Starting /dee2/code/volunteer_pipeline.sh SRR8635271 current disk space = 1526089175040 free memory = 1341330716 SRR8635271 SRAfilesize c33b29b0cbd7764e426f808827632d80 SRR8635271.sra SRR8635271.sra file validated SRR8635271 is single end SRR8635271 is conventional basespace SRR8635271 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635271_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 40 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6925 32.0 32.0 32.0 27.0 32.0 2 30.9575 32.0 32.0 32.0 27.0 32.0 3 32.6825 32.0 32.0 37.0 32.0 37.0 4 33.94625 37.0 32.0 37.0 27.0 37.0 5 35.11875 37.0 37.0 37.0 27.0 37.0 6 37.466 41.0 37.0 41.0 32.0 41.0 7 38.263 41.0 37.0 41.0 32.0 41.0 8 38.277 41.0 37.0 41.0 32.0 41.0 9 38.35775 41.0 37.0 41.0 32.0 41.0 10-14 38.77155 41.0 37.8 41.0 34.0 41.0 15-19 38.41315 41.0 38.6 41.0 33.0 41.0 20-24 37.8784 41.0 37.0 41.0 31.0 41.0 25-29 37.980549999999994 41.0 37.0 41.0 32.0 41.0 30-34 37.39020000000001 41.0 37.0 41.0 28.0 41.0 35-39 37.7899 41.0 37.0 41.0 31.0 41.0 40-44 37.3854 41.0 37.0 41.0 29.0 41.0 45-49 37.84965 41.0 37.0 41.0 31.0 41.0 50-54 35.1927 39.4 32.0 41.0 21.0 41.0 55-59 35.86705 38.6 34.0 41.0 24.0 41.0 60-64 34.49995 38.6 33.0 41.0 22.0 41.0 65-69 34.452299999999994 37.0 31.0 41.0 20.0 41.0 70-74 35.5569 37.8 35.0 41.0 25.0 41.0 75-79 33.98389999999999 36.0 31.0 40.2 20.0 41.0 80-84 35.003249999999994 37.0 32.0 41.0 20.0 41.0 85-89 34.96315 37.0 31.0 41.0 20.0 41.0 90-94 33.86305 37.0 31.0 41.0 20.0 41.0 95-99 31.21825 35.0 26.0 41.0 12.0 41.0 100-104 30.758699999999997 33.0 25.0 39.4 12.0 41.0 105-109 29.6937 32.0 22.0 37.0 12.0 41.0 110-114 27.67355 29.0 20.0 37.0 12.0 41.0 115-119 25.795650000000002 26.0 16.0 35.0 12.0 40.2 120-124 19.3534 16.0 12.0 26.0 10.4 32.0 125-129 17.73225 14.0 12.0 23.0 8.8 30.0 130-134 18.7857 16.0 12.0 23.0 10.4 31.0 135-139 16.5978 12.0 12.0 22.0 8.8 29.0 140-144 13.95395 12.0 12.0 14.0 8.0 22.0 145-149 14.201249999999998 12.0 12.0 16.0 8.0 22.0 150 13.38875 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 7.0 20 16.0 21 31.0 22 47.0 23 61.0 24 90.0 25 138.0 26 171.0 27 206.0 28 233.0 29 331.0 30 419.0 31 449.0 32 505.0 33 548.0 34 430.0 35 236.0 36 60.0 37 19.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.05 15.375 30.8 12.775 2 43.425000000000004 16.1 27.125 13.350000000000001 3 41.275 16.725 28.925 13.075000000000001 4 42.425000000000004 17.125 27.975 12.475 5 36.55 18.075 28.549999999999997 16.825000000000003 6 39.324999999999996 16.25 29.25 15.174999999999999 7 40.35 16.225 27.650000000000002 15.775 8 37.05 15.125 31.0 16.825000000000003 9 33.825 16.825000000000003 31.65 17.7 10-14 29.205 21.745 32.625 16.425 15-19 25.074999999999996 24.495 31.52 18.91 20-24 24.795 24.79 30.814999999999998 19.6 25-29 24.765 25.180000000000003 30.904999999999998 19.15 30-34 24.52 24.895 31.275 19.31 35-39 24.115000000000002 25.645 31.069999999999997 19.17 40-44 23.43 26.200000000000003 31.635 18.735 45-49 22.725 26.939999999999998 31.345 18.990000000000002 50-54 22.71 27.35 31.005 18.935 55-59 21.64 29.110000000000003 31.185000000000002 18.065 60-64 22.79 28.860000000000003 30.245 18.105 65-69 21.66 30.18 29.825000000000003 18.335 70-74 20.979999999999997 31.014999999999997 29.945 18.060000000000002 75-79 20.3 32.98 29.14 17.580000000000002 80-84 19.939999999999998 34.55 28.215 17.294999999999998 85-89 19.855 35.120000000000005 28.09 16.935 90-94 19.905 36.185 27.560000000000002 16.35 95-99 19.509999999999998 38.005 26.179999999999996 16.305 100-104 18.86 38.515 25.155 17.47 105-109 18.695 39.2 24.9 17.205000000000002 110-114 18.41 39.92 24.335 17.335 115-119 19.195 38.379999999999995 24.325 18.099999999999998 120-124 20.7 37.555 24.12 17.625 125-129 20.03 37.84 23.535 18.595 130-134 19.465 39.57 22.55 18.415 135-139 19.61 37.89 23.595 18.905 140-144 21.145 36.905 25.11 16.84 145-149 20.945 35.455 25.235000000000003 18.365000000000002 150 22.725 36.8 25.025 15.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.5 5 3.0 6 5.5 7 7.0 8 8.5 9 6.5 10 5.5 11 6.5 12 5.5 13 5.5 14 9.0 15 9.5 16 9.0 17 12.0 18 15.5 19 15.0 20 11.0 21 12.5 22 17.0 23 12.0 24 10.5 25 13.5 26 16.5 27 24.5 28 30.5 29 37.0 30 48.5 31 59.5 32 74.0 33 98.5 34 120.5 35 125.0 36 131.5 37 143.0 38 154.0 39 166.0 40 188.0 41 211.5 42 206.5 43 186.0 44 189.5 45 201.0 46 170.0 47 136.0 48 123.0 49 109.0 50 94.5 51 81.5 52 82.5 53 75.0 54 71.5 55 72.5 56 53.0 57 42.0 58 32.0 59 24.5 60 25.5 61 24.5 62 23.0 63 25.5 64 21.0 65 14.0 66 9.5 67 7.5 68 7.5 69 10.5 70 13.0 71 11.5 72 8.0 73 7.0 74 6.0 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.87519915029209 89.325 2 4.726500265533723 8.9 3 0.3186404673393521 0.8999999999999999 4 0.02655337227827934 0.1 5 0.02655337227827934 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02655337227827934 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 26 0.65 No Hit AAGGCTAGCTGCACAAGCTAGGCCCTTATTTCCCTTTGTACGGGTGCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.1875 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.2625 0.0 0.0 0.0 0.0 58-59 0.3 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.35 0.0 0.0 0.0 0.0 64-65 0.3625 0.0 0.0 0.0 0.0 66-67 0.4 0.0 0.0 0.0 0.0 68-69 0.5 0.0 0.0 0.0 0.0 70-71 0.5874999999999999 0.0 0.0 0.0 0.0 72-73 0.675 0.0 0.0 0.0 0.0 74-75 0.7375 0.0 0.0 0.0 0.0 76-77 0.8125 0.0 0.0 0.0 0.0 78-79 0.925 0.0 0.0 0.0 0.0 80-81 1.075 0.0 0.0 0.0 0.0 82-83 1.25 0.0 0.0 0.0 0.0 84-85 1.5 0.0 0.0 0.0 0.0 86-87 1.725 0.0 0.0 0.0 0.0 88-89 1.9 0.0 0.0 0.0 0.0 90-91 2.2625 0.0 0.0 0.0 0.0 92-93 2.425 0.0 0.0 0.0 0.0 94-95 2.7625 0.0 0.0 0.0 0.0 96-97 3.0 0.0 0.0 0.0 0.0 98-99 3.325 0.0 0.0 0.0 0.0 100-101 3.5875 0.0 0.0 0.0 0.0 102-103 3.9625 0.0 0.0 0.0 0.0 104-105 4.4 0.0 0.0 0.0 0.0 106-107 4.762499999999999 0.0 0.0 0.0 0.0 108-109 5.2 0.0 0.0 0.0 0.0 110-111 5.425 0.0 0.0 0.0 0.0 112-113 5.612500000000001 0.0 0.0 0.0 0.0 114-115 5.7625 0.0 0.0 0.0 0.0 116-117 5.8875 0.0 0.0 0.0 0.0 118-119 5.975 0.0 0.0 0.0 0.0 120-121 6.1375 0.0 0.0 0.0 0.0 122-123 6.3125 0.0 0.0 0.0 0.0 124-125 6.387499999999999 0.0 0.0 0.0 0.0 126-127 6.4875 0.0 0.0 0.0 0.0 128-129 6.525 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 6.65 0.0 0.0 0.0 0.0 134-135 6.7 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGAAT 10 0.006973645 144.0 6 GAGGTTG 10 0.006973645 144.0 2 >>END_MODULE Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282823 READS because READLEN < 1 Read 282823 spots for SRR8635271.sra Written 282823 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra Rejected 282820 READS because READLEN < 1 Read 282820 spots for SRR8635271.sra Written 282820 spots for SRR8635271.sra SRR ids: ['SRR8635271.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wczo0pio SRR8635271.sra spots: 5656403 blocks: [[1, 282820], [282821, 565640], [565641, 848460], [848461, 1131280], [1131281, 1414100], [1414101, 1696920], [1696921, 1979740], [1979741, 2262560], [2262561, 2545380], [2545381, 2828200], [2828201, 3111020], [3111021, 3393840], [3393841, 3676660], [3676661, 3959480], [3959481, 4242300], [4242301, 4525120], [4525121, 4807940], [4807941, 5090760], [5090761, 5373580], [5373581, 5656403]] SRR8635271 file size 1892504 SRR8635271 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635271 SRR8635271_1.fastq Input file: SRR8635271_1.fastq trimmed: SRR8635271-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:13:33 2024 >> started Mon Dec 9 12:13:51 2024 >> done (17.976s) 5656403 reads processed; of these: 174 ( 0.00%) short reads filtered out after trimming by size control 47 ( 0.00%) empty reads filtered out after trimming by size control 5656182 (100.00%) reads available; of these: 978691 (17.30%) trimmed reads available after processing 4677491 (82.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 84 0.00% 19 185 0.00% 20 185 0.00% 21 208 0.00% 22 284 0.01% 23 320 0.01% 24 368 0.01% 25 328 0.01% 26 291 0.01% 27 340 0.01% 28 343 0.01% 29 364 0.01% 30 358 0.01% 31 363 0.01% 32 362 0.01% 33 405 0.01% 34 382 0.01% 35 354 0.01% 36 380 0.01% 37 411 0.01% 38 378 0.01% 39 448 0.01% 40 418 0.01% 41 423 0.01% 42 454 0.01% 43 481 0.01% 44 516 0.01% 45 559 0.01% 46 531 0.01% 47 612 0.01% 48 719 0.01% 49 752 0.01% 50 806 0.01% 51 889 0.02% 52 963 0.02% 53 1086 0.02% 54 1367 0.02% 55 1475 0.03% 56 1475 0.03% 57 1726 0.03% 58 1810 0.03% 59 1875 0.03% 60 2035 0.04% 61 2230 0.04% 62 2281 0.04% 63 2379 0.04% 64 2371 0.04% 65 2463 0.04% 66 2625 0.05% 67 2833 0.05% 68 2996 0.05% 69 3316 0.06% 70 3577 0.06% 71 4057 0.07% 72 4195 0.07% 73 4604 0.08% 74 4935 0.09% 75 5168 0.09% 76 5399 0.10% 77 5721 0.10% 78 6076 0.11% 79 6641 0.12% 80 7387 0.13% 81 7965 0.14% 82 8294 0.15% 83 8919 0.16% 84 9280 0.16% 85 9678 0.17% 86 10028 0.18% 87 10481 0.19% 88 10845 0.19% 89 11429 0.20% 90 11507 0.20% 91 11880 0.21% 92 12262 0.22% 93 12304 0.22% 94 12901 0.23% 95 13607 0.24% 96 13722 0.24% 97 14114 0.25% 98 14181 0.25% 99 14258 0.25% 100 15143 0.27% 101 15427 0.27% 102 15845 0.28% 103 16275 0.29% 104 16566 0.29% 105 16659 0.29% 106 16822 0.30% 107 17168 0.30% 108 17660 0.31% 109 18198 0.32% 110 18672 0.33% 111 18772 0.33% 112 19056 0.34% 113 19426 0.34% 114 19565 0.35% 115 20923 0.37% 116 21620 0.38% 117 21669 0.38% 118 13629 0.24% 119 1 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 0 0.00% 130 1 0.00% 131 5 0.00% 132 6 0.00% 133 10 0.00% 134 12 0.00% 135 27 0.00% 136 47 0.00% 137 75 0.00% 138 93 0.00% 139 177 0.00% 140 321 0.01% 141 556 0.01% 142 891 0.02% 143 1678 0.03% 144 3292 0.06% 145 6105 0.11% 146 11811 0.21% 147 26602 0.47% 148 68763 1.22% 149 192101 3.40% 150 4677491 82.70% 5656182 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=7.51 fanout-score-rank=26 prefix-density=0.51 prefix-fanout=4.4 sequence=TTGTAATATTTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=199.16 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=19.9 sequence=TGTTGTTGTGTATCGATGTGTGTTTGTTTGAATGTTCCTGTTTTCCGTTAAATTTGGCTCTCCTTTTTGAAGGAGACACGTCATGTGCTACACATCTCTTGATATTTATCTACCACATGTTTGAAATATTGATTGTGCC Started job on | Dec 09 12:16:31 Started mapping on | Dec 09 12:16:31 Finished on | Dec 09 12:18:49 Mapping speed, Million of reads per hour | 147.55 Number of input reads | 5656182 Average input read length | 143 UNIQUE READS: Uniquely mapped reads number | 4035755 Uniquely mapped reads % | 71.35% Average mapped length | 131.61 Number of splices: Total | 243062 Number of splices: Annotated (sjdb) | 156605 Number of splices: GT/AG | 186933 Number of splices: GC/AG | 4994 Number of splices: AT/AC | 195 Number of splices: Non-canonical | 50940 Mismatch rate per base, % | 0.64% Deletion rate per base | 0.01% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 429716 % of reads mapped to multiple loci | 7.60% Number of reads mapped to too many loci | 226553 % of reads mapped to too many loci | 4.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.42% % of reads unmapped: other | 0.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1190711 1190711 1190711 N_multimapping 429716 429716 429716 N_noFeature 246723 293999 3885341 N_ambiguous 118784 17814 483 UnstrandedReadsAssigned:3670248 PositiveStrandReadsAssigned:3723942 NegativeStrandReadsAssigned:149931 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8635271 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635271-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,656,182 reads, 4,289,924 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52973 SRR8635271.ke.tsv 35125 SRR8635271.se.tsv 88098 total ==> SRR8635271.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 54 12.4826 PNS24243 293 194 0 0 KQK14069 1603 1504 3214.27 677.798 KQK14071 474 375 1.02799 0.869409 ==> SRR8635271.se.tsv <== BRADI_1g14170v3 2339 BRADI_1g53295v3 21 BRADI_1g59795v3 76 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 42 BRADI_1g74790v3 70 BRADI_1g09890v3 1 BRADI_1g77505v3 100 BRADI_1g48960v3 0 SRR8635271 completed mapping pipeline successfully