Starting /dee2/code/volunteer_pipeline.sh SRR8635272 current disk space = 1525887164416 free memory = 1548031780 SRR8635272 SRAfilesize ee701f31f655789fc6d3422a9e5dd841 SRR8635272.sra SRR8635272.sra file validated SRR8635272 is single end SRR8635272 is conventional basespace SRR8635272 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635272_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.47875 32.0 32.0 32.0 27.0 32.0 2 31.1675 32.0 32.0 32.0 32.0 32.0 3 32.2275 32.0 32.0 37.0 22.0 37.0 4 33.83375 37.0 32.0 37.0 27.0 37.0 5 34.19375 37.0 32.0 37.0 27.0 37.0 6 36.8305 41.0 37.0 41.0 27.0 41.0 7 38.00375 41.0 37.0 41.0 32.0 41.0 8 38.16175 41.0 37.0 41.0 32.0 41.0 9 38.32975 41.0 37.0 41.0 32.0 41.0 10-14 38.6582 41.0 37.0 41.0 34.0 41.0 15-19 38.231399999999994 41.0 37.0 41.0 32.0 41.0 20-24 37.48345 41.0 37.0 41.0 30.0 41.0 25-29 37.3888 41.0 37.0 41.0 27.0 41.0 30-34 36.653200000000005 41.0 36.0 41.0 26.0 41.0 35-39 37.08919999999999 41.0 37.0 41.0 28.0 41.0 40-44 36.374950000000005 40.2 36.0 41.0 25.0 41.0 45-49 36.499900000000004 41.0 36.0 41.0 26.0 41.0 50-54 33.7033 38.4 29.0 40.2 20.0 41.0 55-59 34.3626 37.0 32.0 41.0 22.0 41.0 60-64 33.062850000000005 37.0 28.0 41.0 18.0 41.0 65-69 32.992000000000004 37.0 29.0 41.0 18.0 41.0 70-74 34.40840000000001 37.0 32.0 41.0 22.0 41.0 75-79 32.61495 36.0 29.0 39.4 18.0 41.0 80-84 34.1786 37.0 31.0 41.0 20.0 41.0 85-89 34.587950000000006 37.0 31.0 41.0 20.0 41.0 90-94 33.6012 37.0 31.0 41.0 20.0 41.0 95-99 31.060449999999996 32.0 25.0 40.2 12.0 41.0 100-104 30.827549999999995 32.0 27.0 38.6 12.0 41.0 105-109 30.278699999999997 32.0 25.0 37.0 12.0 41.0 110-114 28.5459 30.0 20.0 37.0 12.0 41.0 115-119 26.736399999999996 26.0 19.0 35.0 11.2 40.2 120-124 19.50895 18.0 12.0 26.0 10.4 31.0 125-129 18.15625 14.0 12.0 23.0 8.8 31.0 130-134 19.53545 18.0 12.0 24.0 11.2 32.0 135-139 17.287950000000002 12.0 12.0 23.0 8.8 29.0 140-144 14.014199999999999 12.0 12.0 16.0 8.0 23.0 145-149 14.3487 12.0 12.0 16.0 8.0 23.0 150 13.2975 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 7.0 19 9.0 20 15.0 21 40.0 22 57.0 23 71.0 24 128.0 25 150.0 26 165.0 27 252.0 28 300.0 29 324.0 30 381.0 31 448.0 32 522.0 33 480.0 34 406.0 35 173.0 36 67.0 37 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.7 14.674999999999999 28.799999999999997 12.825000000000001 2 42.625 14.75 26.900000000000002 15.725 3 43.025000000000006 16.225 27.500000000000004 13.25 4 43.925 14.924999999999999 26.525 14.625 5 38.375 16.625 28.125 16.875 6 41.125 15.15 28.449999999999996 15.275 7 40.550000000000004 15.425 28.1 15.925 8 37.4 16.2 29.175 17.224999999999998 9 34.925 15.925 30.375000000000004 18.775 10-14 29.945 20.91 31.19 17.955 15-19 25.740000000000002 24.355 30.18 19.725 20-24 26.669999999999998 23.5 29.29 20.54 25-29 25.374999999999996 23.535 30.205 20.885 30-34 25.055 23.43 30.955 20.560000000000002 35-39 24.685000000000002 23.830000000000002 31.075000000000003 20.41 40-44 24.775 23.87 30.919999999999998 20.435 45-49 24.245 24.18 30.85 20.724999999999998 50-54 24.64 23.525 30.955 20.880000000000003 55-59 23.69 24.86 31.125000000000004 20.325 60-64 23.82 24.85 31.430000000000003 19.900000000000002 65-69 24.349999999999998 25.35 30.495 19.805 70-74 23.435 25.795 31.04 19.73 75-79 22.58 26.265 31.45 19.705000000000002 80-84 22.93 26.63 30.599999999999998 19.84 85-89 22.770000000000003 27.27 30.505 19.455 90-94 22.57 28.02 30.54 18.87 95-99 22.189999999999998 28.705000000000002 30.049999999999997 19.055 100-104 21.959999999999997 28.675 30.005 19.36 105-109 21.959999999999997 29.744999999999997 29.525000000000002 18.77 110-114 22.46 29.580000000000002 29.215000000000003 18.745 115-119 22.509999999999998 30.14 28.499999999999996 18.85 120-124 24.375 30.345 27.295 17.985 125-129 23.655 30.795 26.68 18.87 130-134 22.38 32.92 26.650000000000002 18.05 135-139 22.79 31.995 27.095000000000002 18.12 140-144 24.295 33.615 25.974999999999998 16.115 145-149 22.955000000000002 33.46 25.814999999999998 17.77 150 24.55 34.825 25.2 15.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.5 7 0.5 8 1.5 9 2.5 10 2.0 11 2.5 12 3.5 13 2.5 14 2.5 15 4.5 16 3.0 17 3.0 18 4.5 19 3.5 20 2.5 21 5.0 22 7.0 23 6.5 24 7.0 25 8.5 26 9.0 27 9.5 28 13.0 29 20.0 30 22.0 31 26.0 32 41.5 33 52.0 34 60.0 35 75.0 36 99.0 37 118.0 38 129.5 39 152.0 40 174.5 41 201.0 42 225.0 43 214.0 44 195.5 45 201.0 46 189.0 47 175.0 48 167.5 49 151.0 50 130.5 51 113.5 52 109.0 53 98.5 54 93.5 55 88.0 56 71.5 57 61.0 58 51.5 59 41.0 60 36.0 61 28.0 62 22.5 63 24.0 64 29.5 65 30.5 66 32.0 67 26.5 68 23.5 69 24.5 70 16.0 71 13.5 72 11.0 73 8.0 74 6.5 75 4.0 76 2.5 77 1.5 78 2.0 79 1.5 80 0.5 81 1.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.35127860026918 86.7 2 6.110363391655451 11.35 3 0.4037685060565276 1.125 4 0.08075370121130553 0.3 5 0.0 0.0 6 0.0 0.0 7 0.026917900403768503 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.026917900403768503 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 14 0.35000000000000003 No Hit ATGTCTGTCACGTACGTGGTCGTGCAAAAAACCCTGAAAGTTTAATTGGC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6375 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.725 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 0.95 0.0 0.0 0.0 0.0 132-133 0.9624999999999999 0.0 0.0 0.0 0.0 134-135 0.9875 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCAGAA 10 0.006973645 144.0 2 GCCCAGA 10 0.006973645 144.0 1 CCAGAAG 10 0.006973645 144.0 3 GCTGCAC 10 0.006973645 144.0 8 AAGGCTA 10 0.006973645 144.0 1 AGGCTAG 10 0.006973645 144.0 2 GGCTAGC 10 0.006973645 144.0 3 AAGTGCT 10 0.006973645 144.0 7 CAGAAGT 10 0.006973645 144.0 4 >>END_MODULE Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293909 READS because READLEN < 1 Read 293909 spots for SRR8635272.sra Written 293909 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra Rejected 293904 READS because READLEN < 1 Read 293904 spots for SRR8635272.sra Written 293904 spots for SRR8635272.sra SRR ids: ['SRR8635272.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xb3ju07o SRR8635272.sra spots: 5878085 blocks: [[1, 293904], [293905, 587808], [587809, 881712], [881713, 1175616], [1175617, 1469520], [1469521, 1763424], [1763425, 2057328], [2057329, 2351232], [2351233, 2645136], [2645137, 2939040], [2939041, 3232944], [3232945, 3526848], [3526849, 3820752], [3820753, 4114656], [4114657, 4408560], [4408561, 4702464], [4702465, 4996368], [4996369, 5290272], [5290273, 5584176], [5584177, 5878085]] SRR8635272 file size 1966759 SRR8635272 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635272 SRR8635272_1.fastq Input file: SRR8635272_1.fastq trimmed: SRR8635272-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:19:25 2024 >> started Mon Dec 9 12:19:30 2024 >> done (4.580s) 5878085 reads processed; of these: 24 ( 0.00%) short reads filtered out after trimming by size control 1 ( 0.00%) empty reads filtered out after trimming by size control 5878060 (100.00%) reads available; of these: 309295 ( 5.26%) trimmed reads available after processing 5568765 (94.74%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 36 0.00% 20 34 0.00% 21 37 0.00% 22 48 0.00% 23 39 0.00% 24 40 0.00% 25 47 0.00% 26 33 0.00% 27 30 0.00% 28 38 0.00% 29 38 0.00% 30 42 0.00% 31 46 0.00% 32 46 0.00% 33 38 0.00% 34 34 0.00% 35 48 0.00% 36 31 0.00% 37 47 0.00% 38 65 0.00% 39 52 0.00% 40 44 0.00% 41 52 0.00% 42 55 0.00% 43 65 0.00% 44 55 0.00% 45 74 0.00% 46 87 0.00% 47 95 0.00% 48 100 0.00% 49 90 0.00% 50 100 0.00% 51 129 0.00% 52 147 0.00% 53 177 0.00% 54 214 0.00% 55 209 0.00% 56 271 0.00% 57 267 0.00% 58 269 0.00% 59 268 0.00% 60 330 0.01% 61 357 0.01% 62 383 0.01% 63 385 0.01% 64 400 0.01% 65 402 0.01% 66 446 0.01% 67 449 0.01% 68 507 0.01% 69 527 0.01% 70 603 0.01% 71 655 0.01% 72 659 0.01% 73 728 0.01% 74 790 0.01% 75 816 0.01% 76 883 0.02% 77 906 0.02% 78 929 0.02% 79 1097 0.02% 80 1152 0.02% 81 1266 0.02% 82 1305 0.02% 83 1300 0.02% 84 1402 0.02% 85 1451 0.02% 86 1511 0.03% 87 1570 0.03% 88 1658 0.03% 89 1799 0.03% 90 1763 0.03% 91 1805 0.03% 92 1958 0.03% 93 1935 0.03% 94 2095 0.04% 95 2180 0.04% 96 2217 0.04% 97 2265 0.04% 98 2282 0.04% 99 2344 0.04% 100 2487 0.04% 101 2553 0.04% 102 2587 0.04% 103 2794 0.05% 104 2849 0.05% 105 2775 0.05% 106 2939 0.05% 107 3117 0.05% 108 3177 0.05% 109 3341 0.06% 110 3626 0.06% 111 3695 0.06% 112 3733 0.06% 113 3923 0.07% 114 4037 0.07% 115 4269 0.07% 116 4384 0.07% 117 4697 0.08% 118 2902 0.05% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 1 0.00% 130 0 0.00% 131 0 0.00% 132 3 0.00% 133 5 0.00% 134 8 0.00% 135 2 0.00% 136 17 0.00% 137 16 0.00% 138 23 0.00% 139 42 0.00% 140 80 0.00% 141 169 0.00% 142 265 0.00% 143 534 0.01% 144 963 0.02% 145 1990 0.03% 146 4472 0.08% 147 11369 0.19% 148 36820 0.63% 149 137455 2.34% 150 5568765 94.74% 5878060 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=6.20 fanout-score-rank=28 prefix-density=1.11 prefix-fanout=1.8 sequence=TTATTTCCCTTCGGTTATTCTGTGAAGCAGCCAGCCAGGCTATTGTTGCTCTGAATAAGTCTAATAGCTCTAGGTGGTCAGCTGCGTCTACCACAATGAGCATATGTCTGAAGAAAAGTTGTCAAAAACCGCAATAAATAAGCATTATTGTCCTTCTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=111.85 fanout-score-rank=1 prefix-density=1.62 prefix-fanout=8.0 sequence=CTGCTGCTGGATGTATCTCTGATTAATGAGTTGCTGCTCTTTAGAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAATAC Started job on | Dec 09 12:21:07 Started mapping on | Dec 09 12:21:08 Finished on | Dec 09 12:21:34 Mapping speed, Million of reads per hour | 813.89 Number of input reads | 5878060 Average input read length | 144 UNIQUE READS: Uniquely mapped reads number | 4928275 Uniquely mapped reads % | 83.84% Average mapped length | 141.01 Number of splices: Total | 413601 Number of splices: Annotated (sjdb) | 336448 Number of splices: GT/AG | 380743 Number of splices: GC/AG | 6256 Number of splices: AT/AC | 729 Number of splices: Non-canonical | 25873 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 1.52 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417004 % of reads mapped to multiple loci | 7.09% Number of reads mapped to too many loci | 150324 % of reads mapped to too many loci | 2.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.93% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 532781 532781 532781 N_multimapping 417004 417004 417004 N_noFeature 237483 295030 4749818 N_ambiguous 136475 16881 343 UnstrandedReadsAssigned:4554317 PositiveStrandReadsAssigned:4616364 NegativeStrandReadsAssigned:178114 Dataset is classified positive stranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR8635272 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635272-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,878,060 reads, 4,987,305 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52973 SRR8635272.ke.tsv 35125 SRR8635272.se.tsv 88098 total ==> SRR8635272.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 103 20.4424 PNS24243 293 194 0 0 KQK14069 1603 1504 3860.35 698.921 KQK14071 474 375 0 0 ==> SRR8635272.se.tsv <== BRADI_1g14170v3 3574 BRADI_1g53295v3 29 BRADI_1g59795v3 96 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 80 BRADI_1g74790v3 88 BRADI_1g09890v3 0 BRADI_1g77505v3 124 BRADI_1g48960v3 0 SRR8635272 completed mapping pipeline successfully