Starting /dee2/code/volunteer_pipeline.sh SRR8635274 current disk space = 1525947666432 free memory = 1427006616 SRR8635274 SRAfilesize 28afde761b57d6123ec547e8f9162c22 SRR8635274.sra SRR8635274.sra file validated SRR8635274 is single end SRR8635274 is conventional basespace SRR8635274 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8635274_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 40 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5075 32.0 32.0 32.0 27.0 32.0 2 30.7175 32.0 32.0 32.0 27.0 32.0 3 32.6075 32.0 32.0 37.0 32.0 37.0 4 33.41375 37.0 32.0 37.0 27.0 37.0 5 34.03625 37.0 32.0 37.0 27.0 37.0 6 36.56475 37.0 37.0 41.0 27.0 41.0 7 37.80575 41.0 37.0 41.0 32.0 41.0 8 38.27625 41.0 37.0 41.0 32.0 41.0 9 38.34925 41.0 37.0 41.0 32.0 41.0 10-14 38.7881 41.0 37.8 41.0 34.0 41.0 15-19 38.5675 41.0 38.6 41.0 33.0 41.0 20-24 38.00170000000001 41.0 37.0 41.0 31.0 41.0 25-29 37.77034999999999 41.0 37.0 41.0 29.0 41.0 30-34 37.40065 41.0 37.0 41.0 28.0 41.0 35-39 37.9295 41.0 37.0 41.0 32.0 41.0 40-44 37.60985 41.0 37.0 41.0 30.0 41.0 45-49 37.7541 41.0 37.0 41.0 30.0 41.0 50-54 35.70909999999999 39.4 34.0 41.0 21.0 41.0 55-59 36.273900000000005 41.0 36.0 41.0 26.0 41.0 60-64 34.94755 38.6 33.0 41.0 22.0 41.0 65-69 34.7128 37.0 32.0 41.0 20.0 41.0 70-74 35.586850000000005 38.6 34.0 41.0 23.0 41.0 75-79 33.96775 36.0 31.0 40.2 20.0 41.0 80-84 35.07355 37.0 32.0 41.0 20.0 41.0 85-89 35.0394 37.0 32.0 41.0 21.0 41.0 90-94 33.96135 37.0 31.0 41.0 18.0 41.0 95-99 31.52245 35.0 27.0 41.0 12.0 41.0 100-104 30.8356 35.0 27.0 40.2 12.0 41.0 105-109 29.886200000000002 32.0 22.0 37.8 12.0 41.0 110-114 27.951599999999996 30.0 20.0 37.0 12.0 41.0 115-119 26.21 26.0 16.0 35.0 11.2 40.2 120-124 20.097199999999997 18.0 12.0 26.0 10.4 34.0 125-129 18.472450000000002 14.0 12.0 25.0 9.6 33.0 130-134 19.2485 18.0 12.0 24.0 11.2 33.0 135-139 16.95 12.0 12.0 23.0 8.8 29.0 140-144 14.055449999999999 12.0 12.0 16.0 8.0 23.0 145-149 14.3676 12.0 12.0 16.0 8.0 23.0 150 13.307 12.0 12.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 10.0 20 26.0 21 28.0 22 42.0 23 72.0 24 97.0 25 136.0 26 168.0 27 188.0 28 263.0 29 267.0 30 366.0 31 417.0 32 468.0 33 516.0 34 468.0 35 294.0 36 140.0 37 25.0 38 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.3 14.75 31.825 12.125 2 42.275 15.675 28.799999999999997 13.25 3 42.375 16.1 28.425 13.100000000000001 4 42.475 16.375 28.425 12.725 5 37.2 16.7 28.449999999999996 17.65 6 39.7 15.0 30.975 14.325 7 40.475 15.9 28.95 14.674999999999999 8 38.074999999999996 15.174999999999999 29.95 16.8 9 35.125 16.025 32.275 16.575 10-14 29.325000000000003 21.57 33.035 16.07 15-19 24.495 25.06 32.01 18.435000000000002 20-24 24.995 25.045 30.885 19.075 25-29 24.285 24.740000000000002 31.264999999999997 19.71 30-34 24.12 24.545 32.305 19.03 35-39 23.724999999999998 25.185000000000002 31.840000000000003 19.25 40-44 23.84 25.115 32.07 18.975 45-49 22.625 26.69 31.369999999999997 19.314999999999998 50-54 22.105 27.655 31.245 18.995 55-59 21.985 27.68 31.619999999999997 18.715 60-64 22.43 28.155 31.005 18.41 65-69 22.075 29.665000000000003 29.909999999999997 18.35 70-74 20.974999999999998 30.98 30.095 17.95 75-79 20.27 32.635 29.115000000000002 17.98 80-84 20.585 34.06 27.875 17.48 85-89 19.945 35.11 27.889999999999997 17.055 90-94 19.96 35.57 27.77 16.7 95-99 19.625 36.845 26.405 17.125 100-104 19.040000000000003 37.93 25.174999999999997 17.854999999999997 105-109 19.74 37.55 25.430000000000003 17.28 110-114 19.1 38.525 25.185000000000002 17.19 115-119 19.689999999999998 37.585 24.725 18.0 120-124 21.7 35.945 24.915000000000003 17.44 125-129 20.18 36.91 24.575 18.335 130-134 19.54 38.795 23.61 18.055 135-139 20.200000000000003 37.375 24.545 17.88 140-144 21.945 35.305 25.759999999999998 16.99 145-149 21.025 34.75 26.375 17.849999999999998 150 23.1 37.525 23.7 15.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 2.0 6 4.0 7 4.5 8 5.5 9 4.5 10 4.0 11 4.5 12 4.0 13 4.5 14 5.0 15 5.0 16 6.5 17 11.5 18 15.0 19 13.0 20 11.5 21 13.0 22 11.5 23 10.5 24 14.5 25 18.5 26 23.0 27 26.5 28 29.5 29 35.5 30 48.0 31 63.0 32 86.0 33 99.5 34 102.0 35 123.0 36 138.0 37 146.5 38 161.5 39 182.5 40 215.5 41 215.5 42 196.0 43 191.5 44 180.0 45 186.5 46 172.5 47 135.5 48 132.5 49 107.5 50 83.5 51 83.0 52 72.0 53 77.5 54 90.5 55 73.5 56 46.0 57 41.0 58 35.5 59 24.5 60 21.5 61 23.5 62 20.0 63 17.5 64 12.5 65 5.0 66 6.0 67 9.0 68 11.5 69 14.5 70 13.0 71 10.5 72 8.5 73 6.5 74 6.5 75 3.0 76 5.0 77 4.5 78 1.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.24946921443737 89.725 2 4.2993630573248405 8.1 3 0.3184713375796179 0.8999999999999999 4 0.07961783439490447 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02653927813163482 0.22499999999999998 >10 0.02653927813163482 0.75 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTAT 30 0.75 No Hit GGGTTTAGGTTGGGCTTCGGGCCATAGGGGTCCGTCTGTGTCATCCGTCT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.037500000000000006 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.16249999999999998 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.21250000000000002 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.3 0.0 0.0 0.0 0.0 42-43 0.3 0.0 0.0 0.0 0.0 44-45 0.3 0.0 0.0 0.0 0.0 46-47 0.32499999999999996 0.0 0.0 0.0 0.0 48-49 0.35 0.0 0.0 0.0 0.0 50-51 0.3625 0.0 0.0 0.0 0.0 52-53 0.375 0.0 0.0 0.0 0.0 54-55 0.4 0.0 0.0 0.0 0.0 56-57 0.4 0.0 0.0 0.0 0.0 58-59 0.475 0.0 0.0 0.0 0.0 60-61 0.575 0.0 0.0 0.0 0.0 62-63 0.6375 0.0 0.0 0.0 0.0 64-65 0.7625 0.0 0.0 0.0 0.0 66-67 0.8 0.0 0.0 0.0 0.0 68-69 0.8875 0.0 0.0 0.0 0.0 70-71 1.0 0.0 0.0 0.0 0.0 72-73 1.1 0.0 0.0 0.0 0.0 74-75 1.1749999999999998 0.0 0.0 0.0 0.0 76-77 1.35 0.0 0.0 0.0 0.0 78-79 1.4874999999999998 0.0 0.0 0.0 0.0 80-81 1.6875 0.0 0.0 0.0 0.0 82-83 1.8875 0.0 0.0 0.0 0.0 84-85 2.15 0.0 0.0 0.0 0.0 86-87 2.45 0.0 0.0 0.0 0.0 88-89 2.8375000000000004 0.0 0.0 0.0 0.0 90-91 3.2 0.0 0.0 0.0 0.0 92-93 3.575 0.0 0.0 0.0 0.0 94-95 4.012499999999999 0.0 0.0 0.0 0.0 96-97 4.4 0.0 0.0 0.0 0.0 98-99 4.75 0.0 0.0 0.0 0.0 100-101 4.9625 0.0 0.0 0.0 0.0 102-103 5.2375 0.0 0.0 0.0 0.0 104-105 5.6625 0.0 0.0 0.0 0.0 106-107 6.275 0.0 0.0 0.0 0.0 108-109 6.5625 0.0 0.0 0.0 0.0 110-111 6.8375 0.0 0.0 0.0 0.0 112-113 7.025 0.0 0.0 0.0 0.0 114-115 7.2125 0.0 0.0 0.0 0.0 116-117 7.375 0.0 0.0 0.0 0.0 118-119 7.4625 0.0 0.0 0.0 0.0 120-121 7.7 0.0 0.0 0.0 0.0 122-123 7.8375 0.0 0.0 0.0 0.0 124-125 7.925000000000001 0.0 0.0 0.0 0.0 126-127 8.0625 0.0 0.0 0.0 0.0 128-129 8.162500000000001 0.0 0.0 0.0 0.0 130-131 8.225 0.0 0.0 0.0 0.0 132-133 8.2625 0.0 0.0 0.0 0.0 134-135 8.287500000000001 0.0 0.0 0.0 0.0 136-137 8.412500000000001 0.0 0.0 0.0 0.0 138 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGAAC 10 0.006973645 144.0 9 ATGGTCG 10 0.006973645 144.0 5 CCATGAA 10 0.006973645 144.0 8 CATGTCT 10 0.006973645 144.0 7 GATGGTC 10 0.006973645 144.0 4 AGAAAAA 40 0.007966741 18.0 120-124 >>END_MODULE Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201812 READS because READLEN < 1 Read 201812 spots for SRR8635274.sra Written 201812 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra Rejected 201796 READS because READLEN < 1 Read 201796 spots for SRR8635274.sra Written 201796 spots for SRR8635274.sra SRR ids: ['SRR8635274.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bkbp36mf SRR8635274.sra spots: 4035936 blocks: [[1, 201796], [201797, 403592], [403593, 605388], [605389, 807184], [807185, 1008980], [1008981, 1210776], [1210777, 1412572], [1412573, 1614368], [1614369, 1816164], [1816165, 2017960], [2017961, 2219756], [2219757, 2421552], [2421553, 2623348], [2623349, 2825144], [2825145, 3026940], [3026941, 3228736], [3228737, 3430532], [3430533, 3632328], [3632329, 3834124], [3834125, 4035936]] SRR8635274 file size 1349711 SRR8635274 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8635274 SRR8635274_1.fastq Input file: SRR8635274_1.fastq trimmed: SRR8635274-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 12:23:31 2024 >> started Mon Dec 9 12:23:44 2024 >> done (12.282s) 4035936 reads processed; of these: 127 ( 0.00%) short reads filtered out after trimming by size control 40 ( 0.00%) empty reads filtered out after trimming by size control 4035769 (100.00%) reads available; of these: 703183 (17.42%) trimmed reads available after processing 3332586 (82.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 46 0.00% 19 87 0.00% 20 134 0.00% 21 137 0.00% 22 226 0.01% 23 235 0.01% 24 206 0.01% 25 262 0.01% 26 218 0.01% 27 230 0.01% 28 235 0.01% 29 294 0.01% 30 281 0.01% 31 283 0.01% 32 263 0.01% 33 243 0.01% 34 266 0.01% 35 275 0.01% 36 273 0.01% 37 322 0.01% 38 301 0.01% 39 344 0.01% 40 332 0.01% 41 331 0.01% 42 357 0.01% 43 348 0.01% 44 370 0.01% 45 374 0.01% 46 414 0.01% 47 442 0.01% 48 518 0.01% 49 525 0.01% 50 549 0.01% 51 635 0.02% 52 720 0.02% 53 817 0.02% 54 937 0.02% 55 1046 0.03% 56 1055 0.03% 57 1178 0.03% 58 1256 0.03% 59 1331 0.03% 60 1425 0.04% 61 1559 0.04% 62 1683 0.04% 63 1675 0.04% 64 1773 0.04% 65 1792 0.04% 66 1930 0.05% 67 2004 0.05% 68 2292 0.06% 69 2402 0.06% 70 2559 0.06% 71 2844 0.07% 72 3039 0.08% 73 3294 0.08% 74 3477 0.09% 75 3635 0.09% 76 3818 0.09% 77 4082 0.10% 78 4430 0.11% 79 4760 0.12% 80 5295 0.13% 81 5684 0.14% 82 6069 0.15% 83 6489 0.16% 84 6536 0.16% 85 6860 0.17% 86 7084 0.18% 87 7569 0.19% 88 7791 0.19% 89 8193 0.20% 90 8372 0.21% 91 8918 0.22% 92 9153 0.23% 93 9409 0.23% 94 9750 0.24% 95 9740 0.24% 96 10241 0.25% 97 10457 0.26% 98 10589 0.26% 99 10818 0.27% 100 11442 0.28% 101 11406 0.28% 102 11643 0.29% 103 12181 0.30% 104 12206 0.30% 105 12639 0.31% 106 12433 0.31% 107 12649 0.31% 108 13218 0.33% 109 13524 0.34% 110 13752 0.34% 111 14094 0.35% 112 13974 0.35% 113 14321 0.35% 114 14600 0.36% 115 15388 0.38% 116 16048 0.40% 117 16213 0.40% 118 10211 0.25% 119 0 0.00% 120 0 0.00% 121 0 0.00% 122 0 0.00% 123 0 0.00% 124 0 0.00% 125 0 0.00% 126 0 0.00% 127 0 0.00% 128 0 0.00% 129 1 0.00% 130 0 0.00% 131 0 0.00% 132 0 0.00% 133 3 0.00% 134 5 0.00% 135 8 0.00% 136 12 0.00% 137 36 0.00% 138 41 0.00% 139 98 0.00% 140 177 0.00% 141 316 0.01% 142 564 0.01% 143 1091 0.03% 144 2074 0.05% 145 4031 0.10% 146 7948 0.20% 147 18185 0.45% 148 46892 1.16% 149 131573 3.26% 150 3332586 82.58% 4035769 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=37 prefix-density=0.31 prefix-fanout=2.8 sequence=ATGAATAAGTGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=212.07 fanout-score-rank=1 prefix-density=1.53 prefix-fanout=3.7 sequence=CTGCTGCTGGATGTATCTCTGATTAATGAGTTGCTGCTCTTTAGAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAATACTTTAAGCACCT Started job on | Dec 09 12:26:43 Started mapping on | Dec 09 12:26:43 Finished on | Dec 09 12:28:19 Mapping speed, Million of reads per hour | 151.34 Number of input reads | 4035769 Average input read length | 143 UNIQUE READS: Uniquely mapped reads number | 3044988 Uniquely mapped reads % | 75.45% Average mapped length | 131.57 Number of splices: Total | 189660 Number of splices: Annotated (sjdb) | 126729 Number of splices: GT/AG | 149374 Number of splices: GC/AG | 3857 Number of splices: AT/AC | 151 Number of splices: Non-canonical | 36278 Mismatch rate per base, % | 0.61% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 236911 % of reads mapped to multiple loci | 5.87% Number of reads mapped to too many loci | 139168 % of reads mapped to too many loci | 3.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.71% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 753870 753870 753870 N_multimapping 236911 236911 236911 N_noFeature 193906 226533 2931956 N_ambiguous 90351 11211 527 UnstrandedReadsAssigned:2760731 PositiveStrandReadsAssigned:2807244 NegativeStrandReadsAssigned:112505 Dataset is classified positive stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8635274 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR8635274-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,035,769 reads, 3,147,885 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52973 SRR8635274.ke.tsv 35125 SRR8635274.se.tsv 88098 total ==> SRR8635274.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 72 23.2192 PNS24243 293 194 0 0 KQK14069 1603 1504 1459.91 429.484 KQK14071 474 375 2.033 2.39869 ==> SRR8635274.se.tsv <== BRADI_1g14170v3 1108 BRADI_1g53295v3 15 BRADI_1g59795v3 68 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 66 BRADI_1g74790v3 27 BRADI_1g09890v3 3 BRADI_1g77505v3 71 BRADI_1g48960v3 0 SRR8635274 completed mapping pipeline successfully