Starting /dee2/code/volunteer_pipeline.sh SRR8635270 current disk space = 1526132469760 free memory = 1574189536 SRR8635270 SRAfilesize 8038cf0a49733cd4dd5a9165979fca8e SRR8635270.sra SRR8635270.sra file validated SRR8635270 is single end SRR8635270 is conventional basespace SRR8635270 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635270_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.8975 32.0 32.0 32.0 27.0 32.0 2 30.72875 32.0 32.0 32.0 27.0 32.0 3 32.34875 32.0 32.0 37.0 22.0 37.0 4 33.67 37.0 32.0 37.0 27.0 37.0 5 34.94625 37.0 37.0 37.0 27.0 37.0 6 37.359 41.0 37.0 41.0 27.0 41.0 7 37.98025 41.0 37.0 41.0 32.0 41.0 8 38.0965 41.0 37.0 41.0 32.0 41.0 9 38.43675 41.0 37.0 41.0 32.0 41.0 10-14 38.643449999999994 41.0 37.0 41.0 33.0 41.0 15-19 38.16545000000001 41.0 37.0 41.0 31.0 41.0 20-24 37.736399999999996 41.0 37.0 41.0 31.0 41.0 25-29 37.712450000000004 41.0 37.0 41.0 29.0 41.0 30-34 37.147499999999994 41.0 37.0 41.0 27.0 41.0 35-39 37.65304999999999 41.0 37.0 41.0 31.0 41.0 40-44 37.1101 41.0 37.0 41.0 28.0 41.0 45-49 37.519600000000004 41.0 37.0 41.0 29.0 41.0 50-54 34.5992 38.4 32.0 41.0 21.0 41.0 55-59 35.3557 37.0 32.0 41.0 23.0 41.0 60-64 33.863150000000005 37.0 30.0 41.0 19.0 41.0 65-69 33.6163 37.0 30.0 41.0 18.0 41.0 70-74 35.04095 37.0 33.0 41.0 23.0 41.0 75-79 33.6476 36.0 31.0 40.2 18.0 41.0 80-84 34.62835 37.0 32.0 41.0 20.0 41.0 85-89 34.896499999999996 37.0 31.0 41.0 21.0 41.0 90-94 33.59285 37.0 31.0 41.0 18.0 41.0 95-99 30.723300000000002 33.0 25.0 40.2 12.0 41.0 100-104 30.49045 32.0 25.0 38.6 12.0 41.0 105-109 29.563199999999995 32.0 22.0 37.0 12.0 41.0 110-114 27.596600000000002 30.0 20.0 37.0 12.0 41.0 115-119 25.638799999999996 26.0 16.0 35.0 11.2 39.2 120-124 18.861749999999997 16.0 12.0 26.0 9.6 31.0 125-129 17.432399999999994 14.0 12.0 23.0 8.8 28.0 130-134 18.573 16.0 12.0 23.0 11.2 31.0 135-139 16.46655 12.0 12.0 22.0 8.8 28.0 140-144 13.7985 12.0 12.0 14.0 8.0 22.0 145-149 14.08105 12.0 12.0 14.0 8.0 22.0 150 13.31425 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 4.0 19 15.0 20 16.0 21 36.0 22 55.0 23 99.0 24 113.0 25 146.0 26 174.0 27 211.0 28 277.0 29 312.0 30 387.0 31 452.0 32 489.0 33 547.0 34 418.0 35 199.0 36 47.0 37 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.6 15.625 30.975 12.8 2 42.525 15.45 27.775 14.249999999999998 3 41.349999999999994 16.6 28.375 13.675 4 42.425000000000004 15.299999999999999 28.749999999999996 13.525 5 38.175 15.325 29.175 17.325 6 40.925 14.2 30.8 14.075 7 39.85 16.425 29.049999999999997 14.674999999999999 8 37.824999999999996 14.325 30.975 16.875 9 33.6 15.85 30.9 19.650000000000002 10-14 28.875 21.12 33.35 16.655 15-19 25.06 23.875 32.214999999999996 18.85 20-24 25.28 24.34 30.930000000000003 19.45 25-29 24.515 24.36 31.540000000000003 19.585 30-34 24.895 24.044999999999998 31.385 19.675 35-39 23.905 24.855 31.924999999999997 19.314999999999998 40-44 23.895 25.34 31.175000000000004 19.59 45-49 23.205000000000002 25.729999999999997 31.430000000000003 19.634999999999998 50-54 22.509999999999998 26.075 32.214999999999996 19.2 55-59 22.39 26.450000000000003 32.455 18.705 60-64 23.080000000000002 26.46 31.56 18.9 65-69 22.74 27.87 30.725 18.665000000000003 70-74 21.89 28.07 32.045 17.995 75-79 21.445 29.26 30.945 18.35 80-84 20.48 30.470000000000002 30.25 18.8 85-89 20.630000000000003 32.08 29.854999999999997 17.435000000000002 90-94 21.325 32.705 29.435 16.535 95-99 20.57 33.815 27.88 17.735 100-104 19.365 35.135 27.860000000000003 17.64 105-109 20.32 35.815000000000005 27.04 16.825000000000003 110-114 19.595000000000002 36.295 27.355 16.755 115-119 20.505000000000003 35.29 26.08 18.125 120-124 22.36 34.92 25.369999999999997 17.349999999999998 125-129 20.87 35.085 25.465 18.58 130-134 19.74 38.305 24.035 17.919999999999998 135-139 20.64 36.309999999999995 24.585 18.465 140-144 22.49 35.47 25.564999999999998 16.475 145-149 21.67 34.1 25.990000000000002 18.240000000000002 150 23.05 38.4 24.025 14.524999999999999 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 1.5 5 2.0 6 2.0 7 4.5 8 6.0 9 4.5 10 2.0 11 3.0 12 4.5 13 4.5 14 4.0 15 5.5 16 8.5 17 8.0 18 7.0 19 7.0 20 8.5 21 8.0 22 6.0 23 11.0 24 16.5 25 17.0 26 18.5 27 22.5 28 24.5 29 25.5 30 29.5 31 42.0 32 64.5 33 78.0 34 93.5 35 111.5 36 120.0 37 140.0 38 166.0 39 184.0 40 200.0 41 211.0 42 220.5 43 228.5 44 224.5 45 194.5 46 165.0 47 150.5 48 125.0 49 118.5 50 107.5 51 93.5 52 83.5 53 72.0 54 86.5 55 78.5 56 51.0 57 39.5 58 36.5 59 32.5 60 24.5 61 20.5 62 18.0 63 14.0 64 15.0 65 19.0 66 17.5 67 14.5 68 15.5 69 14.0 70 10.0 71 11.5 72 10.5 73 6.5 74 4.5 75 1.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.20289855072464 87.75 2 5.314009661835748 9.9 3 0.3757380568974772 1.05 4 0.0 0.0 5 0.08051529790660225 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026838432635534086 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 37 0.9249999999999999 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 5 0.125 No Hit ATGTCTGTCACGTACGTGGTCGTGCAAAAAACCCTGAAAGTTTAATTGGC 5 0.125 No Hit CGACCGTATTGTTCATCCGACACGATCCATGTCCTTCCTCATGCCTCGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1375 0.0 0.0 0.0 0.0 62-63 0.1875 0.0 0.0 0.0 0.0 64-65 0.21250000000000002 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.2625 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.325 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.4625 0.0 0.0 0.0 0.0 78-79 0.5375000000000001 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.675 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.2125 0.0 0.0 0.0 0.0 92-93 1.4125 0.0 0.0 0.0 0.0 94-95 1.5750000000000002 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.1625 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.0 0.0 0.0 0.0 0.0 108-109 3.125 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 3.8875 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.050000000000001 0.0 0.0 0.0 0.0 126-127 4.1125 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.225 0.0 0.0 0.0 0.0 136-137 4.225 0.0 0.0 0.0 0.0 138 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCATGA 15 1.1730364E-4 144.0 7 CCGCTAC 10 0.006973645 144.0 2 ACCGCTA 10 0.006973645 144.0 1 CCATGAA 15 1.1730364E-4 144.0 8 TCGGATG 10 0.006973645 144.0 7 CGCTACC 10 0.006973645 144.0 3 GTGGGGT 10 0.006973645 144.0 7 GAGAGTT 10 0.006973645 144.0 9 CTACCAT 15 1.1730364E-4 144.0 5 CATGAAC 20 3.687869E-4 108.0 9 GCTACCA 20 3.687869E-4 108.0 4 TACCATG 20 3.687869E-4 108.0 6 >>END_MODULE Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398078 READS because READLEN < 1 Read 398078 spots for SRR8635270.sra Written 398078 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra Rejected 398074 READS because READLEN < 1 Read 398074 spots for SRR8635270.sra Written 398074 spots for SRR8635270.sra SRR ids: ['SRR8635270.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xifob9wq SRR8635270.sra spots: 7961484 blocks: [[1, 398074], [398075, 796148], [796149, 1194222], [1194223, 1592296], [1592297, 1990370], [1990371, 2388444], [2388445, 2786518], [2786519, 3184592], [3184593, 3582666], [3582667, 3980740], [3980741, 4378814], [4378815, 4776888], [4776889, 5174962], [5174963, 5573036], [5573037, 5971110], [5971111, 6369184], [6369185, 6767258], [6767259, 7165332], [7165333, 7563406], [7563407, 7961484]] SRR8635270 file size 2664617 SRR8635270 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635270 SRR8635270_1.fastq Input file: SRR8635270_1.fastq trimmed: SRR8635270-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:12:24 2024 >> started Mon Dec 9 12:12:39 2024 >> done (14.548s) 7961484 reads processed; of these: 168 ( 0.00%) short reads filtered out after trimming by size control 59 ( 0.00%) empty reads filtered out after trimming by size control 7961257 (100.00%) reads available; of these: 1077375 (13.53%) trimmed reads available after processing 6883882 (86.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 76 0.00% 19 163 0.00% 20 180 0.00% 21 191 0.00% 22 255 0.00% 23 272 0.00% 24 278 0.00% 25 295 0.00% 26 251 0.00% 27 280 0.00% 28 300 0.00% 29 310 0.00% 30 314 0.00% 31 314 0.00% 32 357 0.00% 33 333 0.00% 34 325 0.00% 35 335 0.00% 36 352 0.00% 37 385 0.00% 38 402 0.01% 39 431 0.01% 40 405 0.01% 41 410 0.01% 42 442 0.01% 43 423 0.01% 44 430 0.01% 45 465 0.01% 46 457 0.01% 47 573 0.01% 48 603 0.01% 49 614 0.01% 50 673 0.01% 51 776 0.01% 52 797 0.01% 53 991 0.01% 54 1237 0.02% 55 1198 0.02% 56 1249 0.02% 57 1363 0.02% 58 1551 0.02% 59 1629 0.02% 60 1752 0.02% 61 1801 0.02% 62 1844 0.02% 63 2003 0.03% 64 2050 0.03% 65 2201 0.03% 66 2289 0.03% 67 2500 0.03% 68 2627 0.03% 69 2849 0.04% 70 3350 0.04% 71 3563 0.04% 72 3754 0.05% 73 3966 0.05% 74 4429 0.06% 75 4602 0.06% 76 4676 0.06% 77 4993 0.06% 78 5422 0.07% 79 5882 0.07% 80 6645 0.08% 81 7151 0.09% 82 7504 0.09% 83 7836 0.10% 84 8315 0.10% 85 8992 0.11% 86 9029 0.11% 87 9470 0.12% 88 9757 0.12% 89 10517 0.13% 90 11076 0.14% 91 11121 0.14% 92 11519 0.14% 93 11871 0.15% 94 12507 0.16% 95 13396 0.17% 96 13589 0.17% 97 13752 0.17% 98 14044 0.18% 99 14478 0.18% 100 15105 0.19% 101 15235 0.19% 102 16110 0.20% 103 16668 0.21% 104 16914 0.21% 105 17255 0.22% 106 17343 0.22% 107 17860 0.22% 108 18463 0.23% 109 19359 0.24% 110 19728 0.25% 111 20325 0.26% 112 20925 0.26% 113 21558 0.27% 114 21691 0.27% 115 22973 0.29% 116 23836 0.30% 117 24284 0.31% 118 15262 0.19% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 1 0.00% 124 0 0.00% 125 1 0.00% 126 1 0.00% 127 1 0.00% 128 3 0.00% 129 2 0.00% 130 4 0.00% 131 4 0.00% 132 13 0.00% 133 19 0.00% 134 29 0.00% 135 43 0.00% 136 58 0.00% 137 86 0.00% 138 143 0.00% 139 237 0.00% 140 438 0.01% 141 719 0.01% 142 1127 0.01% 143 2160 0.03% 144 4051 0.05% 145 7655 0.10% 146 15197 0.19% 147 34258 0.43% 148 91407 1.15% 149 257017 3.23% 150 6883882 86.47% 7961257 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=8.18 fanout-score-rank=24 prefix-density=0.49 prefix-fanout=4.5 sequence=TTGTAATATTTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=181.90 fanout-score-rank=1 prefix-density=1.57 prefix-fanout=6.6 sequence=CTGCTGCTGGATGTATCTCTGATTAATGAGTTGCTGCTCTTTAGAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAATACTTTAAGCACCTAATTC Started job on | Dec 09 12:13:52 Started mapping on | Dec 09 12:13:56 Finished on | Dec 09 12:14:35 Mapping speed, Million of reads per hour | 734.89 Number of input reads | 7961257 Average input read length | 145 UNIQUE READS: Uniquely mapped reads number | 6231386 Uniquely mapped reads % | 78.27% Average mapped length | 135.47 Number of splices: Total | 375260 Number of splices: Annotated (sjdb) | 256221 Number of splices: GT/AG | 303531 Number of splices: GC/AG | 7114 Number of splices: AT/AC | 261 Number of splices: Non-canonical | 64354 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.00% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 545418 % of reads mapped to multiple loci | 6.85% Number of reads mapped to too many loci | 205183 % of reads mapped to too many loci | 2.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.83% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1184453 1184453 1184453 N_multimapping 545418 545418 545418 N_noFeature 337204 410801 6000475 N_ambiguous 179009 24145 709 UnstrandedReadsAssigned:5715173 PositiveStrandReadsAssigned:5796440 NegativeStrandReadsAssigned:230202 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8635270 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635270-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,961,257 reads, 6,490,852 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52973 SRR8635270.ke.tsv 35125 SRR8635270.se.tsv 88098 total ==> SRR8635270.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 121 18.2702 PNS24243 293 194 0 0 KQK14069 1603 1504 5333.59 734.657 KQK14071 474 375 5.10619 2.82084 ==> SRR8635270.se.tsv <== BRADI_1g14170v3 4269 BRADI_1g53295v3 36 BRADI_1g59795v3 117 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 89 BRADI_1g74790v3 137 BRADI_1g09890v3 0 BRADI_1g77505v3 167 BRADI_1g48960v3 0 SRR8635270 completed mapping pipeline successfully