Starting /dee2/code/volunteer_pipeline.sh SRR8635273 current disk space = 1525887164416 free memory = 1548201128 SRR8635273 SRAfilesize bc59ca2929dafc278d086a32e4583fee SRR8635273.sra SRR8635273.sra file validated SRR8635273 is single end SRR8635273 is conventional basespace SRR8635273 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635273_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.7175 32.0 32.0 32.0 27.0 32.0 2 30.475 32.0 32.0 32.0 27.0 32.0 3 31.4625 32.0 32.0 37.0 22.0 37.0 4 32.81625 37.0 27.0 37.0 22.0 37.0 5 34.71875 37.0 37.0 37.0 27.0 37.0 6 37.202 41.0 37.0 41.0 27.0 41.0 7 37.5105 41.0 37.0 41.0 32.0 41.0 8 37.826 41.0 37.0 41.0 32.0 41.0 9 38.1765 41.0 37.0 41.0 32.0 41.0 10-14 38.702600000000004 41.0 37.0 41.0 34.0 41.0 15-19 38.4654 41.0 38.6 41.0 34.0 41.0 20-24 38.1183 41.0 37.0 41.0 31.0 41.0 25-29 38.35705 41.0 37.0 41.0 32.0 41.0 30-34 37.6532 41.0 37.0 41.0 30.0 41.0 35-39 38.21415 41.0 37.0 41.0 32.0 41.0 40-44 37.71185 41.0 37.0 41.0 30.0 41.0 45-49 37.8986 41.0 37.0 41.0 31.0 41.0 50-54 35.126799999999996 39.4 32.0 41.0 22.0 41.0 55-59 35.85029999999999 38.6 34.0 41.0 25.0 41.0 60-64 34.1128 38.6 32.0 41.0 20.0 41.0 65-69 34.1626 37.0 31.0 41.0 20.0 41.0 70-74 35.2804 37.0 33.0 41.0 23.0 41.0 75-79 33.721 36.0 31.0 40.2 20.0 41.0 80-84 34.99215 37.0 32.0 41.0 21.0 41.0 85-89 35.27525 38.6 31.0 41.0 24.0 41.0 90-94 34.0071 37.0 31.0 41.0 20.0 41.0 95-99 31.1978 35.0 26.0 41.0 12.0 41.0 100-104 30.951600000000003 35.0 26.0 41.0 12.0 41.0 105-109 29.9677 32.0 22.0 37.8 12.0 41.0 110-114 27.93395 30.0 18.0 37.0 12.0 41.0 115-119 25.972699999999996 26.0 16.0 35.0 12.0 40.2 120-124 19.21725 16.0 12.0 26.0 10.4 32.0 125-129 17.54145 14.0 12.0 23.0 8.8 29.0 130-134 18.7869 18.0 12.0 23.0 11.2 31.0 135-139 16.5815 12.0 12.0 22.0 8.0 28.0 140-144 13.839749999999999 12.0 12.0 12.0 8.0 22.0 145-149 14.02225 12.0 12.0 16.0 8.0 22.0 150 13.26075 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 3.0 19 6.0 20 12.0 21 23.0 22 46.0 23 64.0 24 95.0 25 135.0 26 182.0 27 218.0 28 250.0 29 305.0 30 364.0 31 464.0 32 539.0 33 556.0 34 432.0 35 244.0 36 57.0 37 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.275 13.825000000000001 32.725 12.174999999999999 2 41.8 15.725 28.625 13.850000000000001 3 41.625 16.925 28.325 13.125 4 41.949999999999996 16.3 28.599999999999998 13.15 5 39.225 16.375 28.849999999999998 15.55 6 40.675 14.399999999999999 30.775000000000002 14.149999999999999 7 41.5 15.375 29.375 13.750000000000002 8 40.1 14.674999999999999 30.175 15.049999999999999 9 34.475 15.675 31.7 18.15 10-14 29.160000000000004 21.375 33.184999999999995 16.28 15-19 25.44 24.375 31.78 18.404999999999998 20-24 25.72 23.595 31.169999999999998 19.515 25-29 24.709999999999997 23.465 31.669999999999998 20.155 30-34 24.965 23.885 32.145 19.005 35-39 23.855 24.255 32.21 19.68 40-44 24.099999999999998 24.755 32.09 19.055 45-49 23.119999999999997 25.840000000000003 32.045 18.995 50-54 22.88 25.619999999999997 32.26 19.24 55-59 22.66 26.38 32.07 18.89 60-64 23.044999999999998 26.075 32.365 18.515 65-69 22.0 26.724999999999998 32.07 19.205 70-74 22.115000000000002 28.03 31.205 18.65 75-79 21.065 28.599999999999998 30.769999999999996 19.564999999999998 80-84 21.115000000000002 30.620000000000005 30.185000000000002 18.08 85-89 20.64 31.525 29.79 18.045 90-94 20.990000000000002 32.86 29.125 17.025000000000002 95-99 20.549999999999997 34.4 27.834999999999997 17.215 100-104 19.985 35.644999999999996 26.669999999999998 17.7 105-109 20.015 36.449999999999996 26.619999999999997 16.915 110-114 19.72 36.735 25.995 17.549999999999997 115-119 20.4 35.885 25.41 18.305 120-124 21.7 34.98 26.06 17.26 125-129 21.565 34.644999999999996 25.319999999999997 18.47 130-134 19.900000000000002 37.515 24.13 18.455 135-139 21.14 35.47 24.63 18.759999999999998 140-144 23.244999999999997 34.54 25.319999999999997 16.895 145-149 21.65 34.235 25.47 18.645 150 22.775000000000002 36.8 24.675 15.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.5 7 1.5 8 2.5 9 2.5 10 2.5 11 2.0 12 0.5 13 0.5 14 3.0 15 5.0 16 5.0 17 6.5 18 7.0 19 5.0 20 5.5 21 6.5 22 6.5 23 8.5 24 9.5 25 12.0 26 15.5 27 21.5 28 26.5 29 31.5 30 40.5 31 46.0 32 56.5 33 76.0 34 100.0 35 111.0 36 126.0 37 156.0 38 185.5 39 201.5 40 205.0 41 216.0 42 229.5 43 221.5 44 202.5 45 181.0 46 173.0 47 171.0 48 146.0 49 116.5 50 106.0 51 88.0 52 67.5 53 67.5 54 74.5 55 68.0 56 54.5 57 45.5 58 30.0 59 26.0 60 31.5 61 32.5 62 20.0 63 15.0 64 15.0 65 12.5 66 16.5 67 16.0 68 9.5 69 6.0 70 10.5 71 10.5 72 5.5 73 4.0 74 1.5 75 2.5 76 5.5 77 5.0 78 2.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.2 #Duplication Level Percentage of deduplicated Percentage of total 1 94.20600858369099 87.8 2 5.23068669527897 9.75 3 0.4560085836909871 1.275 4 0.0536480686695279 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02682403433476395 0.22499999999999998 >10 0.02682403433476395 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 30 0.75 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.07500000000000001 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.2625 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.325 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.3875 0.0 0.0 0.0 0.0 74-75 0.48750000000000004 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.6875 0.0 0.0 0.0 0.0 80-81 0.8374999999999999 0.0 0.0 0.0 0.0 82-83 0.9874999999999999 0.0 0.0 0.0 0.0 84-85 1.175 0.0 0.0 0.0 0.0 86-87 1.2875 0.0 0.0 0.0 0.0 88-89 1.4125 0.0 0.0 0.0 0.0 90-91 1.6 0.0 0.0 0.0 0.0 92-93 1.85 0.0 0.0 0.0 0.0 94-95 2.0875 0.0 0.0 0.0 0.0 96-97 2.3 0.0 0.0 0.0 0.0 98-99 2.5375 0.0 0.0 0.0 0.0 100-101 3.025 0.0 0.0 0.0 0.0 102-103 3.4125 0.0 0.0 0.0 0.0 104-105 3.7625 0.0 0.0 0.0 0.0 106-107 4.075 0.0 0.0 0.0 0.0 108-109 4.2875 0.0 0.0 0.0 0.0 110-111 4.5375 0.0 0.0 0.0 0.0 112-113 4.7625 0.0 0.0 0.0 0.0 114-115 4.9375 0.0 0.0 0.0 0.0 116-117 5.05 0.0 0.0 0.0 0.0 118-119 5.05 0.0 0.0 0.0 0.0 120-121 5.074999999999999 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.25 0.0 0.0 0.0 0.0 126-127 5.2875 0.0 0.0 0.0 0.0 128-129 5.3125 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.3875 0.0 0.0 0.0 0.0 136-137 5.4 0.0 0.0 0.0 0.0 138 5.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTGT 10 0.006973645 144.0 6 GTTGGTG 10 0.006973645 144.0 2 TGATGTG 10 0.006973645 144.0 5 >>END_MODULE Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343731 READS because READLEN < 1 Read 343731 spots for SRR8635273.sra Written 343731 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra Rejected 343714 READS because READLEN < 1 Read 343714 spots for SRR8635273.sra Written 343714 spots for SRR8635273.sra SRR ids: ['SRR8635273.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1ecd07am SRR8635273.sra spots: 6874297 blocks: [[1, 343714], [343715, 687428], [687429, 1031142], [1031143, 1374856], [1374857, 1718570], [1718571, 2062284], [2062285, 2405998], [2405999, 2749712], [2749713, 3093426], [3093427, 3437140], [3437141, 3780854], [3780855, 4124568], [4124569, 4468282], [4468283, 4811996], [4811997, 5155710], [5155711, 5499424], [5499425, 5843138], [5843139, 6186852], [6186853, 6530566], [6530567, 6874297]] SRR8635273 file size 2300451 SRR8635273 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635273 SRR8635273_1.fastq Input file: SRR8635273_1.fastq trimmed: SRR8635273-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:19:27 2024 >> started Mon Dec 9 12:19:39 2024 >> done (11.391s) 6874297 reads processed; of these: 176 ( 0.00%) short reads filtered out after trimming by size control 68 ( 0.00%) empty reads filtered out after trimming by size control 6874053 (100.00%) reads available; of these: 1174392 (17.08%) trimmed reads available after processing 5699661 (82.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 67 0.00% 19 122 0.00% 20 126 0.00% 21 176 0.00% 22 196 0.00% 23 266 0.00% 24 293 0.00% 25 273 0.00% 26 282 0.00% 27 245 0.00% 28 293 0.00% 29 330 0.00% 30 321 0.00% 31 330 0.00% 32 348 0.01% 33 337 0.00% 34 359 0.01% 35 336 0.00% 36 380 0.01% 37 391 0.01% 38 435 0.01% 39 459 0.01% 40 428 0.01% 41 433 0.01% 42 449 0.01% 43 481 0.01% 44 476 0.01% 45 530 0.01% 46 612 0.01% 47 579 0.01% 48 664 0.01% 49 707 0.01% 50 775 0.01% 51 904 0.01% 52 945 0.01% 53 1110 0.02% 54 1244 0.02% 55 1440 0.02% 56 1501 0.02% 57 1643 0.02% 58 1834 0.03% 59 1842 0.03% 60 2081 0.03% 61 2180 0.03% 62 2257 0.03% 63 2289 0.03% 64 2496 0.04% 65 2591 0.04% 66 2879 0.04% 67 2894 0.04% 68 3070 0.04% 69 3281 0.05% 70 3783 0.06% 71 4180 0.06% 72 4311 0.06% 73 4558 0.07% 74 4891 0.07% 75 5170 0.08% 76 5609 0.08% 77 6023 0.09% 78 6390 0.09% 79 6913 0.10% 80 7450 0.11% 81 8302 0.12% 82 8690 0.13% 83 9309 0.14% 84 9895 0.14% 85 10312 0.15% 86 10777 0.16% 87 11235 0.16% 88 11864 0.17% 89 12490 0.18% 90 13203 0.19% 91 13821 0.20% 92 14219 0.21% 93 14512 0.21% 94 15026 0.22% 95 16322 0.24% 96 16673 0.24% 97 16934 0.25% 98 17357 0.25% 99 17903 0.26% 100 18648 0.27% 101 19128 0.28% 102 19999 0.29% 103 20952 0.30% 104 20997 0.31% 105 21287 0.31% 106 21833 0.32% 107 22201 0.32% 108 22715 0.33% 109 23221 0.34% 110 23799 0.35% 111 24780 0.36% 112 25127 0.37% 113 25878 0.38% 114 25885 0.38% 115 27489 0.40% 116 28649 0.42% 117 28679 0.42% 118 18164 0.26% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 1 0.00% 126 0 0.00% 127 0 0.00% 128 1 0.00% 129 1 0.00% 130 1 0.00% 131 4 0.00% 132 5 0.00% 133 11 0.00% 134 10 0.00% 135 21 0.00% 136 51 0.00% 137 59 0.00% 138 115 0.00% 139 169 0.00% 140 285 0.00% 141 608 0.01% 142 1028 0.01% 143 2072 0.03% 144 3804 0.06% 145 7107 0.10% 146 13786 0.20% 147 31546 0.46% 148 82819 1.20% 149 232355 3.38% 150 5699661 82.92% 6874053 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=37 prefix-density=0.33 prefix-fanout=2.9 sequence=ATGAATAAGTGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=214.80 fanout-score-rank=1 prefix-density=1.66 prefix-fanout=3.9 sequence=CTGCTGCTGGATGTATCTCTGATTAATGAGTTGCTGCTCTTTAGAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAA Started job on | Dec 09 12:21:34 Started mapping on | Dec 09 12:21:34 Finished on | Dec 09 12:22:15 Mapping speed, Million of reads per hour | 603.58 Number of input reads | 6874053 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 5621072 Uniquely mapped reads % | 81.77% Average mapped length | 129.61 Number of splices: Total | 309890 Number of splices: Annotated (sjdb) | 204772 Number of splices: GT/AG | 240352 Number of splices: GC/AG | 6104 Number of splices: AT/AC | 367 Number of splices: Non-canonical | 63067 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351140 % of reads mapped to multiple loci | 5.11% Number of reads mapped to too many loci | 173899 % of reads mapped to too many loci | 2.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.25% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 901841 901841 901841 N_multimapping 351140 351140 351140 N_noFeature 341833 402270 5412182 N_ambiguous 164978 18504 891 UnstrandedReadsAssigned:5114261 PositiveStrandReadsAssigned:5200298 NegativeStrandReadsAssigned:207999 Dataset is classified positive stranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR8635273 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635273-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,874,053 reads, 5,614,190 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52973 SRR8635273.ke.tsv 35125 SRR8635273.se.tsv 88098 total ==> SRR8635273.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 99 17.9147 PNS24243 293 194 0 0 KQK14069 1603 1504 3141.34 518.556 KQK14071 474 375 0 0 ==> SRR8635273.se.tsv <== BRADI_1g14170v3 2457 BRADI_1g53295v3 40 BRADI_1g59795v3 133 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 119 BRADI_1g74790v3 46 BRADI_1g09890v3 7 BRADI_1g77505v3 113 BRADI_1g48960v3 1 SRR8635273 completed mapping pipeline successfully