 8642836 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=7.94 fanout-score-rank=24 prefix-density=2.12 prefix-fanout=1.5 sequence=TTATTTCCCTTCGGTTATTCTGTGAAGCAGCCAGCCAGGCTATTGTTGCTCTGAATAAGTCTAATAGCTCTAGGTGGTCAGCTGCGTCTACCACAATGAGCATATGTCTGAAGAAAAGTTGTCAAAAACCGCAATAAATAAGCATTATTGTCCTTCTGAATTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=132.13 fanout-score-rank=1 prefix-density=1.50 prefix-fanout=3.8 sequence=CTGCTGCTGGATGTATCTCTGATTAATGAGTTGCTGCTCTTTAGAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAATACTTTAAGCACCT Started job on | Dec 09 12:13:56 Started mapping on | Dec 09 12:13:56 Finished on | Dec 09 12:14:23 Mapping speed, Million of reads per hour | 1152.38 Number of input reads | 8642836 Average input read length | 141 UNIQUE READS: Uniquely mapped reads number | 6906193 Uniquely mapped reads % | 79.91% Average mapped length | 133.57 Number of splices: Total | 485190 Number of splices: Annotated (sjdb) | 361445 Number of splices: GT/AG | 413150 Number of splices: GC/AG | 7840 Number of splices: AT/AC | 621 Number of splices: Non-canonical | 63579 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 390866 % of reads mapped to multiple loci | 4.52% Number of reads mapped to too many loci | 232153 % of reads mapped to too many loci | 2.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.44% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1345777 1345777 1345777 N_multimapping 390866 390866 390866 N_noFeature 353678 434718 6640647 N_ambiguous 205313 23523 743 UnstrandedReadsAssigned:6347202 PositiveStrandReadsAssigned:6447952 NegativeStrandReadsAssigned:264803 Dataset is classified positive stranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR8635269 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635269-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,642,836 reads, 6,951,107 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52973 SRR8635269.ke.tsv 35125 SRR8635269.se.tsv 88098 total ==> SRR8635269.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0.361255 0.0727977 PNS24249 1928 1829 0 0 PNS24246 1044 945 0.361255 0.0727977 PNS24248 1044 945 0.361255 0.0727977 PNS24244 1471 1372 129.916 18.032 PNS24243 293 194 0 0 KQK14069 1603 1504 3597.39 455.486 KQK14071 474 375 2.06351 1.04788 ==> SRR8635269.se.tsv <== BRADI_1g14170v3 2855 BRADI_1g53295v3 46 BRADI_1g59795v3 208 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 152 BRADI_1g74790v3 27 BRADI_1g09890v3 0 BRADI_1g77505v3 184 BRADI_1g48960v3 0 SRR8635269 completed mapping pipeline successfully